The Role of DNA Repair in the Evolution of Vertebrate Longevity

(1)

The Role of DNA Repair in the Evolution of Vertebrate Longevity

Dissertation

zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) an der Universität Konstanz,

Fachbereich Biologie

vorgelegt von

Birgit Gohm

Tag der mündlichen Prüfung: 12.10.2016 Referent: PD Dr. Sascha Beneke

Referent: Prof. Dr. Martin Scheffner

(2)

(3)

Zusammenfassung

In der heutigen Zeit sind Alterungsprozesse und die Evolution von Langlebigkeit mehr denn je ein wichtiges und interessantes Forschungsgebiet. Das Verständnis der molekularen Grundlagen ist dabei die Voraussetzung, um effizient altersbedingte Erkrankungen entgegen treten zu können.

Das Hauptaugenmerk des vorliegenden Projektes liegt auf der Poly(ADP- ribose) Polymerase 1 (PARP1), einem Protein, das unter anderem eingebunden ist in die Regulation der DNA Reparatur, der genomischen Stabilität und Alterung. PARP1 bewirkt die Katalyse einer weitreichenden posttranslationalen, kovalenten Proteinmodifikation, und ist damit die Hauptquelle einer Reaktion, die Poly(ADP-ribosyl)ierung genannt wird. In dieser Reaktion wird das Substrat Nicotinamidadenindinukleotid (NAD⁺) in Nikotinamid, ein Proton und ADP- Ribose gespalten. Das letztere wird dabei kovalent an ein Akzeptorprotein gebunden, wie beispielsweise Histone oder PARP1 selbst.

PARP1 ist in allen eukaryotischen Zellen (außer Hefen) zu finden und ist ein evolutionär stark konserviertes Protein (ungefähr 60 % Übereinstimmung zwischen H.sapiens und D.melanogaster), wobei die Aktivität einer beachtlichen Variation unterliegt. Der Einfluss von DNA Reparaturregulation auf den Alterungsprozess und umgekehrt ist in Säugern hinreichend bekannt, ob dies jedoch in anderen Wirbeltierklassen ebenso ein generelles Alterungsmerkmal ist, wurde bisher nicht untersucht. Rekombinantes PARP1 von unterschiedlichen Fischarten wurde eingesetzt, um in vitro die Korrelation von Enzymaktivität mit der jeweiligen Lebensspanne zu bestimmen. Der Vorteil vieler Fischarten ist, dass sie ebenso wie Säuger differenzierte Gewebe besitzen und organspezifische Anzeichen von Alterung zeigen, im Gegensatz zu anderen Modell-Spezies. PARP1 von Nothobranchius furzeri, einem extrem kurzlebigem afrikanischem Killifisch (ca. 9 Monate), und anderen Nothobranchius-Arten (Lebensspanne bis zu 18 Monaten) wurden in dieser Studie zusammen mit dem Zebrafisch Danio rerio (ca. 42 Monate) und dem

(4)

Medaka Oryzias latipes (ca. 60 Monate) eingesetzt. Diese Auswahl an unterschiedlichen Fischarten erlaubt die Betrachtung von PARP1 auf einer evolutionär basaleren Ebene.

In dieser Arbeit war es möglich, die PARP1 DNA Sequenz der vier untersuchten Nothobranchius-Arten (N.furzeri, N.orthonotus, N.rubripinnis und N.korthausae) zu definieren. Aufgrund des hohen Konservierungsgrades könnte es anhand des Aminosäurensequenzvergleichs möglich werden, die PARP1 Aktivität auf definierte Sequenzabschnitte bzw. einzelne Aminosäuren zurückzuführen.

Nachfolgend wurden die rekombinanten Proteine mit Hilfe eines baculoviralen Expressionssystems exprimiert und aufgereinigt. Durch Aktivitätsassays mit anschließenden Slotblots war es möglich die enzymatischen Parameter K_M und V_max zu bestimmen und die Wechselzahl k_cat und die katalytische Effizienz kcat / KM zu berechnen. Diese zeigten eine starke Korrelation zur Lebensspanne und untermauert damit die Bedeutung von PARP1 im Alterungsprozess. Die optimale Reaktionstemperatur der Fisch-PARP1s lag zwischen 27 und 30°C.

Die Durchführung der Reaktionen bei einer Temperatur von 30°C ermöglichten damit eine Reaktionsdurchführung im optimalen Temperaturbereich und zudem den direkten Vergleich zu Parametern von rekombinantem murinem und humanem PARP1 aus einer Studie von S. Beneke aus dem Jahr 2010. Die Aktivität von PARP1 bei Fischen mit den Lebensspannen von 9 – 60 Monaten scheint im Gegensatz zu humaner PARP1 und PARP1 von Ratten, zu gleichen Teilen abhängig zu sein von der Substrataffinität und der maximalen Reaktionsgeschwindigkeit.

(5)

Abstract

The ageing process and the evolution of longevity is more than ever an important field of research. Understanding the molecular basis of ageing is a pre-requisite for effective intervention to counteract age dependent pathologies.

The main focus of this project is on poly-(ADP-ribose) polymerase 1 (PARP1), a protein involved in the regulation of DNA repair, genomic stability and ageing.

PARP1 accomplish its functions via the catalysis of a drastic posttranslational, covalent protein modification and is the main source of poly(ADP-ribose). In the reaction the substrate nicotinamide adenine dinucleotide (NAD⁺) is cleaved in nicotinamide, one proton and ADP-ribose, with the latter covalently bound to an acceptor protein, as for example histones or mainly PARP1 itself.

PARP1 is found in all eukaryotic cells (except yeasts) and is highly conserved in evolution (about 60 % between H.sapiens and D.melanogaster), but activity varies substantially. The impact of DNA repair regulation on the ageing process and vice versa is well established for mammals, but if this is a general feature of ageing also in other vertebrate classes has not been investigated so far. This project is aimed at this point. Recombinant PARP1 from different fish species were utilized to correlate the in vitro activity with the respective life span. Many fish have the advantage to possess differentiated tissues compared to other species used as animal models, and show organ-specific signs of ageing, similar to mammals. PAPR1 from Nothobranchius furzeri, an extreme short lived

(~ 9 months) annual fish and other Nothobranchius species (up to 18 months) are used in this study together with zebrafish D.rerio (42 months) and medaka O.latipes (60 months). This panel of different fish may help to elucidate the importance of PARP1 in the ageing process on a more evolutionary basis.

In this study the PARP1 coding sequence of the investigated Nothobranchius species (N.furzeri, N.orthonotus, N.rubripinnis and N.korthausae) was determined. The comparison of the amino acid sequences was the first step towards the tracking of PARP1 activity back to stretches of or even single amino

(6)

acids. Further, the recombinant proteins were generated using a baculoviral expression system and purified in an optimized purification process. The enzymatic parameter K_M and V_max were determined, the turnover number k_cat and the enzyme efficiency k_cat / K_M were calculated using activity assays in combination with the well-established slot blot technique. The activity of fishPARP1s shows, similar to mammalian PARP1, a strong correlation with the respective life span and therefore underlines the potential importance of PARP1 in the ageing process. The optimal reaction for fishPARP1 temperature was between 27 and 30°C. Consequently, the chosen reaction temperature of 30°C enabled on one hand an optimal temperature and on the other the direct comparison with recombinant human and murine PARP1 from a study of S. Beneke in 2010. Interestingly, the PARP1 activity of fish seems – in contrast to mammalian PARP1 – to be equally dependent on substrate affinity and the maximum reaction velocity.

(7)

Abbreviations

aa Amino acid

ab Antibody

ADP Adenosine diphosphate AIF Apoptosis inducing factor

amp Ampicillin

APS Ammonium persulfate BER Base excision repair

bp Base pair

BSA Bovine serum albumin C-terminus carboxyl – terminus cDNA copy DNA

cfu colony forming unit

Da Dalton

DAPI 4´,6-diamidino-2- phenylindole

DBD DNA-binding domain

ddH2O Double-distilled water DEPC Diethylpyrocarbonate DMSO Dimethyl sulfoxide DNA Desoxyribonucleic acid dsDNA Double-stranded DNA DTT 1,4-Dithiothreitol

ECL Enhanced

chemiluminescence

EDTA Ethylenediamine-tetraacetic acid

FCS Fetal calf serum

g Gravitational acceleration GαM Goat anti-mouse

GαR Goat anti-rabbit

HR Homologous recombination HRP Horseradish peroxidase kDa kilo Dalton

KM Michaelis-Menten constant LB Luria-Bertani broth

moi Multiplicity of infection N-terminus Amino-terminus

NAD⁺ Nicotinamide adenine dinucleotide

NLS Nuclear localization signal NP40 Nonidet P40

o/n Over night

p.i. Post infection

PAGE Polyacrylamide gel electrophoresis

PAR Poly(ADP-ribose) PARG Poly(ADP-ribose)glyco-

hydrolase

PARP Poly(ADP-ribose)polymerase PBS Phosphate buffered saline PCR Polymerase chain reaction pfu Plaque forming unit P/S Penicillin / Streptomycin PMSF Phenylmethylsulphonyl-

flouride

RNA Ribonucleic acid

RNS Reactive nitrogen species ROS Reactive oxygen species rpm rotations per minute

RT Room temperature

SAP Shrimp alkaline phosphatase SD Standard deviation

SDS Sodium dodecyl sulfate SEM Standard error of the mean ssDNA Single-stranded DNA

TAE Tris / acetic acid / EDTA – Buffer

TBS Tris buffered saline TCA Trichloroacetic acid Temed N,N,N´,N´-Tetramethyl-

ethylenediamine

TNT Tris / NaCl / Tween20 – Buffer

TTB TBS / Tween20 / BSA – Buffer

V Maximum reaction velocity

(11)

1 Introduction

The ageing process and the evolution of longevity is more than ever an interesting field of research. Understanding the molecular basis of ageing is a pre-requisite for proper intervention to counteract ageing-dependent pathologies.

Activity of poly(ADP-ribose)polymerase 1 (PARP1) generates a posttranslational, covalent modification, and the strongest inducer of poly(ADP- ribosyl)ation reaction is genotoxic stress. The following chapters will give an overview on the current state of research about those subjects and elucidate their connection.

1.1 Ageing and Longevity

Ageing is a multi-factorial, continuous process, defined through various characteristics. Troen defines ageing as follows: An organism shows age- dependent changes in the biochemical composition in tissues and progressive decrease in physiological capacity. The ability to respond adaptively to environmental stimuli with age is reduced. Furthermore, there is an increased susceptibility and vulnerability to diseases and risk of mortality (Troen, 2003).

Moreover, on a molecular basis ageing leads to dys- or malfunction of metabolic processes and cellular functionality. This decline can result in the development of age-related diseases, such as metabolic disorders (e.g. type 2 diabetes), neurodegenerative diseases (e.g. Alzheimer´s and Parkinson´s disease) or cancer.

(12)

1.2 PARP1 and the PARP Family

The PARP family enfolds 17 members, all sharing the so called PARP signature, a highly conserved region in the catalytic domain (Ame et al., 2004).

The subdivision of the enzymes regarding there enzymatic activity in mono(APD-ribosyl)transferases, for example PARP10 (Kleine et al., 2008), and true poly(ADP-ribosyl)transferases, as PARP1 and PARP2 (Alvarez-Gonzalez and Jacobson, 1987; Ame et al., 1999) and Tankyrase1 (Rippmann et al., 2002) is an ongoing process (Hottiger et al., 2010). Additionally, PARPs have many different localizations and functions.

PARP1 [EC 2.4.2.30] is the founding member of the PARP family, with its activity identified in 1963 by Chambon and colleagues (Chambon et al., 1963).

So far, it was found in all eukaryotes, except yeast. PARP1 is the best studied isoform of the PARP family and upon genotoxic stress it is responsible for about 90% of poly(ADP-ribose) (PAR) production (D'Amours et al., 1999). It is an abundant nuclear enzyme with up to 5 x 10⁵ – 2 x 10⁶ copies per cell (Yamanaka et al., 1988). Human PARP1 is a 113 kDa enzyme with a length of 1014 amino acids, encoded by the ADPRT (ADP-ribosyltransferase) gene located on chromosome 1 at position 1q41-q42. It consists of 3 major domains:

Figure 1-1 Scheme of PARP1. The schematic view of PARP1 containing 3 domains: the DNA binding domain (DBD), with its two zinc fingers (ZnI and ZnII), the bipartite nuclear localization signal (NLS) with a caspase 3 cleavage site (Casp.), followed by a zinc ribbon motif (ZRM), the automodification domain with the BRCT domain, and the catalytic domain in the C-terminal part, where the WGR domain and the PS (PARP signature) are located.

(1) DNA Binding Domain (DBD): 42 kDa, N-terminal residues 1 – 372 aa

(13)

The zinc fingers (Zn) of the DBD are essential for the binding of the enzyme to DNA strand breaks, followed by activation. ZnI (aa 11 – 89) binds to DNA single and double strand breaks (SSB, DSB), whereas ZnII (aa 115 – 199) binds exclusively to SSB (Mazen et al., 1989; Menissier-de Murcia et al., 1989) . After binding to DNA breaks, PARP1 is strongly activated. It was shown that besides the two Zn-fingers the ZRM or Zn3 (aa 233 – 373) also plays an important role in the PARP activation (Langelier et al., 2010; Tao et al., 2008). Localization as well as apoptosis-specific degradation, is mediated by the region from aa 207- 226, which comprises a bipartite nuclear localization signal (aa 207-217 and 221-226) and contains a cleavage sites for caspases 3 and 7 (Germain et al., 1999; Schreiber et al., 1992).

(2) Automodification Domain (AD): 16 kDa, central residues 373 – 524 aa This domain contains the acceptor amino acids for covalent attachment of PAR and comprises a BRCT (breast cancer susceptibility protein C-terminus) motif (aa 386 – 464). This motif in general is important for protein-protein interactions and a prevalent feature of cell cycle and DNA repair proteins (Bork et al., 1997).

(3) WGR / Catalytic Domain (CD): 55 kDa, C-terminal residues

525 – 1014aa

The highly conserved PARP signature (aa 859 – 908) is located within the catalytic domain, which is responsible for the attachment of NAD⁺, the transfer of the ADPr subunits and the branching (Ruf et al., 1996; Simonin et al., 1993).

Additionally, a WGR motif, a tryptophan-, glycine- and arginine- rich area of 80 – 90 aa, is located ahead of the catalytic fold. The function of this motif is still not fully understood, but it seems to be necessary for activity (Langelier and Pascal, 2013).

(14)

1.3 Poly(ADP-ribosyl)ation Metabolism

One of the first cellular responses to genotoxic stress is poly(ADP-ribosyl)ation, which is a drastic posttranslational modification, performed by PARPs (Beneke and Burkle, 2007; Burkle, 2005; Sugimura, 1973). The Poly(ADP-ribosyl)ation reaction can be divided into three steps: Initiation, elongation and branching (Alvarez-Gonzalez and Mendoza-Alvarez, 1995).

Figure 1-2 Poly(ADP-ribosyl)ation reaction. The substrate NAD⁺ is cleaved in nicotinamide, a proton and ADP-ribose (ADPr). This ribose moiety is covalently bound to an acceptor protein (1). Further ADP-ribose subunits were successive catalyzed and transferred for elongation (2) and branching (3). Poly(ADP-ribose)glycohydrolase (PARG) degrades the polymer (red arrows).

(Modified from Master Thesis Birgit Gogol, 2010)

During the initiation step the first ADPr moiety is covalently attached to an amino acid of an acceptor protein. The possible acceptor amino acids for PARP1, glutamic acid, aspartic acid and lysine, and their prevalence in usage are still under debate (Altmeyer et al., 2009; Chapman et al., 2013; Gagne et al., 2015; Jungmichel et al., 2013; Ogata et al., 1980; Pic et al., 2011; Rosenthal

(15)

and Hottiger, 2014; Rosenthal et al., 2011). PARP1 is its most important acceptor protein itself. For effective automodification two PARP1 molecules are necessary, working probably as catalyst as well as acceptor in a homomodification reaction (Mendoza-Alvarez and Alvarez-Gonzalez, 1993;

Pion et al., 2005).

Further ADPr moieties are added step by step via 2´ → 1´´ glycosidic bonds, thus elongating the PAR chain. Depending on the chain length branching can take place every 20 to 50 ADPr subunits in vitro and in vivo via a 2´´ → 1´´´

glycosidic bond (Alvarez-Gonzalez and Jacobson, 1987; Juarez-Salinas et al., 1982; Kiehlbauch et al., 1993; Miwa et al., 1979; Reeder et al., 1967).

PARG (poly(ADP-ribose)glycohydrolase), a PAR degrading enzyme, is responsible for the reverse effect. PARP activity in unstimulated cells is very low, leading to low PAR concentrations with a half-life of several hours. Upon activation the turnover rate of PAR is ranging from seconds to few minutes (Alvarez-Gonzalez and Althaus, 1989). Through endo- and exoglycolytic activity complex PAR is cleaved into short chains of about 20 subunits, although a recent publication suggests mainly very short oligomers (Barkauskaite et al., 2013). The affinity of PARG to these oligomers is strongly reduced, therefore further degrading is decelerated (Brochu et al., 1994; Hatakeyama et al., 1986).

The effect of PAR is highly dependent on amount and chain length and free PAR for example is involved in cell death signaling (Hong et al., 2004; Naegeli and Althaus, 1991).

Moreover, the cleavage of the last covalently bound ADPr subunit is conducted by the macro domain proteins MacroD1, MacroD2 and C6orf130 (Rosenthal et al., 2013).

Besides the covalent modification with PAR, many proteins are able to interact with PAR in a non-covalent manner via different motifs, namely the PAR binding motif (PBM), macro domains, a PAR binding zinc finger (PBZ) and a variant version of it (Ahel et al., 2008; Karras et al., 2005; Min et al., 2013; Pleschke et al., 2000). Those proteins are involved for example in DNA repair (ATM, XPA, XRCC1), cell cycle regulation (p53, Chk1), chromatin structure regulation

(16)

(histones, DEK) and telomeric maintenance (TERT, TRF2) (Dantzer et al., 2004; Fahrer et al., 2010; Haince et al., 2007; Malanga et al., 1998; Panzeter et al., 1993; Pleschke et al., 2000).

1.4 Functions of PARP1 and PARylation

PARP1 and PARylation are involved in a multitude of regulatory functions, including DNA damage signaling, DNA repair, chromatin reorganization, transcription, cell death, ageing and more. In this chapter these functions are described in more detail.

1.4.1 PARP1 in DNA Repair

PARP1 has been shown to be involved in different DNA repair pathways.

Activated upon binding to single and double strand breaks via its zinc fingers, it is not surprising it plays an important role in base excision repair (BER) and double strand break (DSB) repair mechanisms, such as non-homologous end- joining (NHEJ) and homologous recombination (HR), but is also involved in nucleotide excision repair (NER).

1.4.1.1 PARP1 in BER

In BER, which is initiated after lesions caused by alkylating agents or reactive oxygen and nitrogen species (ROS, NOS), lesion-specific DNA glycosylases remove the damaged bases, generating an apurinic or apurimidinic site. This site is substrate for AP endonucleases leading to a SSB. In the following BER is completed by the short-patch (one nucleotide) or long-patch (2 – 13 nucleotides) BER pathway, where new DNA is synthesized and religated (Dianov et al., 1992; Frosina et al., 1996). PARP1 binds to the generated SSB and synthesizes PAR, which enables the recruitment of the scaffold protein XRCCI, DNA polymerase β and ligase III (Dantzer et al., 2000; El-Khamisy et al., 2003; Leppard et al., 2003) and thus organizing the repair. Additionally,

(17)

PARP1 interacts with flap-endonuclease 1 (FEN1) involved in the long-patch pathway (Prasad et al., 2001).

1.4.1.2 PARP1 in NER

The NER with its two sub-pathways, the global-genome coupled (GGC) and the transcription coupled (TC) repair, is induced by bulky DNA lesions caused by UV light or mutagenic chemicals. An interaction of PARP1 with xeroderma pigmentosum A protein (XPA) and cockayne syndrome B protein, responsible for recognition of TC-NER, was shown (Fahrer et al., 2007; Fischer et al., 2014;

Flohr et al., 2003). Furthermore, the chromatin-remodeling enzyme ALC1 is recruited by PAR (Pines et al., 2012).

1.4.1.3 PARP1 in DSB Repair

The most critical DNA lesions in cells are DNA DSB, which can be caused by exogenous (e.g. ionizing radiation and chemicals) or endogenous sources (e.g.

replication). To cope with these DNA DSBs two different repair mechanisms are available: HR and the potentially error-prone NHEJ. During the latter both broken double-strands are ligated after certain amount of end-processing, which can lead to loss of sequence information or association of different break-sites, whereas the HR works by utilizing a sister chromatid as template and therefore only occurs in S/G2 phase. A multitude of proteins are involved in these pathways and PARP1 and PAR shows interactions with the Ku70/Ku80 heterodimer and DNA-PK_CS, both involved in NHEJ (Galande and Kohwi- Shigematsu, 1999; Ruscetti et al., 1998). MRE11, forming a multi-protein complex during HR, binds PAR in a non-covalently manner (Haince et al., 2008). Additionally, although the mechanism is not fully understood, the interaction between Ku and PARP1 has a regulatory effect on which of the pathways is chosen (Hochegger et al., 2006; Wang et al., 2006).

ATM, a major DNA damage signaling kinase at DNA DSB, interacts with PARP1, thus ensuring further down-stream signaling and initiation of repair and cell cycle arrest (Aguilar-Quesada et al., 2007; Haince et al., 2007).

Highlighting the importance of PARP1 in DNA repair and especially in genomic stability, it was shown that after inhibition or abrogation of PARP the treatment

(18)

of cells with a carcinogen leads to increased sister chromatid exchanges (SCE) or micronuclei formation, both marker for impaired genomic integrity (Oikawa et al., 1980; Schwartz and Weichselbaum, 1984; Wang et al., 1997). Furthermore, PARP1 overexpression reduced SCE formation induced by alkylating agents (Meyer et al., 2000).

1.4.2 PARP1 in Cell Death and Inflammation

As described above, PARP1 is intimately involved in DNA repair processes.

Furthermore, PARP1 is also an important player in cell death and inflammation.

In principle, depending on the degree and kind of activation of PARP1, either DNA repair, caspase-independent apoptosis, or necrosis due to energy failure can occur.

Under low to moderate stress conditions PARP1 and its product PAR lead to DNA repair, thus maintaining genomic integrity. Extensive DNA damage results in strong activation of PARP1 and high PAR levels. PARG releases oligo(ADPr), which is able to translocate to the mitochondria by an unknown mechanism, and releases apoptosis-inducing factor (AIF) from the inter- membrane space. AIF translocates back to the nucleus, inducing high- molecular weight DNA fragmentation and caspase-independent apoptosis (Cregan et al., 2004; Yu et al., 2002). Recent studies show a binding of AIF to PAR by a special binding motif, distinct from the DNA binding site of AIF, allowing its transport to the nucleus (Wang et al., 2011). So the term

“parthanatos” for AIF/PAR mediated cell death was introduced (David et al., 2009). Finally, degradation of PAR into ADPr is also able to induce death in cells expressing the TRPM2 membrane channel. Upon binding of ADPr to the NUDIX domain of TRPM2, Ca²⁺ is passing the membrane, which increases the free cytosolic Ca²⁺ concentration. This induces activity of calpains and subsequently cell death (Blenn et al., 2011). PARP1 itself is cleaved by caspase 3 and 7 in early stages of apoptosis, thus protecting cells from energy depletion (Germain et al., 1999; Kaufmann et al., 1993).

(19)

Aside from these scenarios, an overactivation of PARP1 and very strong production of PAR can kill cells by a different mechanism: Massive activation depletes NAD⁺ pools, followed by a drop in ATP as it is used to resynthesize NAD⁺, ultimately leading to energy failure and necrosis (Berger et al., 1983).

In context with PARP1 overactivation it has been shown that PARP1 is involved in inflammatory responses. PARP1 knock out mice or rats treated with PARP inhibitors are protected from inflammatory correlated diseases, such as ischemia reperfusion damage, neuro-degenerative diseases (e.g. Parkinson´s disease) and diabetes type I (Ding et al., 2001; Mandir et al., 1999; Pieper et al., 1999). Additionally, the transcription factor nuclear factor kappa B (NF-κB), a major transcription factor of the immune response and leading to enhanced levels of pro-inflammatory enzymes (e.g. iNOS (inducible nitric oxide synthase)) and cytokines such as TNFα (tumor necrosis factor α) and several interleukines (e.g. IL1β, IL6, IL8), interacts with PARP1 as transcriptional cofactor. iNOS in turn produces high amounts of nitric oxide, which can result in RNS leading to further DNA damage, thus adding fuel in the vicious cycle of PARP1-dependent inflammation (reviewed in (Beneke, 2008). In PARP1 knock-out mice or PARP1 deficient cells expression of these genes is downregulated (Hassa and Hottiger, 2002).

In conclusion, PARP activity has to be balanced for proper physiological functions: Too less activity leading to impaired DNA repair and genomic instability, too much resulting in cell death and / or pathophysiological processes (Burkle, 2001b).

Of note, inflammation is an important part of the ageing process and PARP1 is contributing to these processes (De Martinis et al., 2005).

1.4.3 Further Functions of PARP1

Besides its importance in DNA repair and inflammation, PARP1 is also involved in the local and global regulation of the chromatin structure, either in the context of signaling cascade-mediated transcription or upon DNA damage. PARP1 can

(20)

covalently attach PAR to histones, but histones can also interact and very strong non-covalently with PAR, thus being “shuttled” from the DNA and leading to a relaxation of the chromatin structure (Althaus, 1992; Althaus et al., 1993;

Beneke, 2012; Okayama et al., 1978).

The tumor suppressor protein p53, which regulates cell cycle progression and acts as a transcription factor for pro-apoptotic genes, is influenced by PARP1 (covalently and in a non-covalent way by PAR) as well (Fahrer et al., 2007;

Malanga et al., 1998).

1.4.4 Ageing and PARP1

PARPs, especially PARP1 as described above, are involved in the regulation of many important physiological and pathophysiological processes, as DNA repair, cell-cycle regulation, inflammation and cell death. These processes in turn are playing pivotal roles in the ageing process (Beneke and Burkle, 2004, 2007;

Burkle, 2001a; Burkle et al., 2005).

The ageing process on a cellular level is marked among others by senescence, which in turn is strongly dependent on the telomere length. PARP1 is localized at telomeres and is involved in their maintenance and control. Telomeric repeat- binding factor 2 (TRF 2) is PARylated by PARP1, whereas two other PARPs, tankyrases 1 and 2, interact with TRF 1 (Cook et al., 2002; Dantzer et al., 2004;

Gomez et al., 2006; Smith et al., 1998), but only in primate cells and during mitosis, when the nuclear membrane is absent. It was shown, that the inhibition of PARP activity as well as PARP1 knock-down led to accelerated telomere shortening even in telomerase expressing cells (Beneke et al., 2008).

PARP1 also interacts with proteins known to cause premature ageing when mutated, as Cockayne Syndrome B protein (CSB) and Werner protein (WRN) (Adelfalk et al., 2003; Flohr et al., 2003; Thorslund et al., 2005). PARP1 and WRN together are involved in the regulation of the BER pathway, but also play a role in replication and telomere maintenance (Cheng et al., 2008; Machwe et al., 2004; von Kobbe et al., 2003). Both, the exonuclease and the helicase activity of the WRN can be inhibited by PARP1 depending on the PARylation status of PARP1 (Popp et al., 2013; von Kobbe et al., 2004).

(21)

A linear correlation of PARP activity and life span was reported in 1992 by Grube and Bürkle. In this study a positive correlation between maximum life span of 13 mammalian species and cellular PARylation capacity in peripheral mononuclear blood cells (PBMCs) was demonstrated (Grube and Burkle, 1992).

These results were confirmed by in vitro studies with purified recombinant PARP1 of rat and human. Here, hPARP1 showed a 2-fold higher specific activity compared to rPARP1 (Beneke et al., 2000). Further enzymatic studies revealed that an allelic variation of human PARP1 at position 762 (exchange of valine and alanine) is responsible for strong differences in the enzymatic activity. The enzyme efficiency k_cat / K_M (s^-1 M^-1) of the more active human valine variant and rat PARP1 perfectly mirrors the 5-fold difference in activity detected in PBMCs in first study of 1992, showing that this difference is not dependent on the cellular background but on the amino acid composition (Beneke et al., 2010).

Adding to this, PARP1 deficient mice are bound to accelerated ageing and carcinogenesis (Piskunova et al., 2008).

Interestingly, PARP1 is not only involved in the ageing process and activity correlates with life span, but activity is also correlated to longevity: A decline in PARylation capacity of PBMCs in humans and rats as a function of age was shown in 1992 and studies with lymphoblastoid cell lines derived from centenarians revealed an increased PARP activity compared to controls (Grube and Burkle, 1992; Muiras et al., 1998).

1.5 Fish as Model Organisms in Ageing Research

Choosing a model organism requires some careful consideration. The phylogenetic distance of man and model should be as short as possible and of course it is important in ageing research that the model shows biomarkers of ageing.

(22)

Some studies were conducted with humans (H.sapiens) and primates, but because of the long life spans and ethical reasons the possibilities of those are quite limited. Mice (M.musculus) and also rats (R.norvegicus) are classical model organisms in ageing studies, but still have a long span of about 24 months and as all mammals are costly in maintenance. In addition, most mouse tissues express telomerase, making studies related to proliferation-associated cellular senescence and ageing very difficult. There are many studies on C.elegans and D.melanogaster, as both are displaying short life spans, are easy to cultivate and cause low costs. On the other hand the phylogenetic distance from worm / insect to man is far. Furthermore, they predominately have postmitotic tissues after maturation. An alternative is the large clade of fish, which have a high variety in life spans, are easy to reproduce, are vertebrates as humans and raise lower maintenance costs than mammals (Guarente and Kenyon, 2000; Lucas-Sanchez et al., 2014). In addition, more general ageing mechanisms can be investigated by comparing results from mammalian and fish models. As fishes are non-homeothermic animals the impact of adaption to living temperature as environmental factor can also be explored.

Ageing research in fish started with guppy (P.reticulata) in 1978 and up to now mainly zebrafish (D.rerio) (Hamilton-Buchanan, 1822), medaka (O.latipes) (Temminck and Schlegel, 1846) and the annual fish Nothobranchius furzeri (Jubb, 1971) are established in this area (Ding et al., 2010; Genade et al., 2005;

Kishi, 2004; Woodhead, 1978).

Model species within the Chordata show substantial variations in their life span from a few months (N.furzeri) to more than one hundred years (H.sapiens). The molecular basis of these differences in the ageing process is yet not well understood.

(23)

1.5.1 Medaka, Zebrafish and Killifish – a panel of “ageing fish”

N.furzeri belongs to the order of Cyprinodontiformes and therein to the genus Nothobranchius, which contains many species and is a close relative to medaka.

Figure 1-3 Phylogenetic tree of the examined fish species. The phylogenetic tree shows the relation between genera of Nothobranchius, Oryzias and Danio. The orders are highlighted by the vertical bars (modified from NFIN, www.nothobranchius.info).

It is a notably short-lived species with a maximum life span of about 3 to 9 months depending on the strain. This variations seems to arise from differences in habitat aridity (Dorn et al., 2014; Terzibasi et al., 2008). The annual fish is found in eastern and southern Africa during the monsoon season in ephemeral bodies of waters. At the end of the monsoon, when their habitat dries out all adult fish are dying, restricting their natural life span to few months and thus reasoning the short life span. The eggs are desiccation resistant and are able to survive the dry season. In the Gona Re Zhou National Park in Zimbabwe the first laboratory strain of N.furzeri was isolated in the late 1960s (Jubb, 1971, 1981).

Studies with N.furzeri showed rapid growth and early sexual maturity, followed by age-dependent decline characterized by behavioral features and biomarkers of ageing as telomere shortening or increase of the senescence marker lipofuscin (Hartmann et al., 2009; Terzibasi et al., 2007; Valenzano et al.,

(24)

2006a). Further, life span can be prolonged by either dietary restriction, decline in water temperature or administration of resveratrol (Terzibasi et al., 2009;

Valenzano et al., 2006a; Valenzano et al., 2006b). Besides N.furzeri, so far mainly N.guentheri is used in ageing studies (Liu et al., 2012).

Another killifish used in this study is N.korthausae (Meinken, 1973) with a life span of about 18 months (Baumgart et al., 2015). N.orthonotus´ (Peters, 1844) life span is not exactly determined yet, but as it is extremely closely related to N.furzeri a similar life span has been suggested (Polacik and Reichard, 2011).

About N.rubripinnis (Seegers, 1986) no reliable age information is available, but observations by PhD Michael Donner (Limnologisches Institut, University of Konstanz), suggest a life span of about 16 – 20 months.

Medaka and zebrafish are both long established models in different areas of research. The latter has a maximum life span of about 42 months, medaka of about 60 months (Egami, 1971; Patnaik et al., 1994).

PARP1 activity has been shown to correlate with age in mammals (Grube and Burkle, 1992), but information of PARP activity in fish is so far lacking, apart from sequence information from a couple of species, as for example medaka, zebrafish, pufferfishes, stickleback and platyfish in NCBI, and determination of enzyme activity in zebrafish (Master Thesis B. Gogol, 2010).

(25)

1.6 Objectives

In the mammalian ageing process, which is marked on a molecular level by changes in the cellular functions and metabolism as well as changes in the extracellular composition, PARP1 is determined as an important player. For example PARP1 exhibit influence on those criteria as it is involved in inflammation processes, the regulation of the genomic stability via regulation of DNA repair and chromatin composition, as well as transcriptional regulation.

Furthermore, it plays a role in telomeric maintenance, which is a crucial factor in senescence.

Studies have shown the direct correlation of PARP activity with mammalian longevity in PBMC.

The question addressed in this study is: Is this correlation a feature occurring only in highly developed vertebrates as mammals or is this a more general characteristic? To answer this question another vertebrate system – fish – is employed, which show numerous advantages compared to other model organisms: Fish possess continuously regenerating tissues outside of the germline, in contrast to insects or nematodes. In addition, different species are easily available, whereas in amphibians or nematodes (besides X.laevis and C.elegans, respectively), not many model organisms are available, and there is a wide range of life spans in fish from a few months (N.furzeri) to many years.

The question raised above is investigated on the basis of recombinant PARP1 from six different fish species. The use of recombinant proteins allows the exclusion of other cellular factors and the determination of the enzymatic activity by means of K_M and V_max. Subsequently, due to the close relationship of the Nothobranchius species, a further goal of the study was to take the first step toward tracking the differences in activity of PARP1 back to single or short stretches of amino acids by analysis of sequence variations.

(26)

2 Material

2.1 Organisms, Chemicals and Software

2.1.1 Organisms and Cell Lines

Description Company / Source

Escherichia coli K12 DH5α Leibniz-Institute DSMZ Sf9 (IPLB-Sf21-AE) insect cells, cell line Becton-Dickinson derived from larval ovarian tissue of the

fall armyworm (Spodoptera frugiperda)

Danio rerio, ♀ kind gift of A.-Y. Loos,

AG C. Stürmer, Universität Konstanz

Nothobranchius furzeri kind gift of M. Donner,

AG R. Eckmann, Universität Konstanz Nothobranchius korthausae kind gift of M. Donner

AG R. Eckmann, Universität Konstanz Nothobranchius orthonothus kind gift of M. Donner

AG R. Eckmann, Universität Konstanz, Nothobranchius rubripinnis kind gift of M. Donner,

AG R. Eckmann, Universität Konstanz Oryzias latipes, ♀ and ♂ kind gift of S. Pittlik,

AG A. Meyer, Universität Konstanz

2.1.2 Insect Cell Culture Medium

Description Company

Penicillin / Streptomycin Invitrogen

TNM-FH Insect Cell Medium Bio&Sell

(containing 10 % FCS)

Opti-MEM Life Technologies

(27)

2.1.3 Prokaryotic Cell Culture

Ampicillin Sigma-Aldrich

Bacto agar Becton-Dickinson

Bacto trypton Becton-Dickinson

Bacto yeast extract Becton-Dickinson

Sodium chloride AppliChem

2.1.4 Restriction Enzymes

ApaLI New England Biolabs

EcoRV New England Biolabs

XbaI New England Biolabs

XmaI New England Biolabs

2.1.5 Other Enzymes and Reaction Buffers

DNAseI AppliChem

dNTPs Bio&Sell

HotStart Taq-DNA-Polymerase (5 u/µl) Bio&Sell

10x HotStart Taq Buffer B1 Bio&Sell

Proteinase K Fermentas

Reverse Transcriptase SuperScriptIII LifeTechnologies 5x First Strand Reaction Buffer LifeTechnologies

RNase Inhibitor Invitrogen

RNase H New England Biolabs

10x RNase H Reaction Buffer New England Biolabs

Shrimp Alkaline Phosphatase (SAP) (1 u/µl) New England Biolabs

10x SAP Reaction Buffer New England Biolabs

T4 DNA Ligase (400 u/µl) New England Biolabs

10x T4 DNA Ligase Reaction Buffer New England Biolabs

(28)

2.1.6 Oligonucleotide

Description / Gene / Binding Site Sequence (5´→ 3´) Orientation

01 drPARP1-5 GTGAGTTGTAGGCCTGTCTGACTAGAATTAGTC forward

02 drPARP1-3 CTCTCCAGATCTAACCGGCGTCTCAC reverse

04 drPARP1-884s [P] CAGAGTACAGCGCTGC-[P] forward

05 drPARP1-643as GCGGATCTTCAGCAGG reverse

06 drPARP1-960as CAGTCTTTGCGATCAGGCGTC reverse

07 drPARP1-1824s CCTGGGGCGCTGAAGTTAAAGTCG forward

08 fishPARP1-2368s [P] GACATCAACTATGAGAAACTCAAAACC-[P] forward

09 fishPARP1-1727s [P] GTGGACATCGTCAGAGG-[P] forward

11 fishPARP1-2368as [P] TTGAGTTTCTCATAGTTGATGTC-[P] reverse

14 fishPARP1-151s [P] CACTGGCACCACTTCTCCTGC-[P] forward

15 d(T)-cloning [P] TTTTTTTTTTTTTTTTTTTTT-[P]

17 olPARP1-3` [P] CACATTGGTGCAGATAATGAAGCC-[P] reverse

20 olPARP1 2302as, seq GCAGACTGTAAGCCACTTCAATGTC reverse

21 No seq 3´ 2012 CAGTTTGGACTTGGTGCCAG reverse

24 N.furzeri PARP1 329as [P] GAGACTTATTGAAACGGCAC-[P] reverse 25 N.furzeri PARP1 1038s [P] CAAGTTCAAGCGACAGGACAG-[P] forward 30 drPARP1-3stu [P] CATGTGTTACAAGTAACCTGAATCCAGGTTTAGC-[P] reverse

32 olPARP1-182s [P] CAGGTTCAGCGTCCATTGGC-[P] forward

33 Adapterprimer, 3´-RACE GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT reverse

34 AUAPrimer, 3´-RACE GGCCACGCGTCGACTAGTAC reverse

36 N.spec PARP1 332as = A2 CTCCACGGCAAAGTTATTCAGAG reverse

38 N.spec 5´UTR A1 (as) CAGTTCCTCCCTGCGGCTCAC reverse

41 N.spec RT-P (as) GACCACGTTGGACTCTCCAGAG-[P] reverse

44 Nf PARP1 -10s [P] TAAGGAACAATGGCGGACTC forward

46 Nf PARP1 3093as [P] CAGGCATTTGGATGCAGAAG-[P] reverse

47 N.spec PARP1 3093as [P] CAGGCTTTTGGATGCAGAAG-[P] reverse

50 pSL1180-3´ CGCAACTGTTGGGAAGGGC reverse

51 pSL1180-5´ new GCTTCCGGCTCGTATGTTG forward

52 pBacPAK8 for ACCATCTCGCAAATAAATAAG forward

53 pBacPAK8 rev ACAACGCACAGAATCTAGCG reverse

54 olPARP1 626s, seq GTCCAGGCGACGAGTTG forward

55 pSL1180-5´ AGCTATGACCATGATTACG forward

EcoRI linker GGAATTCC

(29)

Oligonucleotides were purchased from Sigma-Aldrich (01-34, 55) or Microsynth (49-54). [P] indicates phosphorylation at the 3´-end of the oligonucleotide.

RACE: rapid amplification of cDNA ends; drPARP1: Danio rerio PARP1; olPARP1:

Oryzias latipes PARP1; No: Nothobranchius orthonotus.

2.1.7 Antibodies

Description Company / Source

Anti-PAR: 10H hybridoma cells from

10H mouse monoclonal antibody (ab) against M.Miwa and T.Sugimura,

poly(ADP-ribose) Tokyo

(Kawamitsu et al., 1984)

Anti-PARP:

C-II-10 mouse monoclonal ab against the C-II-10 hybridoma cells from N-terminal DNA binding domain of PARP1 G.G.Poirier, Québec,

Canada

Anti-PARP:

H250C rabbit monoclonal ab against Santa Cruz Biotechnology C-terminal region of PARP1

Polyclonal goat anti-mouse (GαM) IgG/HRP Sigma-Aldrich Polyclonal goat anti-rabbit (GαR) IgG/HRP Sigma-Aldrich

Polyclonal GαR IgG/Alexa488 Sigma-Aldrich

Polyclonal GαR IgG/Alexa546 Sigma-Aldrich

2.1.8 Molecular Size Markers

Precision Plus Protein^TM Prestained BioRad Standard

GeneRuler 1 kb DNA Ladder, LifeTechnologies

ready-to-use

2.1.9 Chemicals

β-mercaptoethanol Sigma-Aldrich

2-Propanol Sigma-Aldrich

3-Aminobenzamide Sigma-Aldrich

4´,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich

(30)

Acetic acid Merck KGaA

Acrylamide 4K (40%) AppliChem

Agarose Low MP Sea Plaque Bio&Sell

Agarose, Universal Bio&Sell

Ammonium persulfate (APS) AppliChem

Ammonium sulfate Roth

Bromophenol blue sodium salt AppliChem

Calcium chloride Fluka

Calf thymus double-stranded DNA cellulose Sigma-Aldrich Chloroform : Isoamyl alcohol (24 : 1) Sigma-Aldrich

Coomassie Brilliant Blue G-250 Roth

Diethylpyrocarbonate (DEPC) Sigma-Aldrich

Dithiothreitol (DTT) AppliChem

Dimethyl sulfoxide (DMSO) Sigma-Aldrich

Ethanol 99.8 % Fluka

Ethidium bromide (10 mg/ml) Sigma-Aldrich

Ethylenediamine-tetraacetic acid (EDTA) AppliChem

Formaldehyde 37 % Riedel-de Häen

Formamide Fluka

Glucose Sigma-Aldrich

Glycerol 100 % AppliChem

Glycine AppliChem

Guanidine thiocyanate Roth

Hydrochloric acid (HCl) 37 % Merck

Magnesium chloride (MgCl2) Fluka

Magnesium sulfate (Mg2SO4) Merck

Methanol Fluka

MilliQ water Millipore

Manganese chloride (Mn2Cl) Sigma-Aldrich

Nicotinamide adenine dinucleotide (NAD⁺) Biochemika

N-lauroylsarcosine Sigma-Aldrich

NonidetP-40 (NP40) AppliChem

Phenol Sigma-Aldrich

Phenol red Sigma-Aldrich

(31)

Description Company Phenyl-methyl-sulfonyl-fluoride (PMSF) Fluka

Pipes Sigma-Aldrich

Potassium chloride (KCl) Sigma-Aldrich

Potassium dihydrogen phosphate (KH2PO4) Sigma-Aldrich

Potassium hydroxide (KOH) Fluka

Protamine sulfate Sigma-Aldrich

Rapilait (skim milk) BioRad

Sephadex G100-50 superfine Sigma-Aldrich

Sodium acetate Merck

Sodium chloride (NaCl) AppliChem

Sodium citrate Sigma-Aldrich

Sodium dihydrogen phosphate Merck

Sodium dodecyl sulfate (SDS) Sigma-Aldrich

Sodium hydroxide pellets (NaOH) Merck

TEMED AppliChem

Trichloroacetic acid Fluka

Tris-HCl AppliChem

Triton X100 Sigma-Aldrich

Tween20 Fluka

Urea AppliChem

2.1.10 Kits

BacPAK^TM Baculovirus Expression System Takara Clontech BD BaculoGold^TM Transfection Kit BD Biosciences

MinElute Gel Extraction Kit Qiagen

5´ RACE System for Rapid Amplification of LifeTechnologies / Invitrogen cDNA ends

Qiagen Plasmid Midi Kit Qiagen

ZR Plasmid Miniprep^TM Classic Zymo Research

(32)

2.1.11 Software

EndNote X7 Thomson ISI Research Soft

GeneiousPro8 Biomatters

GraphPad Prism 6 GraphPad Software Inc.

ImageJ Wayne Rasband, Open

Source

ImageLab BioRad

2.2 Media, Buffers and Solutions

2.2.1 DNA Agarose Gel Electrophoresis

Description Composition

50x TAE (Tris-Acetate-EDTA) 2 M Tris-HCl, pH 8.0 1 M acetic acid 50 mM EDTA

Ethidium bromide solution 1x TAE

1 µg / ml ethidium bromide

2.2.2 Buffers and Solutions

H2ODEPC 0.1 % DEPC in MQ water

o/n 37°C, autoclaved

PBS (phosphate-buffered saline) (pH 7.4) 137 mM NaCl 10 mM NaHPO4

3 mM KH2PO4

pH 7.4, autoclaved

PBS – MgCl2 PBS

1 mM MgCl2

(33)

5x TBE (pH 8.3) 500 mM Tris 500 mM boric acid

TBS (pH 8.0) 10 mM Tris

150 mM NaCl

TNT (Tris-NaCl-Tween20) 150 mM NaCl

10 mM Tris-HCl pH 8.0 0.05 % (v/v) Tween 20

2.2.3 Immunofluorescence

Fixing solution TBS

3.7 % (v/v) formaldehyde

Glycine solution TBS

100 mM glycine

Permeabilization solution TBS

0.4 % (v/v) Triton X-100

Blocking solution (TTB) TBS

1 % (w/v) BSA 0.3 % (v/v) Tween 20

2.2.4 Insect Cell Culture Media

TNM-FH⁺ TNM-FH

1 % Penicillin/Streptomycin

(34)

2.2.5 E.coli Cell Culture Media

LB (Luria-Bertani-Broth) 0.5 % (w/v) bacto yeast

extract 1 % (w/v) bacto trypton

1 % (w/v) NaCl autoclaved

LB agar LB

1.5 % (w/v) bacto agar autoclaved

SOC 2 % (w/v) bacto trypton

0.5 % (w/v) bacto yeast

extract .

10 mM NaCl 2.5 mM KCl 10 mM MgCl2

10 mM MgSO4

20 mM glucose autoclaved

TB buffer 10 mM Pipes

15 mM CaCl2 250 mM KCl 55 mM MnCl2 sterile filtrated

2x YT-medium 1.6 % (w/v) bacto trypton

1 % (w/v) bacto yeast extract 85.5 mM NaCl

autoclaved

2.2.6 PARP Activity Assay

2x PARP Reaction Buffer 20 mM MgCl2

200 mM Tris-HCl pH 7.8

pH 6.7 adjusted with KOH

(35)

2.2.7 Purification of Recombinant Protein

Sf9 PARP1 Lysis Buffer = Buffer I 25 mM Tris-HCl pH 8.0 10 mM EDTA pH 8.0 sterile filtered

added directly before use PMSF to 1 mM β-MeEtOH to 1 mM

PARP1 Purification Buffer A = Buffer II 100 mM Tris-HCl pH 7.4 0.5 mM EDTA

10 % (v/v) glycerol sterile filtered

added directly before use PMSF to 1 mM β-MeEtOH to 2 mM

PARP1 Purification Buffer B = Buffer III 50 mM Tris-HCl pH 8.0 200 mM KCl

1 mM EDTA sterile filtered

added directly before use β-MeEtOH to 10 mM DTT to 1 mM

PARP1 Purification Buffer C = Buffer IV 50 mM Tris-HCl pH 8.0 0.5 mM EDTA

5 mM MgCl2 5 % (v/v) glycerol sterile filtered

added directly before use β-MeEtOH to 12 mM PMSF to 1 mM

PARP1 Dialysis Buffer PBS

20 % (v/v) glycerol

(36)

2.2.8 RNA Isolation

Sol D 25 mM sodium citrate pH 7.0

, 4 M guanidine thiocyanate

0.5 % N-lauroylsarcosine added directly before use β-MeEtOH to 100 mM

2.2.9 SDS-PAGE

Separation Gel Buffer 3 M Tris-HCl pH 8.9

Stacking Gel Buffer 500 mM Tris-HCl pH 6.7

10x Running Buffer 250 mM Tris-HCl

1.92 M glycine 1 % (w/v) SDS

1.5x urea protein loading buffer 93.75 mM Tris-HCl pH 6.8 9 M urea

7.5 % (v/v) β-MeEtOH 15 % (v/v) glycerol 3 % (w/v) SDS

0.01 % (w/v) bromophenol

blue

2.2.10 Western Blot

Description Composition / Company

1x Blotting Buffer = Towbin Buffer 50 mM Tris-HCl pH 8.6 384 mM glycine

20 % (v/v) methanol 0.1 % (w/v) SDS

(37)

Blocking Solution TNT

5 % (w/v) skim milk powder

SuperSignal West Femto Maximum Thermo Scientific Sensitivity Substrate

Amersham ECL Select Western Blotting GE Healthcare Detection Reagent

(38)

3 Methods

3.1 Cell culture – Cultivation of Sf9 Insect Cells

The Sf9 cell line was derived from pupal ovarian tissue of the fall armyworm Spodoptera frugiperda. These cells are susceptive to infection with the Autographa california nuclear polyhedrosis virus (AcNPV baculovirus).

Therefore, they are commonly used to isolate and proliferate baculoviral stocks and to produce recombinant proteins. The Sf9 cell line can be cultured as an adherent monolayer as well as in suspension at 25 to 28°C.

All Sf9 cell work was carried out under the laminar flow. All used material was autoclaved or disinfected with 80 % (v/v) ethanol. Gloves and lab coat were worn at all times.

The adherent cells were cultured in TNM-FH⁺ medium and incubated in an incubator at 26°C. For splitting the cells were washed once with prewarmed medium and scraped off with a plastic cell scraper. Then the cells were diluted as desired and resuspended in fresh medium and afterwards seeded on a new Petri dish or flask.

3.2 Molecular Biological Methods

3.2.1 Total RNA Isolation

The isolation of total RNA was performed using acid guanidinium thiocyanate- phenol-chloroform extraction following the protocol of Chomczynski (Chomczynski and Sacchi, 1987).

During the process of RNA isolation from cells and tissues it is important to inactivate any RNAses. Therefore, all buffers were prepared with H₂O_DEPC and all materials consisting of glass or metal were baked for at least 8 h at 180°C.

For D.rerio RNA isolation 1 - 2 fishes were euthanized, the ovaries were removed as fast as possible on ice and transferred to a reaction tube with 500 µl ice cooled Sol D.

(39)

RNA from N.furzeri was isolated from whole fish. Therefore, the beheaded fishes were scaled off and finally pulverized in liquid nitrogen. Then the powder was transferred to a reaction tube containing 500 µl ice cold Sol D.

Alternatively, RNA of the Nothobranchius species and medaka were isolated from ovaries and tissues.

The following procedure was identical for all starting materials. All centrifugation steps were carried out at 4°C in a table-top centrifuge at maximum speed for 15 min, all working steps were performed on ice and all buffers and solutions were pre-chilled. Variations are mentioned.

The material in Sol D was carefully resuspended via needles with decreasing diameters. Following, 50 µl 2 M sodium acetate (pH 4), 500 µl phenol and 100 µl chloroform : isoamyl alcohol (24 : 1) were successive added and tilted over.

The reaction tube was stored for 15 min on ice and afterwards centrifuged for 20 min at 17300 xg at 4°C. The supernatant was carefully transferred to a new reaction tube and 500 µl ice cold isopropanol was added. Subsequently, the tube was stored for 1 h at -20°C and then centrifuged. The supernatant was removed and the pellet was resuspended in 200 µl Sol D. Following 400 µl isopropanol was added. The solution was stored for at least 1 h at -20°C and then centrifuged. After removing the supernatant the pellet was resuspended in 400 µl 70 % (v/v) ethanol and incubated for 15 min at room temperature in order to wash the RNA. After a final centrifugation the pellet was dried carefully with nitrogen and resuspended in 50 – 200 µl H₂O_DEPC.

3.2.2 Reverse Transcription

This technique was used to reverse-transcribe RNA in cDNA using SuperScriptIII Reverse Transcriptase. The newly synthesized cDNA can then be used as template for specific DNA amplification via PCR.

The reverse transcription was performed according the manufacturers´ protocol in 20 µl reaction mix. In a first step specific primers (2 pmol) or oligo(dT) (500 ng), 1 µl total RNA, 1 µl 10 mM dNTPs were mixed and added to 13 µl with

(40)

H₂O. After 5 min at 65°C and 1 min on ice 4 µl 5x First-Strand Buffer, 1 µl 0.1 M DTT, 1 µl RNase – Inhibitor and 1 µl SuperScriptIII (200 u / µl) were added.

Subsequently, the mixture was incubated for 60 min at 40 – 50°C and then heat-inactivated for 15 min at 70°C.

3.2.3 Polymerase Chain Reaction (PCR)

PCR was used for amplification of specific cDNA produced by reverse transcription as well as for colony screening of transformed E.coli K12 DH5α.

The volume of the PCR was 10 µl or 50 µl depending on the purpose of the PCR: 10 µl PCRs were performed for colony screening and for testing varying parameters (e.g. annealing temperature, new primers, etc.). 50 µl PCRs were used to achieve higher amounts of PCR product as needed for sequencing or further processing.

For 10 µl or 50 µl PCR following components were applied:

Component Taq HS KOD HS

10x Buffer (B1 / KOD HS) 1.0 µl 5.0 µl 1.0 µl 5.0 µl

25 mM MgCl2 1.0 µl 5.0 µl - -

25 mM MgSO4 - - 0.6 µl 3.0 µl

2 mM dNTPs 1.0 µl 5.0 µl 1.0 µl 5.0 µl

10 µM forward Primer 0.7 µl 3.5 µl 0.3 µl 3.0 µl

10 µM reverse Primer 0.7 µl 3.5 µl 0.3 µl 3.0 µl

Template

(bacterial material / product of RT, dC-tailed cDNA)

Bacteria from agar plate /

0.5 µl 1.0 - 5.0 µl 0.5 - 1 µl 1.5 µl Polymerase (Taq, 5 u / µl /

KOD HS, 1 u / µl) 0.1 µl 0.5 µl 0.2 µl 1.0 µl

H2O ad 10.0 µl ad 50.0 µl ad 10.0 µl ad 50.0 µl

Table 3-1 Composition of Taq HS-PCR and KOD HS-PCR

The Role of DNA Repair in the Evolution of Vertebrate Longevity