The Role of the Bmi1-GSK3! pathway in Glioblastoma
Inauguraldissertation
zur
Erlangung der Würde eines Doktors der Philosophie vorgelegt der
Philosophish-Naturwissenschaftlichen Fakultät der Universität Basel
Von
Serdar Korur von Edirne, Türkei
Basel, 2010
Genehmigt von der Philosophisch-Naturwisseschaftlichen Fakultät
auf Antrag von Prof. Heinrich Reichert, Prof. Adrian Merlo, Prof. Ruth Chiquet- Ehrismann und Dr. Brian Hemmings.
Basel, den 13. Oktober 2009
Prof. Dr. Eberhard Parlow Dekan
Table of contents
SUMMARY ... 2
1. INTRODUCTION ... 3
1.1. Cancer... 3
1.2. Cancer stem cells... 5
1.3. General features of brain tumors ... 8
1.4. Glioblastoma ... 9
1.5. Main pathways affected... 12
1.6. Glycogen synthase kinase 3 pathway ... 14
1.7. Bmi1 pathway ... 15
1.8. Combinatorial therapies to overcome therapeutic resistance ... 16
2.RESULTS ... 18
Part 1: GSK3! regulates differentiation and growth arrest in glioblastoma ... 18
Part 2: Combination of sublethal concentrations of epidermal growth factor receptor inhibitor and microtubule stabilizer induces apoptosis of glioblastoma cells... 58
Part 3: Histone deacetylase inhibition and blockade of the glycolytic pathway synergistically induce glioblastoma cell death... 68
3. FUTURE PERSPECTIVES... 78
REFERENCES... 86
ABBREVIATIONS ... 103
ACKNOWLEDGEMENTS ... 104
2
Summary
Malignant gliomas remain one of the deadliest of all cancers despite maximal therapy. They present unique challenges to therapy with a median survival of 12 months.
Simultaneous activation of several growth promoting and anti-apoptotic pathways represents the basis for the failure of monotherapies against this disease. In order to efficiently block growth of glioblastoma (GBM) cells, we have applied several combinatorial approaches. We have found that combination of histone deactylase inhibitors along with the glycolytic inhibitor 2-deoxyglucose (2DG) efficiently induced apoptosis in GBM cells. Furthermore, combination of the microtubule inhibitor patupilone and AEE788 –an inhibitor of EGFR, which is frequently activated in gliomas, induced apoptosis in GBM cells at doses that as single drugs were not effective. In GBM and other cancers, subpopulations of tumor cells with stem cell properties that are believed to constitute a tumor cell reservoir, have been identified. GBM cells frequently express the progenitor cell markers Nestin and Sox2 and low levels of the differentiation markers CNPase, GFAP and !-tubulin III. Bmi1 and Glycogen synthase kinase 3 (GSK3) has been implicated in stem cell maintenance, but how Bmi1 regulates differentiation is still unknown. We have identified a link between Bmi1 and GSK3 and showed that blocking GSK3 may be instrumental to reduce the GBM cancer stem cell pool. We found that the GSK3 inhibitors SB216763 as well as Lithium chloride depleted the cancer stem cell population in GBM cells and induced tumor cell differentiation, irrespective of the CD133 status. Cell proliferation and colony formation were markedly reduced in a dose- dependent manner.
Future work giving a deeper insight into the regulatory mechanisms of the receptor tyrosine kinases and downstream effectors will help us to identify more specific targets. Understanding the mechanisms why some targeted therapies work and others fail will finally bring us to the level that efficient long-term treatment strategies can be envisaged.
3
1. Introduction
1.1. Cancer
Cancer is the main cause of death after circulatory diseases in western societies, estimated to be the cause of death in one quarter of the population in the EU (Niederlaender, 2006). In spite of the advances in the understanding of the molecular biology of cancer and of the development of novel therapeutics, cancer remains one of the deadliest of all diseases (Maher et al., 2001). Critical factors are to be identified prior to the successful introduction of therapeutic interventions.
Cancer can be viewed as the backside of evolution, which maximizes the probability of an organism to survive in a hostile environment (Maynard Smith and Szathmáry, 1995). Life originated in an environment with dramatically changing conditions, caused in part by exposure to toxic chemical compounds and by continuous ultraviolet and gamma-radiation (Maynard Smith and Szathmáry, 1995; Ridley, 1993). In order to maintain survival and stability, cells had to repair damage induced by external forces, endogenous metabolic toxins and reactive oxygen species, formed during normal metabolism. On the other hand, precise cellular repair systems would not allow genetic variation of the gene pool and thus, will lead to lack of adaptability (Maynard Smith, 1989). Perfect organisms with a constant gene pool over their lifetime might extinct when exposed to a different environmental parameter. Optimal organisms are formed by a trade-off between genetic variability and stability, which includes the risk of acquiring mutations that can give rise to cancer (Ridley, 1993). Those mutations may result in formation of cells that ultimately break the most basic rules of the organism and exploit every possibility of cellular regulatory pathways in order to proliferate indefinitely. The huge research effort to understand and combat cancer has tremendously increased the general knowledge in cell biology, as most of the cancer genes discovered play an important role in pathways regulating DNA repair, cell signaling, cell cycle, programmed
4
cell death and tissue architecture (Alberts, 2002). Normal cells have to receive and interpret an elaborate set of signals for the good of the organism, and damaged cells must be sacrificed in order to maintain stability of the organism. Only a few cells that can evade those protective mechanisms may constitute the candidate cancer initiating cells.
Those cells may further develop through a microevolutionary process governed by several mutations, each conferring a growth advantage progressively leading to a selection of ever more aggressive clones (Nowell, 1976). As a result, cancer cells gain the ability to reproduce without restraint and colonize foreign tissues leading to death of the organism by eventually causing malfunctioning of a vital organ (Knudson, 2001;
Knudson, 1971; Friend et al., 1986).
A fundamental feature of most cancer cells is that they are genetically unstable and have high mutation rate caused by impaired DNA repair systems and increased replication errors paving the way to the microevolutionary selection process. The fact that cancer is a multistep process is reflected by the requirements needed by a cell to be capable of cancerous growth (Alberts, 2002; Hanahan and Weinberg, 2000):
1. Insensitivity to extrinsic and intrinsic signals regulating cell proliferation 2. Evasion of apoptosis
3. Ability to overcome replicative senescense and avoid differentiation inducing signals 4. Genetic instability
5. Invasion
6. Survival in foreign sites.
Genetic alterations needed to push normal cells to a cancerous state can be induced in different ways: i) direct environmental factors (e.g. radiation) ii) genetic susceptibility to certain environmental factors (e.g. haploinsufficency of a gene involved in DNA repair) iii) induction by genetic factors (e.g. presence of an oncogenic mutation in the germline). Environmental factors might directly induce genetic alterations that target genes involved in the regulation of the cell cycle, survival and genome integrity (e.g. induction DNA adducts by cigarette smoking). Main environmental factors leading to cancers are cigarette smoking (Witschi et al., 1995), UV-light (Fisher and Kripke,
5
2002) nuclear accidents, nuclear bombs (Little, 2000), and certain chemicals that industrial workers are exposed to (e.g. asbestos, benzene, benzidine, vinyl chloride etc.) (Jameson, 2000). On the other hand, alterations in genes involved in cancer might already be present in germline causing inherited cancer syndromes. Genetic studies of families with inherited cancer syndromes have led to the identification of many important genes.
Among those familial diseases, Li-Fraumeni syndrome (p53), Retinoblastoma (Rb), neurofibromatosis (NF1 and NF2), Breast cancer (BRCA1), Colorectal cancer (APC), Von-Hippel Lindau syndrome (VHL), Wilms tumor (WT1-4), Xeroderma pigmentosum (XP genes), Ataxia-telengiectasia (ATM) and Bloom syndrome (BLM) (Fearon, 1997) represent typical examples. Mutations can also occur in somatic cells, causing sporadic forms of cancers, which constitutes the majority. Rb (Friend et al., 1986; He et al., 1995), p16/p14 (Merlo et al., 1995; Labuhn et al., 2001) p27 (Alleyne et al., 1999) and HDM2 (Vogelstein and Kinzler, 2004) are examples of those genes that, when mutated, are able to equip the cells with a growth advantage and induce the cancerous process.
1.2. Cancer stem cells
What are the normal cells of origin of cancer and why is this question so important? The cancer-initiating cell could be a normal stem cell, a progenitor cell, or a differentiated cell. This question was highly debated in recent years after the discovery of cancer stem cells in leukemia (Lapidot et al., 1994) that was followed by the identification of cancer stem cells in numerous solid tumors including glioblastoma (Ignatova et al., 2002; Lochhead et al., 2001; Singh et al., 2003; Singh et al., 2004; Al- Hajj et al., 2003; Gibbs et al., 2005; O'Brien et al., 2007; Ricci-Vitiani et al., 2007; Xin et al., 2005; Burger et al., 2005). The failure to eradicate cancer may be as fundamental as a misidentification of the target. Identification of a defined cell that could function as a therapeutic target would facilitate development of successful treatment strategies (Figure 1). Conventional non-specific cancer treatments such as chemotherapy and radiotherapy, which act on all dividing cells, usually fail, and the disease recurs.
6
One of the most typical and interesting features of stem cells is the self-renewal characteristic that is also found in the cancer cells. Tumors might arise from the transformation of normal stem cells into cancer cells since they share many genetic and phenotypic features (Austin and Kimble, 1987; Bhardwaj et al., 2001; Chan et al., 1999;
Ellisen et al., 1991; Gailani and Bale, 1999; Henrique et al., 1997; Korinek et al., 1998;
Polakis, 2000; Varnum-Finney et al., 2000; Wechsler-Reya and Scott, 2001; Wechsler- Reya and Scott, 1999; Zhang and Kalderon, 2001; Zhu and Watt, 1999; Figure 2). Those cancer initiating cells are the driving force behind tumor propagation as well as the critical mediators of both drug- and radiation resistance (Visvader and Lindeman, 2008) and the reason behind the failure of conventional therapies.
Figure 1: Tumors are maintained and driven by a rare population of cancer cells termed – cancer stem cells. Conventional therapies may kill tumor cells with limited proliferative potential but if the cancer stem cells remain viable they will reform the tumor. On the other hand, cancer stem cell specific therapies may lead to cures by extinguishing renewal potential of the tumor (Reya et al., 2001).
7
Singh and colleagues were able to identify CD133 (also known as Prominin 1) as a surface marker of cancer stem cells in brain tumors. As few as 100 of these CD133- positive cells found to be able to induce tumors in transplantation experiments and yielded phenocopies of the initial neoplasia (Singh et al., 2003; Singh et al., 2004). The expression of multi drug resistance proteins (Dean et al., 2005) and efficient DNA repair mechanisms (Bao et al., 2006) render CD133-positive cells highly resistant to chemo- and radiotherapeutic regimens. However, CD133 may not be a reliable stem cell marker for brain tumors as recent studies showed CD133-negative cells that are able to form tumors in immunocompromised mice. The other hypothesis consists of the concept that an adult astrocyte can dedifferentiate becoming a cancer cell as shown in an animal model (Bachoo et al., 2002). If cancer originates from cancer stem cells then any successful therapy will have to also eradicate this tumor promoting cell population to prevent recurrence.
Figure 2: Several signaling pathways regulating normal stem cells found to be deregulated in cancer (Reya et al., 2001)
8 1.3. General features of brain tumors
Any brain tumor having the histological, immunohistochemical and ultrastructural proof of glial cell differentiation is defined as ”glioma”. Gliomas are classified into different groups according to their degree of malignancy. The most widely accepted classification sytem is based on World Health Organization (WHO), which classifies glial tumors into four basic grades (I-IV astrocytoma) according to the degree of malignancy defined by histopathological criteria. Grade I gliomas are usually benign, well circumscribed and seldom progress into more advanced stages, whereas grades II to IV are malignant and readily infiltrative into the brain parenychma. Survival ranges from 3 to 10 years in low-grade astrocytoma (grade II) from 2 to 5 years in Grade III anaplastic astrocytomas, and about 1 year in grade IV tumors also known as glioblastomas (GBM) (Maher et al., 2001). In Switzerland the incidence rate per 100,000 population/year, was estimated as 3.32 in males and 2.24 in females (Ohgaki et al., 2004).
The blood-brain barrier (BBB) is an important cellular structure that prevents toxic substances from entering the brain and allows passage of nutrients and small compounds. On the other hand, it constitutes a major obstacle to the delivery of pharmacological agents into the tumor tissue, an important problem in the treatment of brain tumors (Sathornsumetee et al., 2007). The blood-brain barrier is formed by the tight junctions made by endothelial cells, other vascular cells and astrocytic foot processes and involves several active efflux transport systems including the prototype member P- glycoprotein (P-gp) (Pardridge, 2003). Drugs that could have been invaluable for the treatment of brain tumors either fail to pass the BBB or fail to pass blood-tumor barrier, which is limited by the fact that tumors have a high interstitial pressure (Boucher et al., 1997). 100% of large molecular and 98% of small molecular drugs do not cross the BBB.
Another approach to overcome BBB is a bur hole-based drug delivery via intracerebral catheters (Merlo et al., 1999). Although those methods might efficiently supply drugs into the tumor bed, they may not readily target metastatic cells as the diffusion of the drugs to other areas of the brain than the tumor could be limited. A further development is direct intra-tumoral injection of small peptides that are distributed in the tumor mass
9
prior to resection (Kneifel et al., 2006). Efficient BBB drug targeting strategies can be built with the knowledge of the endogenous transporters within the brain capillary endothelium. The development of novel carrier molecules such as conjugating a tumor- targeting domain to a protein that can bind to molecules expressed on the BBB, and mediating their entry into tissue are strongly needed.
1.4. Glioblastoma
Glioblastoma (GBM) is the most frequent and most aggressive type of primary brain tumor in humans, accounting approximately for 50% of all tumors of glial origin and 20% of all intracranial tumors (Louis et al., 2007). Any disease with prevalence of less then 50 in 100.000 is classified as an orphan disease. Those diseases have not often been adopted by the pharmaceutical industry, as the number of patients affected is too low to make the drug-development cost-effective. Glioblastoma belongs to this class of diseases with an occurence of about 5-10 per 100,000 persons (Rich et al., 2004).
Malignant gliomas present unique challenges to therapy and remain one of the deadliest of all cancers with a median survival of 12 months. Even in the most favorable cases patients die within two years (Deorah et al., 2006). The duration of survival associated with malignant gliomas has improved only minimally despite tremendous efforts of therapy and improvement in the understanding of the molecular biology of cancer and in molecular medicine in the last decades (Rich and Bigner, 2004). Unique challenges in combating GBM are associated with; i) high vulnerability of the tissue where the tumor mass resides ii) diffuse invasiveness of tumor cells into the adjacent brain parenchyma iii) recurrence of the disease by rapid growth of the infiltrating cells (Merlo, 2003), resulting in very poor prognosis. GBM can manifest as de novo lesion (primary GBM, >90%) or progress from less undifferentiated low-grade astrocytoma (secondary GBM) (Ohgaki and Kleihues, 2007). Primary GBM usually develops in older patients as a highly aggressive and invasive de novo lesion, without any clinical or histological evidence of a less malignant precursor lesion. Secondary GBM manifest in
10
younger patients and develop through progression from low-grade to high-grade astrocytoma in a time range of 5 to 10 years. Although there are common pathways employed, primary and secondary GBMs develop through distinct molecular pathways (Collins, 1998; Rasheed et al., 1999). Primary GBM manifests with loss of heterozygosity at 10q (70% of cases), EGFR amplification (36%), p16INK4a deletion (31%) and PTEN mutations (25%). On the other hand, in secondary GBM etiology TP53 mutations are the most frequent and earliest detectable genetic alterations, already present in 60% of precursor low-grade astrocytomas. Additionally, primary and secondary glioblastomas manifests significant differences in their pattern of promoter methylation and in expression profiles at RNA and protein levels. (Ohgaki and Kleihues, 2007; Maher et al., 2001; Wechsler-Reya and Scott, 2001; Zhu and Parada, 2002; Figure 3). Recently, in a cancer genome-sequencing project, the IDH1 gene was identified as a gene, which is somatically mutated predominantly in secondary glioblastomas (Parsons et al., 2008). It was later found that IDH1 mutations are a strong predictor of better prognosis and a highly selective molecular marker to distinguish primary glioblastomas from secondary glioblastomas that complements clinical findings (Nobusawa et al., 2009). The IDH1 gene which encodes isocitrate dehydrogenase (IDH) 1 catalyzes the oxidative carboxylation of isocitrate to "-ketoglutarate, resulting in the production of NADPH in the Krebs cycle (Devlin, 2006). IDH1 mutations dominantly inhibit the function of the enzyme through the production of catalytically inactive heterodimers (Zhao et al., 2009).
Further studies will provide molecular explanations for the role of IDH1 mutations in GBM.
It is predictable that the mutations occurring in the precursor cancer cell in primary GBM creates a much more unstable genetic background that facilitates further mutations which accelerates tumor growth by selection of more malignant clones (Nowell, 1976). In secondary GBM, specific founder mutations might cause milder instability and may require longer time lapse in order to gain further mutations to progress to a GBM (Ohgaki and Kleihues, 2007).
11
Standard therapy, including complete surgical resection is not successful because of the infiltrative behavior of the tumor cells, which already invade multiple parts of the brain during the progression of the disease even long before the time of the diagnosis.
Surgical intervention is usually followed by aggressive chemo- and radio-therapeutic regimens, which has proven limited efficacy because of i) the expression of multi-drug resistance proteins (Dean et al., 2005), ii) efficient DNA repair mechanisms of glioblastoma cells (Bao et al., 2006), iii) serious side effects induced from the therapy.
Identifying novel molecular targets, and therapeutical strategies with improved efficacy and reduced toxicity, are strongly demanded.
Figure 3: Genetic pathways to primary and secondary glioblastomas (Ohgaki and Kleihues, 2007).
12 1.5. Main pathways affected
Key cellular pathways, controlling apoptosis, cell cycle arrest, proliferation, survival and DNA repair are the most frequently disrupted pathways in GBM due to alterations in TP53, p16/p14, RB, PTEN, EGFR and PDGFR genes (Figure 4).
EGFR/PTEN/PKB pathway
Epidermal growth receptor (EGFR) is a key protein involved in the development of primary GBM (Kita et al., 2007), its overexpression occurs in about 60% of primary GBMs but rarely in secondary GBM (ca. 10%) (Dropcho and Soong, 1996). The most frequent mutant form is the constitutively active variant 3 (EGFRvIII) with the deletions of exons 2 to 7 (Huang et al., 1997). Activation of the EGF receptor in turn promotes cell proliferation in part through the suppression of the p27 gene via the PI3K/PKB pathway and partly due to the activation of the Ras/MAPK pathway (Narita et al., 2002). PKB activation due to the constitutive active EGFR results in increased cell proliferation and cell survival. LOH at chromosome 10 is the most frequent genetic alteration in GBM.
PTEN is located at chromosome 10 and negatively regulates PI3K by dephosphosphorylating phosphatidyl inositol triphosphate (PIP3). In PTEN mutant cells, PKB is hyperphosphorylated by PI3K (Maehama and Dixon, 2000) and this leads to increased proliferation and inhibition of apoptosis.
TP53/HDM2/p14ARF Pathway
The most frequent alteration found in diffuse astrocytoma is on the TP53 gene (60%). TP53 mutations are also found in primary GBM but at a lower frequency (ca.
30%) and with a different distribution pattern through the gene. In the cases where p53 is not mutated Hdm2 mutations have been detected (Maher et al., 2001) (less than 10% of GBM). In addition p14/arf is frequently deleted (76%) in GBM. Disruption of the p53 pathway leads to evasion of apoptosis and allows proliferation of damaged cells.
13 p16INK4a/RB1 Pathway
A hallmark of astrocytomas is the high mitotic activity, a characteristic shared also by primary and secondary GBM. Homozygous deletions of p16 is also frequently detected, it is deleted in 31% in primary GBM and 19% secondary GBM. Promoter methylation of RB1 gene occur 43% of secondary and in 14% of primary GBM (Ohgaki and Kleihues, 2007; Labuhn et al., 2001). RB1 and p16 tumor suppressor proteins control the progression through G1 to S phase of the cell cycle. Therefore inactivation of this pathway allows G1/S phase progression leading to high mitotic activity.
Despite many efforts, median survival of GBM patients has not improved more than a few months (Rich and Bigner, 2004). Thus, the development of specific bioactive molecules that selectively target and inhibit tumor initiation and propagation capacity of brain tumor stem cells might allow reduction or elimination of tumor establishment, growth and recurrence (Reya et al., 2001). The pursuit of novel agents that fulfill these criteria will allow a big leap towards successful treatment of brain tumor patients.
14
Figure 4: Main signaling pathways activated by growth factors. PI3K pathway and the MAP kinase pathway are indicated. Designed by Emmanuel Traunecker (mac_manus@hotmail.com)
1.6. Glycogen synthase kinase 3 pathway
Glycogen synthase kinase 3 serine/threonine kinase was first identified as an enzyme phosphorylating and inactivating glycogen synthase (Doble and Woodgett, 2003). Far behind its role in glycogen metabolism, further studies showed that GSK3 is a key protein in the regulation of numerous signaling pathways. It was shown to be inhibited in response to insulin signaling from PKB (Cross et al., 1995). It integrates several signaling pathways and regulates many aspects of cell behavior such as cell cycle, proliferation, differentiation and apoptosis (Cohen and Goedert, 2004; Doble and Woodgett, 2003). Two mammalian GSK3 isoforms are known: GSK3" and GSK3!.
15
Knocking out the GSK3! isoform in mice is embryonically lethal due to massive liver degeneration. The presence of the normal " isoform in the GSK3! #$ animals is not able to rescue the phenotype (Hoeflich et al., 2000) indicating that at least some of the functions of the two isoforms are not redundant. The two isoforms share 97% sequence similarity within their kinase domains, but differ significantly outside this region, with GSK3" containing an extended N-terminal glycine-rich tail (Frame and Cohen, 2001).
Controversial findings have been reported regarding the influence of GSK3 on the induction of apoptosis. GSK3 has been shown to act as a pro-survival factor in pancreatic cancer (Ougolkov et al., 2005) and as a proapoptotic factor in colorectal cancer (Tan et al., 2005). These opposite findings indicate that the biological function of GSK3 depends upon cellular context and microenvironment. Consequent to its key functions GSK3 is involved in the etiology of several diseases such as Alzheimer’s disease (Ryder et al., 2003), diabetes (Cline et al., 2002), bipolar disorder (Gould and Manji, 2002), and recently cancer (Wang et al., 2008b).
Pathways regulating normal stem cell behavior are also utilized by cancer cells.
GSK3 is involved in the regulation of Wnt (Miller and Moon, 1996; Yost et al., 1996);
(Polakis, 2000), Shh (Jia et al., 2002) and Notch pathways (Foltz et al., 2002) which are important for embryonic cell fate determination and normal stem cell maintenance.
Therefore we decided to investigate its role in brain tumor cell identity and maintenance of the cancer stem cell pool.
1.7. Bmi1 pathway
In the recent years it became evident that cancer is not only a disease due to genetic mutations but also epigenetic changes play a crucial role influencing malignant transition (Jones and Baylin, 2002). Maintenance of chromatin structure is essential for appropriate gene expression and every perturbation of the epigenetic regulations can lead to inappropriate gene expression and genomic instability, driving normal cells into a cancerous state. Polycomb group proteins are epigenetic gene silencers implicated in
16
neoplastic transformation. Bmi1, a member of the polycomb group (PcG) proteins is involved in brain development (Leung et al., 2004). PcG proteins maintain embryonic and adult stem cells by forming multiprotein complexes that function as transcriptional repressors (Park et al., 2003; Zencak et al., 2005; Liu et al., 2006). Bmi1 was first indentified as an oncogene due to its cooperation with Myc in lymphoma formation (Jacobs et al., 1999b). It has been shown to block senescence in immortalized mouse embryonic fibroblast through the repression of INK4A/Arf (Jacobs et al., 1999a) and it is amplified and/or overexpressed in non small cell lung cancer (Vonlanthen et al., 2001), colorectal carcinoma (Kim et al., 2006), medulloblastoma (Leung et al., 2004), lymphoma (Haupt et al., 1993), multiple myeloma (Matsui et al., 2004) and primary neuroblastoma (Nowak et al., 2006). Bmi1 regulates the Ink4a/Arf-locus that is a frequent target for homozygous deletions in glioblastoma. Whether Bmi1 is expressed in GBM is being debated (Leung et al., 2004) and its role in GBM is not well delineated. In a mouse glioma model, Bmi1 had been implicated in brain tumorigenesis in an Ink4a/Arf-independent manner (Bruggeman et al., 2007). In addition, it was recently shown that inhibition of Bmi1 by micro RNA-128 attenuates glioma cell proliferation and self renewal (Godlewski et al., 2008).
1.8. Combinatorial therapies to overcome therapeutic resistance
The glucose analog 2-deoxy glucose (2-DG) is a competitive inhibitor of glucose uptake and metabolism. Once entering the cells 2-DG is metabolized by the hexokinase to 2-deoxy glucose-6-phosphate (2-DG-6-P) which is not a substrate for glucose-6- phosphate dehydrogenase or phosphohexoisomerase (Wick et al., 1957), therefore cannot be further metabolized and accumulate in the cell until dephosphorylation by phosphatases. GBM cells are highly proliferative they rely on high sources of energy. A cardinal feature of glioblastoma cells is increased glucose uptake aided by high levels of hexokinase and glucose transporters. Most glioblastoma cells maintains a huge part of their energy supply from the glycolytic pathway as this pathways leads to faster production of ATP when compared to oxidative phosphorylation and in order to maintain their high growth and proliferation rates. Cancer cells can overcome drug effects by
17
turning on and off different genes to adapt changes in the environment, which requires ATP. Thus, blocking cells’ energy production machinery in combination with another cytotoxic drug might sensitize the effects of the therapeutics by not giving opportunity to turn on and off redundant pathways. Tertiary structure of chromatin is a crucial factor in determining whether a particular gene is expressed or not. The accessibility of DNA wrapped around nucleosomes determines how efficiently a gene can be transcribed. This is regulated in part by a series of chromatin modifying enzymes such as histone acetlytransferases (HATs) and histone deactylases (HDAs). The alterations in chromatin structure by mutations or aberrant transcription of genes involved in the control of histone modifications are key events in cancer initiation. Changes in chromatin structure might lead to silencing of tumor suppressor genes and activation of oncogenes leading to carcinogenic progression. Various structurally diverse compounds (such as TSA, SAHA, trapoxin A, Laq842, sodium butyrate) are available which can bind to histone deactylases (HDACs) and induce histone acetylation and consequent reactivation of 2-10% of all genes (Mariadason et al., 2000; Egler et al., 2008).
EGFR, activation is one of the most frequent alterations in primary GBM, resulting in simultaneous activation of PKB and RAS pathways (Barker et al., 2001). The failure to induce efficient cell death in GBM suggested additional crosstalk between downstream pathways. Bioactive compounds such as PKI-166 or AEE788 with EGFR protein kinase inhibitory (PKI) activity have been designed and found to have a cytostatic effect in vitro on tumor cells that overexpress EGFR (Lane et al., 2001; Traxler et al., 2004). In addition, the EGFR PKI imatinib (gefitinib) allowed tumor growth control in 10% of patients with non–small cell lung cancer who carried specific mutations in the tyrosine kinase domain (Lynch et al., 2004). Several small molecular weight compounds, of tyrosine kinase inhibitors such as Gleevec or erlotinib/gefinitib, when applied as monotherapies, only resulted in limited efficacy in the treatment of GBM (Wen et al., 2006). Highly mutator phenotype of GBM cells enabled them to gain alterations in several growth promoting pathways and there is an obvious cross talk between several signaling pathways. In conclusion, these findings supported the hypothesis that in order to efficiently induce cell death in GBM cells, combination of two or more drugs is required (Failly et al., 2007).
18
2.Results
Part 1: GSK3! regulates differentiation and growth arrest in glioblastoma
Serdar Korur, Roland M. Huber, Balasubramanian Sivasankaran, Michael Petrich, Pier Jr. Morin, Brian A. Hemmings, Adrian Merlo and Maria Maddalena Lino.
PLoS One. 2009 Oct 13;4(10):e7443
19
GSK3! Regulates Differentiation and Growth Arrest in Glioblastoma
Serdar Korur1, Roland M. Huber1, Balasubramanian Sivasankaran1, Michael Petrich1, Pier Morin Jr2, Brian A. Hemmings2, Adrian Merlo1* and Maria Maddalena Lino1
1: Laboratory of Molecular Neuro-Oncology, University Hospital Basel, Hebelstrasse 20, CH-4031 Basel, Switzerland
2: Friedrich Miescher Institute for Biomedical Research, Maulbeerstrasse 66, CH-4058 Basel, Switzerland
* Proofs should be addressed to Adrian Merlo
Tel.: +41 61 265 93 11; Fax: +41 61 265 90 60; E-mail: adrian.merlo@gmx.ch
Running title: GSK3! regulates differentiation and growth arrest in glioblastoma
Key words: Glioblastoma, cancer stem cells, glycogen synthase kinase 3!, Bmi1, differentiation therapy
!"#$%&'$((
!"#$%&'("&%()&*+%#(,-("(./.01"2*/#(/3($%11'(4*25(25%('2%6($%11(.&/.%&2*%'(/3('%137&%#%4"1(
"#)(0#1*6*2%)(8&/4259(:'("('0,./.01"2*/#(4*25*#(25%(206/&(6"'';(25%'%($%11'("&%(,%1*%+%)(
2/($/#'2*202%("(206/&($%11(&%'%&+/*&9(<"254"-'($/#2&/11*#8(25%(&%#%4"1(/3(#/&6"1('2%6($%11'(
"&%()%&%801"2%)(*#($"#$%&9(=5%(./1-$/6,(8&/0.(8%#%(>6*?;(45*$5(*'(&%@0*&%)(3/&(#%0&"1(
'2%6($%11('%137&%#%4"1("#)("1'/($/#2&/1'("#2*7/A*)"#2()%3%#'%(*#(#%0&/#';(*'(0.&%801"2%)(*#(
'%+%&"1($"#$%&';(*#$10)*#8(6%)011/,1"'2/6"9(B%(5"+%(3/0#)(25"2(>6*?(*'($/#'*'2%#21-("#)(
5*851-(%A.&%''%)(*#(C>D9(E/4#&%801"2*/#(/3(>6*?(,-('5FG:'(*#)0$%)("()*33%&%#2*"2*/#(
.5%#/2-.%("#)(&%)0$%)(%A.&%''*/#(/3(25%('2%6($%11(6"&H%&'(I/AJ("#)(G%'2*#9(
K#2%&%'2*#81-;(%A.&%''*/#(/3(81-$/8%#('-#25"'%(H*#"'%(L(,%2"(MCINL!O;(45*$5(4"'(3/0#)(
2/(,%($/#'*'2%#21-(%A.&%''%)(*#(.&*6"&-(C>D;("1'/()%$1*#%)9(=5*'('088%'2'("(30#$2*/#"1(
1*#H(,%24%%#(>6*?("#)(CINL!9(K#2%&3%&%#$%(4*25(CINL!("$2*+*2-(,-('*FG:;(25%('.%$*3*$(
*#5*,*2/&(I>J?PQPL;(/&(1*25*06($51/&*)%(MR*!1O(*#)0$%)(206/&($%11()*33%&%#2*"2*/#9(K#(
"))*2*/#;(206/&($%11("./.2/'*'(4"'(%#5"#$%);(25%(3/&6"2*/#(/3(#%0&/'.5%&%'(4"'(
*6."*&%);("#)($1/#/8%#*$*2-(&%)0$%)(*#("()/'%7)%.%#)%#2(6"##%&9(C>D($%11(1*#%'($/#'*'2(
6"*#1-(/3(!E?LL7#%8"2*+%(M!E?LL7O($%11'9(K#2%&%'2*#81-;(ex vivo($%11'(3&/6(.&*6"&-(
206/&(,*/.'*%'("11/4%)(25%(*)%#2*3*$"2*/#(/3("(!E?LL7('0,./.01"2*/#(/3($%11'(25"2(%A.&%''(
'2%6($%11(6"&H%&'("#)("&%()%.1%2%)(,-(*#"$2*+"2*/#(/3(CINL!9(E&08'(25"2(*#5*,*2(CINL;(
*#$10)*#8(25%(.'-$5*"2&*$()&08(R*!1;(6"-()%.1%2%(25%(C>D('2%6($%11(&%'%&+/*&(
*#)%.%#)%#21-(/3(!E?LL('2"20'9(
!
!"#$%&'(#)%"!
"#$#%&!'&()*#'!'(++#'&!&,-&!$-%$#.!'&#/!$#00'!-.#!&,#!).*1*%+!23.$#!4#,*%)!&(/3.*+#%#'*'!
5678!9:6;;!<-0'3!=%3>%!-'!?.3/*%*%!6@!>-'!*)#%&*2*#)!-'!-!'(.2-$#!/-.=#.!32!$-%$#.!'&#/!
$#00'!*%!4.-*%!&(/3.'!5A78!B'!2#>!-'!6CC!9:6;;DE3'*&*1#!<9:6;;F@!$#00'!>#.#!',3>%!&3!
*%)($#!&(/3.'!*%!&.-%'E0-%&-&*3%!#GE#.*/#%&'!+*1*%+!.*'#!&3!-!E,#%3$3EH!32!&,#!*%*&*-0!
%#3E0-'*-!5AI;78!9:6;;F!$#00'I!>,*$,!#GE.#''!/(0&*D).(+!.#'*'&-%$#!-%)!:JB!.#E-*.!
E.3&#*%'!5K7I!-.#!,*+,0H!.#'*'&-%&!&3!$,#/3D!-%)!.-)*-&*3%!&,#.-EH8!L3>#1#.I!'&#/%#''!*'!
%3&!.#'&.*$&#)!&3!&,#!#GE.#''*3%!32!&,#!9:6;;!/-.=#.I!'*%$#!9:6;;D%#+-&*1#!<9:6;;D@!
$#00!E3E(0-&*3%'!>#.#!-0'3!23(%)!&3!4#!&(/3.*+#%*$!5M78!9-%$#.!'&#/!$#00'!,-1#!-0'3!4##%!
)#&#$&#)!*%!+0*340-'&3/-!<NOP@I!&,#!/3'&!/-0*+%-%&!,(/-%!4.-*%!&(/3.I!>*&,!-%!-%%(-0!
*%$*)#%$#!32!;Q!E#.!/*00*3%!-%)!-!/#-%!'(.1*1-0!32!0#''!&,-%!6!H#-.!5QDR78!NOPI!-!,*+,0H!
*%1-'*1#!-%)!E.30*2#.-&*1#!&(/3.I!/-%*2#'&'!*&'#02!-'!-!de novo!0#'*3%!3.!E.3+.#''#'!2.3/!
0#''!(%)*22#.#%&*-&#)!03>D+.-)#!-'&.3$H&3/-8!!
O/*6!*'!-!/#/4#.!32!&,#!E30H$3/4!+.3(E!32!E.3&#*%'!*%1301#)!*%!4.-*%!)#1#03E/#%&!5S78!
?30H$3/4!+.3(E!E.3&#*%'!/-*%&-*%!#/4.H3%*$!-%)!-)(0&!'&#/!$#00'!4H!23./*%+!/(0&*D E.3&#*%!$3/E0#G#'!&,-&!2(%$&*3%!-'!&.-%'$.*E&*3%!.#E.#''3.'!56CD6T78!O/*6!*'!-0'3!*%1301#)!
*%!$-%$#.!4H!$33E#.-&*3%!>*&,!PH$!*%!0H/E,3/-!23./-&*3%!56R7!-%)!403$=*%+!32!
'#%#'$#%$#!*%!*//3.&-0*U#)!/3('#!#/4.H3%*$!2*4.340-'&'!&,.3(+,!.#E.#''*3%!32!&,#!
V%=K-WB.2D03$('!56S78!V&!*'!-0'3!-/E0*2*#)!-%)W3.!31#.#GE.#''#)!*%!%3%D'/-00D$#00!0(%+!
$-%$#.I!$303.#$&-0!$-.$*%3/-I!%-'3E,-.H%+#-0!$-.$*%3/-I!/#)(00340-'&3/-I!0H/E,3/-I!
/(0&*E0#!/H#03/-!-%)!E.*/-.H!%#(.340-'&3/-!5SI6;I6SDAA78!X,#&,#.!O/*6!*'!#GE.#''#)!
!"#$%&#!'#()"*+),-+'!./#0123#4"#.#5)6'-#7/!)5.#5)8-/9#%5!:#;.'#!5</!(.*-8#!"#
*65)+!7-"-'!'#!"#."#4"=>.?@+AB!"8-<-"8-"*#5.""-+#0CD23#E6+*F-+5)+-9#!*#;.'#'F);"#
+-(-"*/G#*F.*#5!(+)HI@B:CJ#!"F!K!*'#<+)/!A-+.*!)"#."8#'-/AB+-"-;./#!"#7/!)5.#.*#/-.'*#
<.+*!.//G#KG#8);"+-76/.*!"7#%5!:#0C>23#
$/G()7-"#'G"*F.'-#=!".'-#D#L$MNDO9#.#'-+!"-?*F+-)"!"-#=!".'-9#+-76/.*-'#"65-+)6'#
'!7"./!"7#<.*F;.G'#!",)/,-8#!"#(-//#(G(/-#()"*+)/9#<+)/!A-+.*!)"9#8!AA-+-"*!.*!)"#."8#
.<)<*)'!'#0CP9CQ23#RF-#5.55./!."#!')A)+5'#$MNDα#."8#$MND!#.+-#A6"(*!)".//G#
!"8-<-"8-"*#.'#$MNDα#(."")*#+-'(6-#*F-#-5K+G)"!(.//G#/-*F./#<F-")*G<-#)A#$MND!#LB?BO#
5!(-#0CS23#$MND#F.'#K--"#8-'(+!K-8#.'#.#<+)B'6+,!,./#A.(*)+#!"#<."(+-.*!(#(."(-+#0CJ2#
."8#.'#.#<+)B.<)<*)*!(#A.(*)+#!"#()/)+-(*./#(."(-+#0C12#."8#!'#!"*-+()""-(*-8#;!*F#'-,-+./#
<.*F;.G'#."8#!5</!(.*-8#!"#@/TF-!5-+U'#8!'-.'-#0DV29#8!.K-*-'#0D:29#K!<)/.+#8!')+8-+#0DC29#
."8#5)+-#+-(-"*/G#(."(-+#0DD23##
W-#F.,-#."./GT-8#*F-#+)/-#)A#$MND#!"#5./!7"."*#7/!)5.'#."8#!*'#/!"='#*)#(+!*!(./#
'!7"./!"7#<+)*-!"'3#X);"+-76/.*!)"#)A#%5!:#+-86(-8#$MND!#/-,-/'#."8#!"86(-8#*F-#
8!AA-+-"*!.*!)"#)A#5./!7"."*#7/!./#(-//'3#X!+-(*#!"F!K!*!)"#)A#$MND!#KG#/!*F!65#(F/)+!8-#
LY!Z/O9#M%C:QSQD#."8#'!HI@#8-(+-.'-8#I-'*!"#."8#M)[C#/-,-/'#."8#!"86(-8#*F-#(-//#
8!AA-+-"*!.*!)"#5.+=-+'#ZI\.'-9#7/!./#A!K+!//.+G#.(!8!(#<+)*-!"#L$E@\O#."8#!B*6K6/!"#4443#
4"#.88!*!)"9#Y!Z/#."8#M%C:QSQD#8-</-*-8#(."(-+#'*-5#(-//'#7+);"#.'#F65."#$%&#ex vivo#(-//#(6/*6+-'9#!"86(-8#8!AA-+-"*!.*!)"#."8#!"F!K!*-8#"-6+)'<F-+-#A)+5.*!)"3#RF6'9#
$MND#5.G#+-<+-'-"*#.#"),-/#*F-+.<-6*!(#*.+7-*#A)+#5./!7"."*#7/!)5.'3#
!"#$%&"'()"*+)!$#,-+(!
."#&$*#()
"#$%&!'($)*+'!%,-(./+0!1&%$!)(-.+/-'!0#&./2!(!/+#&%'#&2.3(*!)&%3+0#&+!4+&+!
.$$+0.(-+*5!1&%6+/!(/0!7+)-!(-!89:;<=!>**!)(-.+/-'!2(?+!-@+.&!4&.--+/!3%/'+/-!1%&!-@+!
/+#&%'#&2.3(*!)&%3+0#&+!(/0!1%&!(/%/5$%#'!'3.+/-.1.3!(/(*5'.'!%1!0.'+('+0!-.''#+!
(33%&0./2!-%!-@+!2#.0+*./+'!%1!-@+!A-@.3'!<%$$.--++!%1!B('+*C!D4.-6+&*(/0!EAFBBG=!!
)
/$'')01'#1%$)"*+)%$"2$*#()
HIJKLC!HIK9C!HIMKNC!OJPJC!HIMMLC!HIQ:KC!OJQJC!O9PC!BDKMN!(/0!R'S9J!2*.%$(!3+**!
*./+'!4.-@!0+1./+0!2+/+-.3!'-(-#'!%1!TP53, p16/p14!(/0!PTEN!TJQUC!V>WX!
$+0#**%,*('-%$(!(/0!BK:Q!/+#&%,*('-%$(!3+**!*./+'!4+&+!3#*-#&+0!./!A(2*+!$+0.#$!
'#))*+$+/-+0!4.-@!MN!$Y!2*#3%'+C!2*#-($./+C!'-(/0(&0!(/-.,.%-.3'C!(/0!K:Z![<D=!
BDM9P!3+**'!4+&+!3#*-#&+0!./!I+#&%,('(*!$+0.#$!E\/?.-&%2+/G!'#))*+$+/-+0!4.-@!,('.3!
1.,&%,*('-!2&%4-@!1(3-%&!EM:!/2]$*C!\/?.-&%2+/GC!+).0+&$(*!2&%4-@!1(3-%&!EM:!/2]$*C!^_V!
D5'-+$'GC!BMP!EK`G!(/0!IM!'#))*+$+/-!E:=N`G!E\/?.-&%2+/G=!>**!3+**'!4+&+!$(./-(./+0!(-!
JP;<!./!NZ!<WM=!"@+!3+**!*./+'!4+&+!'++0+0!./!S83$!)*(-+'!(-!Na:::8K:a:::!3+**']3$M!(/0!
2&%4/!1%&!MQ!@!)&.%&!-%!-&+(-$+/-=![%&!3+**!3%#/-./2C!3+**'!4+&+!-&+(-+0!1%&!PM!@!('!
0+'3&.,+0!./!-@+!1.2#&+!*+2+/0'!(/0!3%#/-+0!,5!@+$%35-%$+-+&=!H.-@.#$!3@*%&.0+!EH.<*G!
4('!%,-(./+0!1&%$!YA^<F!(/0!DBMKSPSJ!1&%$!"%3&.'=!V!3%/3+/-&(-.%/'!#'+0!(&+!
./0.3(-+0!./!-@+!1.2#&+!*+2+/0'=!H.<*!4('!0.''%*?+0!./!bBD!(/0!DBMKSPSJ!./!VYDW!(/0!
'-%&+0!(-!8M:;<=!"@+!Ac[^!./@.,.-%&!>AAP99!4('!)&%?.0+0!,5!I%?(&-.'!b@(&$(=!"@+!
γ−!"#$"%&!"'()*(+(%,$'-./0'1&!',+%&()"2'3$,4'5,#*"6''
'
!"#"$%&'"()*+,"$&*--*%&
7,$'"&#*'#"88'8()"9':;;'#"88!'1"$"'<8&%"2'()'%$(<8(#&%"'()%,'=>?44'/"%$('2(!*"!'#,)%&()()@' A;'48',3'#B8%B$"'4"2(B4'1(%*'A;C'7DE6'D"88!'1"$"'@$,1)'3,$'A>'2&F!'&%'GHID'&)2':C' DJK9'2B$()@'1*(#*'<"$(,2'%*"'4"2(B4'1&!'),%'#*&)@"26'D"88!'1"$"'%*")'3(L"2'1(%*'>C' 3,$4&82"*F2"'()'AL'/ME'&)2'!%&()"2'1(%*'#$F!%&8'N(,8"%6'
'
./012&3ex vivo4&56##&#,$6&'"()*+,"$&*$7&$68("9*-*#&)67,8)&
7,88,1()@'()3,$4"2'#,)!")%9'&'%B4,$'!&4<8"'#8&!!(3("2'&!'OMP'+&!"2',)'%*"'QRJ'
#$(%"$(&'1&!',+%&()"2'3$,4'&'<&%(")%'B)2"$@,()@'!B$@(#&8'%$"&%4")%'&%'%*"'S)(N"$!(%F' R,!<(%&89'M&!"89'E1(%T"$8&)26'Q(%*()'A?G'*'&3%"$'!B$@(#&8'$"4,N&89'%*"'!&4<8"'1&!'%$"&%"2' 1(%*'%*"'U"B$&8'0(!!B"'-(!!,#(&%(,)'V(%'WP(8%")F('M(,%"#'O4+RX'&##,$2()@'%,'%*"'
4&)B3&#%B$"$Y!'<$,%,#,86'0B4,$'#"88!'1"$"'#B8%B$"2'()'UMZ'4"2(&6'S)#,&%"2'<8&!%(#' 2(!*"!'1"$"'B!"2'3,$')"B$,!<*"$"'#B8%B$"',3'UMZ'#"88!6'
'
:#*-),7-;$+,<,(8-6-&*$7&+(*$-'65+,"$&
0*"'8")%(N($&8'N"#%,$!'<[VJ6A?<B$,?!#$&4+8"2?!*5U.'W.22@")"X'&)2'<[VJ6A?<B$,?
!*5U.'WE(@4&9'!*A;\A]'CCGGCCTAATACTTTCCAGATTGATCTCGAGATCAATCTGG AAAGTATTAGGTTTTT9'!*\=G]'CCGGCCAGACCACTACTGAATATAACTCGAGTTATA TTCAGTAGTGGTCTGGTTTTX'%&$@"%()@'M4(A'1"$"'%$&)!3"#%"2'()%,'RZVK=G'#"88!'
!"#$!%$&'()!%'*+,-.)/-'$01"/)0#'!%$'*,12,#)0#'3*4567/&879:;',0/'$0<$+"*$'*&"!$)0-' 3*5=>?6@6?A;'B-)0#'4,4+>'*&$1)*)!,!)"0C'D%$'1"01$0!&,!)"0'"E')0E$1!)"B-'*,&!)1+$-')0'
!%$'-B*$&0,!,0!'(,-'!)!&,!$/'B-)0#'F$G,'1$++-C'A+)".,'1$++-'($&$'!&,0-/B1$/'()!%' )0E$1!)"B-'<)&,+'*,&!)1+$-C'@!,H+I'!&,0-E$1!$/'1+"0$-'($&$'-$+$1!$/'()!%'>'µ#J.+'
*B&".I1)0C'K.):'"<$&$L*&$--)"0'(,-'"H!,)0$/'()!%'*KMKN?*B&"',0/'*KMKN'*B&"?
K.):'B-)0#'4,4+>'*&$1)*)!,!)"0'E"&'8'%C'@!,H+I'!&,0-E$1!$/'1+"0$-'($&$'-$+$1!$/'()!%'>' µ#J.+'*B&".I1)0C'-)OPM'!&,0-E$1!)"0'E"&'A@QR'(,-'*$&E"&.$/'B-)0#'!%$'A@Q?R!J"'
-)OPM'@)#0,+@)+$01$'Q)!'34$++'@)#0,+)0#'D$1%0"+"#I;',11"&/)0#'!"'!%$'.,0BE,1!B&$&S-' )0-!&B1!)"0-C'4$++-'($&$'!&,0-E$1!$/'B-)0#'!%$'M.,L,'PB1+$"E$1!"&'/$<)1$'3G"0T,;C'4$++-'
!&,0-E$1!$/'()!%'0"0?-*$1)E)1'-)OPM'($&$'B-$/',-','1"0!&"+C' '
!"#$%&'(()*+,"#-+.$)#%%#/%)
D&,0-($++'.)#&,!)"0',--,I-'($&$'*$&E"&.$/'B-)0#'."/)E)$/'K"I/$0'1%,.H$&'B0)!-'()!%'
*"+I1,&H"0,!$'E)+!$&-'"E'8?µ.'*"&"-)!I'34"-!,&;C'D%$'+"($&'-)/$'"E'!%$'E)+!$&'(,-'1",!$/' ()!%':U'.#J.+'E)H&"0$1!)0'E"&'>'%',!'RVW4C'D%$'H"!!".'1%,.H$&'(,-'E)++$/'()!%'=5N5' 1"0!,)0)0#':UX'Y4@C'4$++-'3:UZ'*$&'($++')0'-$&B.?E&$$'=5N5;'($&$'*+,!$/')0'!%$'B**$&' 1%,.H$&',0/')01BH,!$/'E"&'>Z'%'()!%'"&'()!%"B!'A@QR"')0%)H)!"&-C'ME!$&'&$."<,+'"E'!%$'
&$.,)0)0#'1$++-'E&".'!%$'B**$&'-B&E,1$'"E'!%$'E)+!$&['.)#&,!$/'1$++-',!'!%$'H"!!".'"E'!%$' E)+!$&'($&$'E)L$/'()!%'RCVX'E"&.,+/$%I/$')0'\K@',0/'-!,)0$/'()!%'UC:X'1&I-!,+'<)"+$!C' Y"&'$,1%'!&$,!.$0!['1$++-')0':U'E)$+/-'"E'<)$('($&$'1"B0!$/')0'!%&$$')0/$*$0/$0!'
$L*$&).$0!-C' '
0'%-'"$)1(.-)#$#(/%+%)#$2)#$-+1.2+'%)
!"##$%&"'"%&($)"*%&+,)%-.%/012%#3$"*%+4%5677"'%894,(+4+4:%;<%$9*+6=%*9*"83#%$6#7(,"%
>1?1@2%AB%=C%D'+$%EF%GHI2%BH-%C%*+,)+9,)'"+,9#%>?DD@2%59+#"*%(4*%6$"*%"+,)"'%
+=="*+(,"#3%9'%7'9J"4%(,%K;BL!H%/'9,"+4%#3$(,"$%&"'"%'"$9#M"*%94%*"4(,6'+4:%IK-;<%1?1K E9#3(8'3#(=+*"%:"#$%(4*%,'(4$7"''"*%,9%4+,'98"##6#9$"%="=5'(4"$%>+0#9,%N"#%,'(4$7"'%
$,(8O$2%P4M+,'9:"4@H%D)"%79##9&+4:%E'+=('3%(4,+59*+"$%&"'"%6$"*Q%(4,+K0=+-%>RE$,(,"@2%
(4,+K!K8(,"4+4%(4*%(4,+KS"$,+4%>1(4,(%!'6J%0+9,"8)49#9:3@T%(4,+K!K,656#+4%PPP%(4*%(4,+K NUV/%>1+:=(@T%(4,+K!S/($"%>!)"=+894@T%(4,+KN1WX!%>!"##%1+:4(#+4:@T%(4,+KS9,8);%
>?"M"#9E="4,(#%1,6*+"$%F35'+*9=(%0(4O@T%(4,+K19.;%>YZ?%$3$,"=$@T%(4,+K!?-XX%
>C+#,"43+%0+9,"8@T%(4,+KVO,%(4*%E)9$E)9KVO,%>1"'K[\X@%>C+##+E9'"2%0+##"'+8(%CV2%R1V@2%
(4,+KE-G]E-[2%(4,+K08#;2%(4,+K^'O%(4*%(4,+KE)9$E)9K^'O%>1(4,(%!'6J%0+9,"8)49#9:32%1(4,(%
!'6J%!V2%R1V@2%(4,+KV8,+4%>1+:=(KV#*'+8)2%1,H%_96+$2%R1V@H%?"89'(,"*%E'9,"+4$%&"'"%
'"M"(#"*%6$+4:%)9'$"'(*+$)%E"'9.+*($"K894`6:(,"*%(4,+K=96$"2%(4,+K'(55+,2%(4,+K'(,%>S"&%
^4:#(4*%0+9#(5$@%9'%(4,+K:9(,%>/+"'8"@%$"894*('3%(4,+59*+"$%(4*%M+$6(#+J"*%53%,)"%
8)"=9#6=+4"$8"48"%*","8,+94%$3$,"=%16E"'1+:4(#%a"$,%/+89%>D)"'=9%18+"4,+7+8@H%
/'9,"+4%5(4*$%&"'"%b6(4,+7+"*%&+,)%P=(:"c%$97,&('"%>),,EQ]]'$5H+479H4+)H:9M]+`]@H%Y"$6#,$%
&"'"%49'=(#+J"*%,9%(8,+4%#"M"#$H%
%
!"##$%&'()*+$,*-$.#&/$01(&2"('1$
!"##%?SV%894,"4,%(4*%(E9E,9$+$%&"'"%(4(#3J"*%53%7#9&%83,9=",'3%>!3V4%V?/%
V4(#3J"'2%0"8O=(4%!96#,"'@%(4*%,)"%'"$6#,$%$,(,+$,+8(##3%"M(#6(,"*%&+,)%16==+,%M[HX%
$97,&('"H%!"##$%&"'"%,'3E$+4+J"*2%7+."*%+4%+8"K89#*%\B<%",)(49#%79'%-%)%(4*%$,(+4"*%&+,)%
AB%d:]=#%E'9E+*+6=%+9*+*"%79'%UV!1%(4(#3$+$H%/"'8"4,%*"(*%8"##$%&($%*","'=+4"*%7'9=%
!"#$%&'%'&!(')$'*$+#,,-$()$-./012$%"3-#4$5#-.,!-$3&#$6(7#)$3-$8#3)$73,.#-$*&'8$!"&##$
()9#%#)9#)!$#:%#&(8#)!-4$;'&$<=2>>$3)3,?-(-@$(-',3!#9$+#,,-$A#&#$,3/#,#9$A(!"$3)!(0
<=2>>$3)!(/'9?$B2C2DE$*'&$2D$8()$3!$F°<@$A3-"#9$A(!"$GHI$3)9$-'&!#9$BJK;LMN$<#,,$
I'&!#&$/?$H=$H('-+(#)+#-E4$
;'&$H&9M$3)3,?-(-@$+#,,-$A#&#$%.,-#9$A(!"$2D$!O$/&'8'9#':?.&(9()#$*'&$P$"$3)9$
%&'+#--#9$A(!"$!"#$QG<0H&9M$R(!$3++'&9()6$!'$!"#$83).*3+!.&#&S-$()-!&.+!(')-$BH=$
G"3&8()6#)E4$;'&$*,.'&#-+#)!$,3/#,()6$A(!"$1;QG@$+#,,-$A#&#$*(:#9$3)9$%#&8#3/(,(T#9$
A(!"$!"#$<?!'*(:U<?!'%#&8$R(!$BH=$G"3&8()6#)E4$G#&8#3/(,(T#9$+#,,-$A#&#$()+./3!#9$
A(!"$3)!(01;QG$B2CPDDE$'&$83!+"()6$(-'!?%#$+')!&',$3)!(/'9?$*'&$>D$8()$')$(+#@$A3-"#9$
!A(+#$3)9$()+./3!#9$A(!"$!"#$+'&&#-%')9()6$-#+')93&?$3)!(/'9?$*'&$>D$8()$')$(+#$3)9$
3)3,?T#9$/?$*,'A$+?!'8#!&?$B<?Q)$Q=G$Q)3,?T#&@$H#+R83)$<'.,!#&E4$
$
!""#$%&'(%&)*"+,(-'.
<#,,-$A#&#$6&'A)$!'$VDW$+')*,.#)+?$3-$3$8')',3?#&$3-$9#-+&(/#9$3/'7#4$<#,,-$A#&#$!"#)$
*(:#9$()$FW$G;Q$()$GHI$*'&$2X$8()$3!$&''8$!#8%#&3!.&#@$A3-"#9$A(!"$GHI$3)9$
()+./3!#9$A(!"$!"#$%&(83&?$3)!(/'9?$'7#&)(6"!$3!$F°<$()$GHI$Y$2W$HIQ$Y$D42W$Z&(!')$
N2DD4$Q*!#&$!"'&'.6"$A3-"()6$A(!"$GHI@$!"#$-#+')93&?$3)!(/'9?$A3-$399#9$*'&$>$"$3!$
&''8$!#8%#&3!.$<#,,-$A#&#$(836#9$/?$+')*'+3,$8(+&'-+'%?4$Q,,$!.8'&$-38%,#-$
3)3,?T#9$A#&#$-!3()#9$A(!"$"#83!':?,()0#'-()4$
/+&-%0--0'.0$01',+,.%2.31+%"0..
HI$-#&(#-$3&#$%&(83&?$!.8'&$!(--.#-$'/!3()#9$*&'8$%3!(#)!-$9(36)'-#9$A(!"$%&(83&?$<KI$
!"#$%&'()*&&+,+-.'*(($%.+/0'!$'!1-'234'0%*.+/0'&5&!-#6'7$%#*)'8%*+/'!+&&"-'"&-.'*&'*'
!-#9)*!-',$%'#+(%$*%%*5':*&'$8!*+/-.',%$#'&*#9)-&'$,'8%*+/'&"%0-%5',$%'/$/;/-$9)*&!+(' .+&-*&-6'<$!*)'=7>',%$#'!:$'/$%#*)'8%*+/&?'@A'BCD'*/.'-+01!'*&!%$(5!$#*'&*#9)-&':*&'
*#9)+,+-.'*/.')*8-)-.'"&+/0'!1-'>,,5#-!%+E'A;(5()-'*#9)+,+(*!+$/'9%$!$($)'*(($%.+/0'!$'
!1-'#*/",*(!"%-%F&'+/&!%"(!+$/&'G>,,5#-!%+EH6'I*#9)-&':-%-'158%+.+J-.'!$'>,,5#-!%+E' K@LLMA6N'B-/-O1+9&'*/.'&(*//-.'"&+/0'*/'>,,5#-!%+E'B-/-'O1+9'&(*//-%',$))$:+/0'!1-'
#*/",*(!"%-%F&'+/&!%"(!+$/&6'PE9%-&&+$/'M*)"-&':-%-'-&!+#*!-.'"&+/0'!1-'BO;=D>' +#9)-#-/!*!+$/'+/'!1-'B-/-.*!*'=-,+/-%'Q6@'GB-/-.*!*?'C*&-)?'I:+!J-%)*/.H'9*(R*0-6' S*!*;#+/+/0'*/.'M+&"*)+J*!+$/':*&'9-%,$%#-.'"&+/0'!1-'B-/-.*!*'>/*)5&!'Q6@'9*(R*0-6'
>))'&*#9)-&':-%-'T"*/!+)-'/$%#*)+J-.'*/.'#-.+*/'&(*)-.'!$'($%%-(!',$%'#+/$%'M*%+*!+$/'+/' -E9%-&&+$/'.+&!%+8"!+$/6'>))'#+(%$*%%*5'.*!*'%-9$%!-.'+/'!1-'#*/"&(%+9!'*%-'+/'*(($%.*/(-' :+!1'!1-'DU>DP'0"+.-)+/-&6'
!"#$%&#'
()*+'*#',-"."/0."##"1'*2'3(45',%*6,1"21.,6%*,)7'721'7#&.,89&,)7'
!"#$%&'()(*+)(,,#&-%./,%0((-%)(+&)1(2%#-%,('()/3%2#44()(-1%15"&)%16+(,%#-7352#-8%
"(2533&03/,1&"/%/-2%-(5)&03/,1&"/9%:-%/-%/-/36,#,%&4%!"#$%";<=%/-2%+)&1(#-%
(*+)(,,#&-%#-%>!?%7(33%3#-(,%/-2%+)#"/)6%0)/#-%15"&),@%/33%>!?%7(33%3#-(,%(*+)(,,(2%
.#8.%!"#$%3('(3,@%A#1.%1.(%B<C$D%3#-(%./'#-8%1.(%.#8.(,1%(*+)(,,#&-%7&"+/)/03(%1&%1.(%
)(4()(-7(%3#-(%E=FG%HDI%JK#85)(%$=%/-2%2/1/%-&1%,.&A-L9%:-%+)#"/)6%0)/#-%15"&)%
,/"+3(,@%!"#$%(*+)(,,#&-%A/,%"/)M(2%#-%$NO$D%JPQRL%&4%>!?@%SOT%JT$RL%&4%
&3#8&2(-2)&83#&"/%/-2%COT%JQURL%&4%/,1)&761&"/9%:-%7&-1)/,1@%45336%2#44()(-1#/1(2%-&)"/3%
0)/#-%1#,,5(%./2%-&%!"#$%+)&1(#-%JK#85)(%$!@%VL9%
%
#:!;<#'767*2#&'()*+'1,=2."6$%7&"#'3>?@!'
W&%,1526%1.(%)&3(%&4%!"#$%#-%>!?@%!"#$%(*+)(,,#&-%A/,%M-&7M(2%2&A-%5,#-8%3(-1#'#)/3X
"(2#/1(2%2(3#'()6%&4%,.;<=,9%!"#$%A/,%(44#7#(-136%2&A-)(853/1(2%#-%1.(%Y,NPC@%ZCTC@%
ZPT@%/-2%ZCQC%>!?%7(33%3#-(,%JK#85)(,%U=%/-2%[$=%/-2%2/1/%-&1%,.&A-L%5,#-8%2#44()(-1%
,.;<=%,(\5(-7(,%JK#85)(%[$!L9%[#-7(%1.(%]&367&"0%8)&5+%8(-(%!"#$%#,%#-'&3'(2%#-%1.(%
)(853/1#&-%&4%2('(3&+"(-1%/-2%15"&)#8(-(,#,@%1.(%(44(71%&4%!"#$%2&A-)(853/1#&-%#-%>!?%
7(33,%A/,%,7)((-(2%06%/-/36,#,%&4%+)&1(#-,%#-'&3'(2%#-%M(6%7(3353/)%+/1.A/6,%&4%1.(%7(33%
7673(@%2('(3&+"(-1@%"(1/0&3#,"@%/+&+1&,#,%/-2%8)&A1.@%#-7352#-8%^)M@%=M1@%>[_Cβ@%+$N%
/-2%+$Q@%!73XU@%7X?67@%<(,1#-%/-2%[&*U9%:-%7&-1)/,1%1&%-&-X-(&+3/,1#7%7(33,%#-%!"#$%
M-&7M&51%"#7(%H$DI@%!"#$%2&A-)(853/1#&-%#-%>!?%7(33,%2#2%-&1%/44(71%:-MQ/O=)4%+)&1(#-%
3('(3,%JK#85)(%U=L9%!"#$%2&A-)(853/1#&-%#-257(2%7(33%2#44()(-1#/1#&-%/,,&7#/1(2%A#1.%
"&)+.&3&8#7/3%7./-8(,%/-2%2(7)(/,(2%(*+)(,,#&-%&4%1.(%,1("%7(33X)(3/1(2%+)&1(#-,%<(,1#-%
!"#$%&'()$!**&+,!"-."/$."#0*1.&"$&2$!"$!314&*-1.*$2!15$."$6787$/9.&+!$*599$9."5)$
#5154+."5#$:-$."*45!35#$95;593$&2$1<5$!314&*-15=3,5*.2.*$+!4>54$?@AB)$!"#$#5*45!35#$
95;593$&2$&9./"#4&*-15=3,5*.2.*$+!4>54$CDB!35$E@./0453$(A=F$!"#$%(GHI$J"$*&"14!31)$
G+.K$&;545',4533.&"$!**&+,!".5#$#5#.22545"1.!1.&"$!3$3<&L"$:-$."*45!35#$D531."$
5',4533.&"$E@./045$%KCHI$J"154531."/9-)$?%M7!$95;593$L545$+!4>5#9-$45#0*5#$E@./0453$
(A$!"#$%KA=GHI$N<.3$4!.35#$1<5$O0531.&"$&2$L<51<54$?%M7!$+5#.!153$1<5$5225*13$
&:354;5#$&"$*599$#.22545"1.!1.&"I$N&$1<.3$5"#)$L5$035#$1<5$3+!99$+&95*0953$P.C9$!"#$
%G(KQ8Q7$!3$L599$!3$3.RDA$1&$."1542545$L.1<$?%M7!$!*1.;.1-$."$?GS$*5993I$
$
!"#$!%&'%()*+(''(,%&-%!./%
N<.41-=1L&$,4.+!4-$10+&4$1.33053$&:1!."5#$24&+$,!1.5"13$#.!/"&35#$L.1<$?GS$L545$
310#.5#$03."/$+.*4&!44!-$!"#$L53154"$:9&1$!"!9-3.3$1&$+5!3045$?%M7!$+RDA$!"#$
,4&15."$95;593I$?%M7!$+RDA$L545$<./<54$."$?GS$!"#$!314&*-1&+!$,!1.5"13$*&+,!45#$
L.1<$1<5$*&"14&9$E@./0453$(T)$@$!"#$%(H$!"#$,4&15."$L!3$2&0"#$1&$:5$5',45335#$."$1<5$
+!U&4.1-$&2$1<5$10+&43$!"!9-V5#I$N<5$<./<$?%M7!$5',4533.&"$."$!314&*-1&+!$L!3$
+&31$,4&:!:9-$#05$1&$/45!154$"5*4&3.3$."$1<5$?GS)$L.1<$."*45!35#$,4&15."$
#5/4!#!1.&"$E@./045$%(GHI$
$
'&0123%4-,%,+563&-,57(,%&-8&9&:&;-%;<%!"#$%&-7+(4'('%,&<<(+(-:&4:&;-%=4+>(+'%
N<5$5225*1$&2$1<5$."<.:.1.&"$&2$?%M7$&"$,4&15."$95;593$&2$,4&/5".1&4$ED531."$!"#$%&'(H$
!"#$#.22545"1.!1.&"$ECDB!35)$?@AB)$!"#$!=10:09."$JJJH$+!4>543$."$?GS$*599$9."53$6787)$
PD7KW)$G%K(X$!"#$PDKY$L!3$!"!9-V5#$03."/$1<5$#40/3$P.C9$!"#$%G(KQ8Q7$&4$3.RDA3I$
!=*!15"."$.3$1!4/515#$2&4$#5/4!#!1.&"$0,&"$,<&3,<&4-9!1.&"$:-$?%M7!"$Z(X[I$G9&*>."/$
!"#$!%&'()(*+)(%,(-./%&+%-00121,-&3+4%+*%!50-&(4346%7'30'%7-/%1/(.%-/%-%)(-.5+1&%*+)%&'(%
(**(0&/%+*%839,%-4.%":;<=>=$%+4%!"#$%-0&3?3&@%AB3C1)(%$:DE%F*&()%>;%'%&)(-&2(4&%73&'%
839,%-4.%":;<=>>$6%G(/&34%H)+&(34%,(?(,%.(0)(-/(.%34%&'(%G(/&345(IH)(//34C%J$>$6%
8G$<K%-4.%8G<L%0(,,%,34(/%AB3C1)(/%$F6%:D6%7'30'%7-/%0+4*3)2(.%M@%
32214+0@&+0'(23/&)@%AB3C1)(%N:DE%G(/&34%-4.%"+I;%7()(%4+&%(IH)(//(.%34%&'(%Oex vivoP%
:"<;Q%!:R%0(,,%,34(E%"+I;%,(?(,/%7()(%)(.10(.%34%8G<L6%J$>$%-4.%8G$<K%1H+4%!"#$%
34'3M3&3+4%AB3C1)(%$F6%:DE%S'(%+,3C+.(4.)+0@&(%/H(03*30%2-)T()%;U6%$U50@0,30%410,(+&3.(%$U5 H'+/H'+.3(/&()-/(%A9GV-/(D%-4.%&'(%4(1)+4-,%2-)T()%!5&1M1,34%WWW%340)(-/(.%34%:"<;Q6%
8G<L%-4.%8G$<K6%AB3C1)(%$F6%:DE%!"#$%34'3M3&3+4%-,/+%340)(-/(.%&'(%H)+&(34%,(?(,/%+*%
&'(%-/&)+0@&30%,34(-C(5/H(03*30%2-)T()%!BFV%34%8G$<K%-4.%:"<;Q%AB3C1)(%NFDE%
X+74)(C1,-&3+4%+*%!"#$%-0&3?3&@%34%8G<L%M@%/3YGF%)(.10(.%G(/&34%-4.%"+I;%H)+&(34%
,(?(,/%AB3C1)(%N9D6%0+4*3)234C%&'(%/H(03*303&@%+*%&'(%34'3M3&+)@%.)1C%":;<=>=$%34%
M,+0T34C%!"#$!E%S'(%(**(0&%+*%&'(%/H(03*30%!"#$%34'3M3&+)%":;<=>=$%7-/%2+)(%
H)+4+140(.%-4.%0+4/3/&(4&%&'-4%&'(%(**(0&%+*%839,6%7'30'%3/%T4+74%&+%&-)C(&%+&'()%
/3C4-,34C%2+,(01,(/%Z;=[E%S'1/%!"#$%34'3M3&3+4%/H(03*30-,,@%.(0)(-/(.%&'(%(IH)(//3+4%+*%
H)+C(43&+)%2-)T()/%AG(/&34%-4.%"+I;D%-4.%34.10(.%&'(%(IH)(//3+4%+*%.3**()(4&3-&3+4%
2-)T()/%A4(1)+4-,%2-)T()%!5&1M1,34%WWW6%+,3C+.(4.)+0@&(5/H(03*30%2-)T()%9GV-/(%-4.%&'(%
-/&)+0@&30%2-)T()%!BFVD%34%-%0(,,%,34(5.(H(4.(4&%2-44()E%
%
!"#$%$&$'"(')(*+,-(./01/&/2(*34(5/112(6$&#(7(2&/8(5/11(2$9"7&:;/(
S'(%H'(4+&@H30%/73&0'%&+7-)./%.3**()(4&3-&3+4%34%!:R%0(,,/%*+,,+734C%34'3M3&3+4%+*%
!"#$%)-3/(/%&'(%\1(/&3+4%+*%7'(&'()%!"#$%-0&3?3&@%)(C1,-&(/%0-40()%/&(2%0(,,%
!"!#$%&'"()*+,-.//0+%(1+,-.//2+3%(345+)&46+34$$)+7%84+944(+14)35'941+'(+:;<+
=>?/?/@2/AB*+C(+%(+%(%$D)')+"E+4'F7&+1'EE454(&+"5'F4('3+:;<+34$$+$'(4)+GHI.J?+HI>.@?+
HI/.K?+L/A/?+HI>>K?+L/M/?+;N.>@+%(1+O)PJ/Q+=/MB+E"5+&74+!54)4(34+"E+,-.//0+34$$)?+
"($D+HI/.K+3"(&%'(41+,-.//0+34$$)?+%&+%!!5"R'6%&4$D+.>S*+T"+&4)&+U74&745+&74+
,-.//0+!"!#$%&'"(+!"))4))41+%+3%(345+)&46+34$$2$'V4+37%5%3&45?+&74+4R!54))'"(+$484$)+"E+
)&46+34$$+6%5V45)+U454+%(%$DW41+'(+&74+,-.//24(5'3741+!"!#$%&'"(*+I4)&'(?+I"&37>+%(1+
;6'.+U454+7'F7$D+4R!54))41+54$%&'84+&"+&74+,-.//2+E5%3&'"(+GX'F#54+@,Q*+:NY/!+%(1+!2 3%&4('(+!5"&4'(+$484$)+U454+%$)"+7'F745+'(+&74+,-.//0+!"!#$%&'"(+&7%(+'(+&74+3"(&5"$+
GX'F#54+@,Q*+C(7'9'&'"(+"E+:NY/+'(+34$$+$'(4+HI/.K+U'&7+4'&745+H',$+"5+N;>.PAP/+
)7"U41+%+)4$43&'84+4EE43&+"(+&74+3%(345+)&46+34$$2$'V4+!"!#$%&'"(*+H',$+%&+.Z+6<+%(1+
N;>.PAP/+%&+>Z+µ<+'(1#341+%+@Z2PZS+14!$4&'"(+"E+,-.//0+34$$)+GX'F#54+@[Q*+T74+
4EE43&)+"E+:NY/+'(7'9'&"5D+15#F)+U454+E"#(1+&"+94+)!43'E'3+'(+&7%&+&74+4!'1456%$+F5"U&7+
E%3&"5+5434!&"5+'(7'9'&"5+G[\\AJJQ+%(1+&74+γ2)4354&%)4+'(7'9'&"5+G-[]TQ+1'1+("&+
)'F('E'3%(&$D+%$&45+&74+,-.//0+!"!#$%&'"(+G1%&%+("&+)7"U(Q*+T"+E#5&745+3"()"$'1%&4+&7')+
"9)458%&'"(?+U4+4(5'3741+&74+HI/.K+,-.//0+!"!#$%&'"(+9D+X[,N+)"5&'(F?+"9&%'('(F+%+
,-.//0+34$$+!"!#$%&'"(+"E+%!!5"R'6%&4$D+JZS*+T7')+U%)+6%'(&%'(41+E"5+)4845%$+!%))%F4)+
%(1+&74(+)#9^43&41+&"+'(7'9'&'"(+"E+:NY/+9D+H',$+"5+N;>.PAP/?+U7'37+14!$4&41+&74+
,-.//0+E5%3&'"(+GX'F#54+@;Q*++
C&+7%)+944(+%5F#41+&7%&+:;<+34$$)+F5"U(+E"5+6%(D+!%))%F4)+'(+)&%(1%51+641'#6+1"+("&+
6'55"5+&74+)&46+34$$+3"6!%5&64(&+U'&7'(+&74+"5'F'(%$+"5+=/JB*+T"+4R%6'(4+&7')?+&74+_ex vivo”+34$$+$'(4+;N>JA+U%)+%(%$DW41+U7'37+7%1+944(+')"$%&41+E5"6+%+E54)7+"5+9'"!)D+
%(1+1'543&$D+F5"U(+%)+(4#5")!7454)+'(+(4#5"9%)%$+641'#6+)#!!$464(&41+U'&7+9X:X+%(1+
\:X?+&7#)+E%8"5'(F+4R!%()'"(+"E+3%(345+)&46+34$$)*+C(&454)&'(F$D?+&74+!"!#$%&'"(+U'&7+%+
!"#$%&#''(')*#%!)+,-"./#%),%"0)!%&#''%'),#%1-!%/#2/#!#,"#3%45%"0#%67899(%-,3%,:"%45%"0#%
67899;%2:2.'-"):,%<=)+./#%>?(6@A%B,'5%"0#%67899(%2:2.'-"):,%#C2/#!!#3%#'#D-"#3%
'#D#'!%:E%F#!"),G%H:CI%-,3%J$)8%-,3%E:/$#3%,#./:!20#/#!%<=)+./#%>JG%6@A%K,0)4)"):,%:E%
LHM9%3#&/#-!#3%"0#%!"#$%&#''%')*#%<67899(@%2:2.'-"):,%<=)+./#%>7@%-,3%-'!:%-'"#/#3%
2/:"#),%'#D#'!%:E%!"#$%&#''%-,3%3)EE#/#,")-"):,%$-/*#/!G%$-),'5%3#&/#-!#3%H:CI%'#D#'!%
<=)+./#%H9@A%K,3.&"):,%:E%3)EE#/#,")-"):,%)$2-)/!%"0#%-4)')"5%:E%2/#&./!:/%&#''!%":%E:/$%
,#./:!20#/#!A%K,0)4)"):,%:E%LHM9%!)+,)E)&-,"'5%/#3.%"0#%,.$4#/%-,3%D:'.$#%:E%
,#./:!20#/#!%),%JHINO%&#''!%<=)+./#%>PG%=@A%Q0#%/#!.'"!%!0:1%"0-"%),0)4)"):,%:E%LHM9%
/#3.&#!%"0#%&-,&#/%!"#$%&#''%2::'%-,3%"0-"%67899%$-5%,:"%4#%-%/#')-4'#%&-,&#/%!"#$%&#''%
$-/*#/A%
%
!"#$%&'(&)&*&+'%,-./0-1%0+2+'3%4+,56*&+'%6'.%&'./0-1%67+7*+1&1%&'%!89%0-221%
Q0#%#EE#&"!%:E%LHM9%),0)4)"):,%:,%&#''%2/:')E#/-"):,%-,3%-2:2":!)!%),%"0#%LJR%&#''%'),#!%
SF8NG%T9O9G%SFI8U%-,3%SF98V%1#/#%-,-'5W#3%.!),+%&:':,5%E:/$-"):,G%/#'-")D#%&#''%
,.$4#/%-,3%&#''%3#-"0%-!%/#-3:."A%K,%-%&:':,5%E:/$-"):,%-!!-5G%4:"0%"0#%,.$4#/%-,3%!)W#%
:E%&:':,)#!%E:/$#3%-E"#/%8X%3-5!%:E%3/.+%"/#-"$#,"%1#/#%$#-!./#3A%LHM9%),0)4)":/!%
!)+,)E)&-,"'5%/#3.%&:':,5%E:/$-"):,%),%-''%LJR%&#''%'),#!%"#!"#3%&:$2-/#3%1)"0%"0#%
.,"/#-"#3%&:,"/:'%<=)+./#%O?@A%Q0#%LHM9%),0)4)":/%&:,&#,"/-"):,!%.!#3%1#/#%),%"0#%,:,(
":C)&%/-,+#Y%&#''%2/:')E#/-"):,%-,3%!./D)D-'%:E%"0#%0.$-,%-3)2:!#%")!!.#(3#/)D#3%2/:+#,)":/%
&#''!%<?888@%1#/#%,:"%,#+-")D#'5%-EE#&"#3%<=)+./#%O?@A%LHM9%),0)4)"):,%45%S)6'%:/%
HJI8>O>9%),3.%-%!')+0"%),&/#-!#%),%&#''%3#-"0%E:/%LJR%&#''%'),#!%SF98VG%SF8NG%T9O9%
-,3%JH8IU%-E"#/%OI%0%<=)+./#%OJ@A%K,3.&"):,%:E%&#''%3#-"0%1-!%!)+,)E)&-,"'5%#'#D-"#3%
!"#$%&'()%*$"*+*,-.%/*01%!23%4-5+*$#6%!*,"%,"#%3,2$62.6%&78%,"#.29#:,*4%
,#5-;-1-5*6#%*$%,"#%/<=>%4#11%1*$#%?@*A:.#%BCDE%0#11%6#2,"%!23%6-3#F6#9#$6#$,%2$6%
G2.*#6%H.-5%4#11%1*$#%,-%4#11%1*$#E%C*.#4,%4#11%4-:$,*$A%2H,#.%#I9-3:.#%-H%4#113%,-%/*01%-.%
'7J=KBK)%H-.%BJ%"%3"-!#6%*$"*+*,*-$%-H%,"#%9.-1*H#.2,*-$%-H%/<=>L%/<)=ML%N)B)%2$6%
/<J=O%4#113%?@*A:.#%B0DE%&JF8%244:5:12,*-$%!23%.#4-.6#6%*$%/<)=ML%/<=>L%N)B)%2$6%
&JF8%2..#3,%*$%/<J=O%?@*A:.#%'PDE%Q$%2%5*A.2,*-$%2332RL%/<)=M%3"-!#6%2%3*A$*H*42$,%
.#6:4,*-$%*$%4#11%5*A.2,*-$%H-11-!*$A%&'()%*$"*+*,*-$%?@*A:.#%BSDE%T"#3#%.#3:1,3%3"-!%
,"2,%&'()%3,.-$A1R%.#6:4#3%4-1-$R%H-.52,*-$%2$6%*$6:4#3%4#11%6#2,"%*$%&78%4#11F1*$#3E%
%
!"#$%##"&'((
75*=L%2%5#5+#.%-H%,"#%9-1R4-5+%A.-:9%9.-,#*$3L%*3%.#U:*.#6%H-.%3#1HF.#$#!21%-H%$#:.21%
3,#5%4#113%2$6%*3%:9.#A:12,#6%*$%3#G#.21%42$4#.3E%Q,%*3%213-%V$-!$%,-%.#9.#33%Q$VP2WX.H%
1-4:3%*$"*+*,*$A%9.-A#$*,-.%4#11%9.-1*H#.2,*-$%6:.*$A%$#:.21%6*HH#.#$,*2,*-$%Y)MZE%Q$%
6*HH#.#$,*2,#6%4#113L%75*=%1#G#13%6#4.#23#%!"*1#%Q$VP2WX.H%9.-,#*$%1#G#13%*$4.#23#%YP[ZE%X3%
,"#%Q$VP2WX.H%1-4:3%*3%H.#U:#$,1R%6#1#,#6%*$%+.2*$%,:5-.3%YP=ZL%,"#%.-1#%-H%75*=%
-G#.#I9.#33*-$%*$%&78%4#113%299#2.3%,-%+#%6*3,*$4,%H.-5%*,3%.#9.#33*-$%-H%,"#%Q$VP2WX.H%
1-4:3E%@-.%#I2591#L%6-!$.#A:12,*-$%-H%75*=%6*6%$-,%*$H1:#$4#%Q$VP2WX.H%9.-,#*$%1#G#13%*$%
,:5-.%4#113%,"2,%.#,2*$#6%,"#%Q$VP2WX.H%1-4:3E%T":3L%*$%&78%4#113L%75*=%,2.A#,3%2%
6*HH#.#$,%92,"!2RE%'4.##$*$A%-H%3#G#.21%V#R%9.-,#*$3%4-$,.-11*$A%4#11%4R41#L%6#G#1-95#$,L%
5#,2+-1*35L%29-9,-3*3%2$6%A.-!,"L%*$41:6*$A%S.VL%XV,L%&'()!%L%9=K%2$6%9=PL%741FJL%4F 8R4L%<#3,*$%2$6%'-IJL%3"-!#6%,"2,%6-!$.#A:12,*-$%-H%75*=%.#6:4#6%&'()!%9.-,#*$%
1#G#13%2$6%*$6:4#6%6*HH#.#$,*2,*-$%*$%42$4#.%4#113E%Q$%266*,*-$L%,:5-.%4#11%9.-1*H#.2,*-$L%
!"#$%$&'()*%+#&,%-.)&./)0'-.-+1.%0%,2)31#1)*)/'2)#1/"01/5))
6%!0-$1#1/)!-*1)78)21&#!)&+-)9:7;()<=>?)@&!)A11.)0-.!%/1#1/)-.'2)#101.,'2)&!)&)
,@1#&B1",%0),&#+1,)C-#)0&.01#)9??;5)D,)@&!)A11.)!@-3.),@&,),@%!)1.E2*1).1+&,%$1'2)#1+"'&,1!) ,@1)F.,()G1/+1@-+)&./)H-,0@)B&,@3&2!()3@%0@))&A1##&.,'2)&0,%$&,1/)%.)!1$1#&')
0&.01#!)9??(:?;5)I@%!)!"++1!,!),@&,)<=>?)%.@%A%,-#!)0-"'/)1J1#,)&),@1#&B1",%0&''2) .1+&,%$1()B#-K!"#$%$&')1CC10,)-.),"*-#)01''!5)G-31$1#(),@1)'-.+K,1#*)*1/%0&')"!1)-C),@1)
<=>?)%.@%A%,-#)L%M')C-#),@1),#1&,*1.,)-C)B!20@%&,#%0)/%!-#/1#!)/%/).-,)'1&/),-)&.)%.0#1&!1)
%.)0&.01#)%.0%/1.01)9::;()&#+"%.+)&+&%.!,)&.)-.0-+1.%0)1CC10,)-C)<=>?)%.@%A%,-#!5)N.),@1) 0-.,#()M-@1.)et al.)/1*-.!,#&,1/),@&,)0&.01#)B#1$&'1.01)%.)B!20@%&,#%0)B&,%1.,!)-.) '-.+K,1#*)L%M')*1/%0&,%-.)3&!)'-31#),@&.)%.),@1)+1.1#&')B-B"'&,%-.)9::;()!"++1!,%.+) 1$1.)&)B#-,10,%$1)1CC10,)-C)L%M'5)I@1)#1!"',!)B#1!1.,1/)@1#1)-CC1#)&)*-'10"'&#)1JB'&.&,%-.) -C),@%!)1B%/1*%-'-+%0&')-A!1#$&,%-.O)&/*%.%!,#&,%-.)-C)L%M')%./"01!)/%CC1#1.,%&,%-.)&./)
%.@%A%,!)B#-'%C1#&,%-.)&./(),@1#1A2()*%+@,)1CC10,%$1'2)%.@%A%,),"*-#)C-#*&,%-.)&./) B#-+#1!!%-.5)P"#,@1#*-#1(),@1)B'1,@-#&)-C)0'%.%0&')/&,&)-.)L%M')-CC1#)!-'%/)%.C-#*&,%-.)
&A-",)B-,1.,%&')!%/1K1CC10,!)&./)%,)&BB1&#!)!&C1),-)&!!"*1),@&,).-#*&')&/"',)!,1*)01''!)) .-,).1+&,%$1'2)&CC10,1/()1$1.)A2)'-.+K,1#*)"!1)-C),@1)/#"+5)I@1)$1#2)!%*%'&#)B@1.-,2B%0)
&./)C".0,%-.&')&',1#&,%-.!)%./"01/)A2)1%,@1#)%.@%A%,%.+)<=>?)-#)A2)/-3.#1+"'&,%.+)Q*%R)
%.),@1)B#1!1.,)!,"/2)B-%.,!),-)&)C".0,%-.&')'%.4)A1,311.)Q*%R)&./)<=>?5)G-31$1#() C"#,@1#)!,"/%1!)).11/1/),-)&.&'2E1)3@1,@1#),@1#1)%!)&)/%#10,)%.,1#&0,%-.)A1,311.)Q*%R)
&./)<=>?5)6-3.#1+"'&,%.+)<=>?)!B10%C%0&''2)/10#1&!1/),@1)!"AB-B"'&,%-.)-C)0&.01#) 01''!),@&,)0-.,&%.1/)&)0&.01#)!,1*)01''K'%41)!%+.&,"#1)A2)/#%$%.+),@1*)%.,-)/%CC1#1.,%&,%-.5))
=-J7)B#-,1%.)%!)3%/1'2)1JB#1!!1/)%.),@1)1&#'2).1"#&')B'&,1)&./)1&#'2).1"#&'),"A1)-C)!1$1#&')
!B10%1!)9:8;5)D.),@1)/1$1'-B%.+)01.,#&').1#$-"!)!2!,1*()=-J7)1JB#1!!%-.)A10-*1!)
