In vivo verification of the error tolerance by error-prone PCR

To test the error tolerance capability of the SED3B encoding scheme in practical, we en-coded text of “Hello, World!” into 78bp DNA string. A 168bp DNA fragment includ-ing the 78bp DNA strinclud-ing encodinclud-ing "Hello, World!" was constructed usinclud-ing two primers of 5’- TCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCAC-GAGGCCCTTTCGTCTTTAAGGATGCTCGTGCCCATGCCCATGCCGTAC -3’ and 5’- GGCTCGAGCTCGAGACTAGCACCTGGTTTAGCATGGGCAAGTAAAACGGCACAAA-AATATGGTTGGGGTACGGCATGGGCATGGGCACGAGCATCCTTAA -3’. We then used

22 Materials and methods

Fig. 2.1 Detailed steps of decoding error-containing DNA strings into error free bit string.

The black, green and red characters stand for the data encoding bases, error correction bases and error containing bases respectively. The encoding scheme does permit detection of insert and deletion errors by detection of continuous errors of encoding blocks. Although the decoding algorithm implemented here didn’t involve a frameshift correction process which can increase the accuracy of recovered information in principle, correct information still can be recovered as proved by error-prone PCR experiments.

2.3 Methods for orthogonal information encoding in living cells 23

Fig. 2.2 The logo of our institute used as input for error tolerance simulation

error-prone PCR to introduce random errors into the 168bp DNA fragments. Error-prone PCR was performed using JBS dNTP-Mutagenesis Kit using the recommended protocol with 30 thermal cycles to introduce errors into the encoded DNA string. The amplified fragments by error-prone PCR were ligated with linearized pZE21-MCS plasmid using In-Fusion®

HD Cloning Kit from Clontech© Laboratories. The ligation products were transformed into stellarE. colistellar competent Cells. The plasmid map and encoded information are presented in Figure 2.3.

Fig. 2.3 Illustration of construction process of plasmids carrying the encoded 78bp DNA string with variant errors introduced by error-prone PCR

The plasmid abstractions of individual colonies were deposited for sequencing. Original information was recovered using the error rich DNA fragments. Primers used for error-prone amplification of the 168bp insert DNA fragment are

5’-TCTAAGAAACCATTATTATCAT-24 Materials and methods 3’ and 5’-GGCTCGAGCTCGAGACTAGCA-3’. The primers used for linearization of the plasmid are TAATGGTTTCTTAGACGTCGGAATTGCCAGCTGGG -3’ and 5’-TCTCGAGCTCGAGCCAGGCATCAAATAAAACGA AAGG-3’. The primer used for sequencing is 5’-GCGAAACGATCCTCATCCTGTCT-3’.

Chapter 3

Genome-scale comparative studies of mutans streptococci

3.1 Introduction

Traditionally and supported by 16S rRNA gene andrnpBgene sequence analyses, the genus Streptococcusis divided into several groups, with the mutans group streptococci consisting of the species S. mutans, S. sobrinus , S. ratti , S. criceti, S. downei, S. macacae, and – but controversially discussed –S. ferus[56]ⁱ. Mutans group streptococci are considered as significant contributors to the development of dental caries [1]. By attaching to the tooth surfaces and forming biofilms, they can tolerate and adapt to the harsh and rapidly changing physiological conditions of the oral cavity such as extreme acidity, fluctuation of nutrients, reactive oxygen species, and other environmental stresses [57]. They occasionally also cause bacteremia, abscesses, and infective endocarditis [58, 59]. Many strains of mutans streptococci are genetically competent, i.e. they can take up DNA fragments from the environment and recombine them into their chromosome, an important mechanism for horizontal gene transfer (HGT). The ability of some bacteria to generate diversity through HGT provides a selective advantage to these microbes in their adaptation to host eco-niches and evasion of immune responses [60, 61]. Due to diversities in the genetic contents between

This chapter was modified based on two previous publications:

Song, Lifu; Sudhakar, Padhmanand; Wang, Wei; Conrads, Georg; Brock, Anke; Sun, Jibinet al.(2012): A genome-wide study of two-component signal transduction systems in eight newly sequenced mutans streptococci strains.BMC genomics13, S. 128.; Song, Lifu; Wang, Wei; Conrads, Georg; Rheinberg, Anke; Sztajer, Helena;

Reck, Michael et al. (2013): Genetic variability of mutans streptococci revealed by wide whole-genome sequencing. BMC genomics14, S. 430. Some of the texts, figures, and tables may be directly used without further indication.

iFor updates please refer to http://www.bacterio.net/s/streptococcus.html

26 Genome-scale comparative studies of mutans streptococci different isolates, the genome content of a single isolate doesnot necessarily represent the genomic potential of a certain species. With the rapid development of DNA sequencing technologies, the steadily increasing genome data enable us to dig the evolutionary and genetic information of a species from a pan-genome perspective. In 2002, the release of the genome sequence of S.mutans UA159, the first genome sequence of mutans group streptococci, has greatly helped in understanding the robustness and complexity ofS. mutans as an oral and odontogenic (e.g. infective endocarditis and abscesses) pathogen [28]. Later, after the genome sequence ofS. mutansNN2025 became available, a comparative genomic analysis ofS. mutansNN2025 and UA159 has provided insights into chromosomal shuffling and species-specific contents [29]. Recently, Cornejoet al.have studied the evolutionary and population genomics ofS. mutansbased on 57S. mutansdraft genomes and revealed a high HGT rate ofS. mutans[62].

In this study, the whole genome of eight mutans streptococci strains, including six S.

mutansstrains (5DC8, KK21, KK23, AC4446, ATCC25175 and NCTC11060), oneS. ratti strain (DSM20564) and oneS. sobrinusstrain (DSM20742) were sequenced. A pan-genomic model of mutans streptococci was constructed and analyzed. Cross-comparison of the genome contents of the eight mutans streptococci strains and the previously genome sequenced strains ofS. mutansUA159 and NN2025 were carried out focusing on the genomic components that are highly related to pathogenicity. Further, by constructing and comparative analysis of genome-level metabolic networks, the diversities in sub-pathways among these strains were systematically investigated. The results are helpful for understanding the evolution and pathogenicity of these oral pathogens, which in turn will be helpful for the clinical management of diseases caused by these pathogens and for the development of diagnostics and new molecular epidemiological methods.

3.2 Genome sequencing, assembly and annotation of eight