Working with DNA

______________________________________________________________________Material and Methods

59

______________________________________________________________________Material and Methods

60 3.4.5 Agarose gel electrophoresis of DNA

Agarose gel electrophoresis of DNA molecules (plasmid DNA and PCR products) was carried out to determine their size and amount. Agarose gels with 1 % to 1.5 % (w/v) agarose in TAE buffer (40 mM Tris-acetate, 1 mM EDTA pH 8) and 0.5 µg/mL ethidium bromide were prepared depending on the size of the analyzed DNA fragments. Before the DNA samples were applied into the sample wells of the gels, they were mixed with loading dye (6x stock: 0.2 % bromphenol blue, 0.2 % xylene cyanol FF, 60 % (v/v) glycerol, 60 mM EDTA pH 8). 5 µl of 2-Log DNA ladder (New England Biolabs) were also applied on each gel. Electrophoresis was performed at 80-120 V at RT in TAE buffer. The DNA was visualized by UV irradiation at 254 nm (BioDocd-IT system, UVP).

3.4.6 Purification of DNA fragments 3.4.6.1 Gel extraction of agarose gels

For the extraction and purification of DNA fragments from agarose gels, DNA fragments were sliced out of the gel. Afterwards, the QIAquick gel extraction kit (QIAGEN) was used according to the instructions of the manufacturer. After dissolving the DNA from the gel matrix by incubation for 10 min at 50°C, the DNA bound to a silica gel column was washed several times and eluted in 25-50 µl ddH₂O.

3.4.6.2 Purification of PCR fragments

For purification of PCR fragment from the PCR assay, the QIAquick PCR purification kit (QIAGEN) was used according to the instructions of the manufacturer. The DNA bound to a silica gel column was eluted in 25-50 µl ddH2O.

3.4.7 Polymerase chain reactions (PCR)

The PCR technique was utilized for the exponential amplification of DNA ^{124, 125}. Appropriate PCR primers for standard PCR were designed using the PCR primer design tool from MWG Operon (www.eurofinsdna.com). For manually designed primers the melting temperature was calculated using the following formula ¹²⁶:

T_m= 64.9 + 41 x (nG+nC-16.4)/(nA+nT+nG+nC)

______________________________________________________________________Material and Methods

61 3.4.7.1 Amplification of genomic DNA and plasmid DNA

The PCR amplifications were performed using 50-100 ng of template DNA (genomic or plasmid DNA), 1 µM of each primer (forward and reverse), 200 µM dNTPs and 1 µl dimethyl sulfoxide (DMSO) in a 50 µl reaction volume. The reaction buffer of the Phusion polymerase (Finnzymes) supplied by the manufacturer was used. 1 U of the phusion polymerase was added directy to the sample prior to the PCR reaction that was carried out in a thermal cycler (BioRad). Standard cycling conditions are shown in table 3.10 and optimal cycling conditions were determined empirically for each DNA fragment.

Table 3.10: Standard PCR assay using Phusion polymerase

Step 1 Step 2-31 Step 32

Denaturing 98°C, 5 min 98°C, 30 sec

Annealing T_m+3°C, 30 sec

Elongation 72°C, 15-13 sec/kb 72°C, 10 min

3.4.7.2 PCR mutagenesis

Designed primer sets were used to introduce desired restriction sites at the 5' ends of DNA fragments. The restriction site overhang was considered in the calculation of the melting temperature of the primers.

3.4.7.3 Site-directed mutagenesis of plasmid DNA (Quik Change PCR)

Site directed mutagenesis was used to introduce mutations into plasmid DNA. Mutagenic primers were designed using the QuikChange Primer Design Program from Stratagene (www.stratagene.com) that contain the desired mutation, flanked by non-mutated sequences. 2 PCR reactions are carried out that contain 50 ng of the plasmid, 0.2 µM dNTP mix, 2 U of Phusion polymerase and 1 x of the corresponding polymerase buffer. Each reaction contains one of the mutagenic primers in a 0.8 µM concentration. After denaturation at 98°C for 1 min, 10 cycles followed of 98°C for 1 min; 1 min of the respective annealing temperature and 72°C for 3.5 min. Both samples were pooled and subjected to 18 cycles using the same conditions. The methylated template DNA was

______________________________________________________________________Material and Methods

62 digested with 20 U of the methylation specific restriction endonuclease DpnI for 8 h at 37

°C. Afterwards, 2.5 µl, of the non-methylated intact PCR product was directly transformed into chemically competent E. coli DH5α cells.

3.4.8 Enzymatic modification of DNA 3.4.8.1 Restriction of DNA

Plasmid DNA and PCR products were designed using the respective restriction endonucleases (New England Biolabs) in appropriate buffers following the instructions of the manufacturer. The reaction mixture usually contained 5-20 U enzyme/µg DNA and were incubated at 37°C for 2 h.

3.4.8.2 5'-dephosphorylation of linearized vector-DNA

In order to avoid re-ligation of the digested plasmid DNA during the ligation reaction, Antarctic Phosphatase (New England Biolabs) treatment was used to remove the 5'-end phosphoryl groups. 1 U/ng DNA of Antarctic Phosphatase was added to the restriction mixture which was then further incubated at 37°C for 30 min. Afterwards, the phosphatase was inactivated by incubating of the sample for 5 min at 65°C.

3.4.8.3 Ligation

Ligation of restricted DNA fragments into vector DNA was performed using T4 DNA ligase ¹²⁷. 50 ng of digested, dephosphorylated plasmid DNA and ~150 ng of digested insert DNA (ration 1:3) were mixed. 200 cohesive end units of the T4 DNA ligase and 1 x supplied reaction buffer were added in a reaction volume of 20 µl and incubated overnight at 16°C. After inactivation of the T4 DNA ligase for 10 min at 70°C, the recombinant vector molecules were used for transformation.

For the generation of recombinant pec-A-HI-SUMO vectors, the respective inserts and linearized vector were processed with T4 DNA Polymerase LIC qualified (Novagen) according to the protocol of Prof. Dr. Elena Conti (MPI Munich) and subsequently ligated with a 2:1 insert:vector ratio.

______________________________________________________________________Material and Methods

63 3.4.8.4 Annealing of DNA oligonucleotides

1 or more sets of DNA oligonucleotides in forward and reverse direction were designed to contain the desired DNA sequence, flanked by terminal restriction sites that form sticky ends after annealing. 1 nmol of each oligonucleotide was 5'-phosphorylated in separate reactions that contained 50 U of T4-polynucleotide kinase (PNK), 1 x of the corresponding reaction buffer, and 10 mM ATP in 20 µl reaction volume. After incubation for 1 h at 37°C, 1 µl of the phophorylated forward primer was mixed with 1 µl of the corresponding phosphorylated reverse primer together with 1 U of T4 DNA ligase and 1 x of the respective reaction buffer in a 10 µl reaction volume. The samples were incubated for 5 min at 95°C on a heating block and then gradually cooled down over 2-3 h to RT. 4 µl of the hybridization mix was then ligated into appropriate vectors as described in 3.5.8.3 or directly used for in vitro run-off transcription (3.5.3).

3.4.9 Transformation

3.4.9.1 Preparation of chemical competent E. coli cells

Competent cells of all used E. coli strains were treated with CaCl₂ and RbCl (rubidium chloride). Therefore, 0.25 mL of an E. coli overnight culture was used for inoculation of 25 mL LB medium. Cells were incubated at 37°C and 200 rpm up to an OD₆₀₀ of 0.3-0.5.

Then, the culture was centrifuged at 2,300 x g for 10 min at 4°C and after discarding the supernatant, the cell pellet was gently resuspended in 10 mL of ice-cold solution A (10 mM MOPS, 50 mM RbCl, 50 mM CaCl2) and subsequently pelleted again. The cell pellet was gently resuspended in 10 mL of ice-cold solution B (100 mM MOPS, 50 mM CaCl2, 10 mM RbCl, pH 6.5) and incubated for 30 min on ice. The solution was centrifuged at 700 x g for 15 min at 4°C and the competent cells were carefully resuspended in 2 mL of ice cold solution B and 40 % glycerol and stored at -80°C for several months.

3.4.9.2 Transformation of competent E. coli cells

Plasmid DNA was gently mixed with 200-300 µl of competent E. coli cells (3.5.9.1). After incubation on ice for 1 h, the cells were subjected to a heat shock at 42°C for 45 sec and subsequently placed on ice. 1 mL of LB medium was added to the sample which was then incubated at 38°C for 1 h at 200 rpm. 100 µl of the freshly transformed cells were plated on LB agar plates that contained the respective antibiotics. The remaining cells were

______________________________________________________________________Material and Methods

64 pelleted and carefully resuspended in 100 µl of LB medium prior to plating. The LB agar plates were incubated at 37°C overnight and colonies were screened for positive clones that contained the recombinant plasmid.

3.4.10 Sequencing

Automated sequencing of DNA ¹²⁸ was performed by Eurofins MWG GmbH (Ebersberg).

Primer sets that were used in addition to the standard sequencing primers from MWG operon for sequencing of cas genes as well as codon-optimized cas genes from C.

Thermocellum over 1.5 kb are listed in table 3.11.

Table 3.11: Additional primers used for sequencing

Primer Sequence 5'-3‘ Primer binding site

Cas3_seq_rev TCTGTCAAGCCTCTCCTTC Position 1653-1671 in Cas3 ORF

Cas8b_seq_fwd ATCCTGTCTGTTCTTGTTGC Position 694-713 in Cas8b ORF

Cas3_co_seq_fwd ATTCGCATGGCGGAATGG Position 760-778 in codon-optimized Cas3 ORF Cas8b_co_seq_rev CGAAATTGCCTTCGGTTTTATTGT

Position 1192-1216 in codon-optimezed Cas8b ORF

3.4.11 5'- terminal radioactive labeling of DNA

Single-stranded DNA oligonucleotides, synthesized by MWG Operon were used for radioactive labeling. 5 pmol of the respective template was mixed with 5 pmol of γ[³² P]-ATP (Hartmann Analytic), 10 U of T4 PNK and 1 x of the corresponding reaction buffer were mixed in a reaction volume of 10 µl and incubated for 1 h at 37°C.

______________________________________________________________________Material and Methods

65 3.4.12 Denaturing polyacrylamide gel electrophoresis of radiolabeled DNA Denaturing 8 M urea, 12 % polyacrylamide TBE gels (mixed in a 40 mL volume with the addition of 0.1 % (v/v) APS and 0.01 / (v/v) TEMED. Gels were placed into a gel chamber (PROTEAN II Electrophoresis Chamber, BioRad). Prior to loading onto the gel, the reactions were mixed with 1 volume of formamide loading buffer (100 % formamide, 0.01

% bromphenol blue, 0.01 % xylene cyanol FF) and incubated at 95°C for 5 min. The separation was carried out for 1-2 h at 12 W, depending on the size oft the DNA fragments.

3.4.13 Detection of radiolabeled DNA by phosphorimaging

Gels were put into plastic bags and subsequently exposed to phosphor screens overnight at -20°C. The Storm 840 phosphorimager was used to visualize the bands on the phosphor screens.

3.4.14 Extraction of radiolabeled DNA from urea-polyacrylamide gels

After determining the location of the desired DNA fragments by phosphorimaging, the respective bands were cut out from the gel and dissolved in 500 µl of gel elution buffer (20 mM Tris/HCl pH 7.5, 250 mM sodium acetate, 1 mM EDTA, 0.25 % SDS) using a fresh reaction tube. The samples were incubated for 30 min at -20°C and then placed on ice on a shaker overnight. After pelleting the gel pieces (1 min, 13,000 rpm, RT), the supernatant was transferred into a fresh reaction tube. After EtOH precipitation, the activity of radiolabeled nucleid acid was measured in a scintillation counter (Beckmann LS 6500).