4. Material and methods
4.1. Materials and source of supplies
4.1.2. Vectors
Material and methods
68
pGPD_rev GTTTCTCGAGTTGGGCGTAA
Cloning/colony PCR
nosT-NotI ATAAGAATGCGGCCGCTAGATCGTTCAAACATTTGGC
Cloning/colony PCR
nosT-SacI CGAGCTCGGTTTGACAGCTTATCATCG
Cloning/colony PCR
pTEFfusion_f TCGAGCTCGGTACCCAGACCCCATAGAAGCGCGCC
Cloning/colony PCR
pTEFfusion_r GCCCTTGCTCACCATTTTTTAGTATGAAAAAGATG
Cloning/colony PCR
GFPfusion_f TTTTCATACTAAAAAATGGTGAGCAAGGGCGAGGA
Cloning/colony PCR
GFPfusion_r TCGGTTCGTATTCGTTTACTTGTACAGCTCGTCCA
Cloning/colony PCR
tTEFfusion_f GAGCTGTACAAGTAAACGAATACGAACCGAGACGC
Cloning/colony PCR
tTEFfusion_r CTCTAGAGGATCCCCACAATCTCCTTGTCTGGCTC
Cloning/colony PCR
TAM7534_SpeI_F GCCACTAGTAAAGAAAAGGCGCTCGAAG
RNAi construction
TAM7534_SpeI_R GCCACTAGTCTCAGCCCCTCGTCTACATC
RNAi construction 10496OVER_BAMHI _F GCGGATCCATGTCCTCCACGCCAATGGT
Overexpression in U. maydis 10496OVER_Not_R GCGCGGCCGCTTACTCGTCCGTGACCTTGA
Overexpression in U. maydis 3173OVER_bamHI_F GCGGATCCATGCAGATCGCCTTCTTCAG
Overexpression in U. maydis 3173OVER_ Not I_R GCGCGGCCGCTTATTTGGAAGACTTGACAA
Overexpression in U. maydis
69
4.1.2.1. Vectors for TA cloning of PCR products pGEMT-Easy (Promega, Mannheim)
- Vector used for cloning of PCR products. Vector is commercially prepared by cutting with EcoRV and adding a 3´ terminal thymidine to both ends. Inserted DNA segments can be cut out with EcoRV. The plasmid can be used for the blue-white selection. The sequencing of the insert is possible using T7 and SP6 primers, located on both side near to the EcoRV restriction site. Vector possesses ampicillin resistance cassette as selection marker for E. coli.
pCRII-TOPO (Invitrogen, Karlsruhe) - Vector used for cloning of PCR products. Topoisomerase activity and overhanging thymidine residues increased cloning efficiency. Inserted DNA segments can be cut out with EcoRI. The Plasmid can be used for the blue-white selection. The verification of the inserts is possible by sequencing using M13 and M13Rev primers.
Vector possesses ampicillin and kanamycin resistance cassettes as selection markers for E. coli.
4.1.2.2. P. indica transformation vectors Starting vectors:
pBShhn-pTEF – vector based on plasmid pBS-hhn (Kämper et al., 2004)
contains the hygromycin
phosphotransferase gene (Hpt) fused to the nos terminator. Hsp70 promoter is exchanged with 1650 bp of P. indica TEF promoter. Vector possesses ampicillin resistance cassette as selection marker for E. coli. (Zuccaro et al., 2009)
pvv26 - binary vector (kindly provided by Jörg Kämper, Karlsruhe, unpublished) constructed on the
backbone of the pPK2-Hyg (Covert et al., 2001) using the restriction sites NcoI/SacI in a three fragment ligation.
This vector contains the right and left border of the T-DNA for use in Agrobacterium-mediated
transformation, and Hpt gene under control of the piTEF promoter. Vector possesses kanamycin resistance cassette as selection marker for E. coli. (Zuccaro et al., 2009)
pBGgHg - vector contains two gene sequences: eGFP and Hpt which are
Material and methods
70 controlled by A. bisporus GPD promoter and transcriptional terminator of the cauliflower mosaic virus 35S gene. Both cassettes are located between the left and right border regions of T-DNA from A. tumefaciens Ti plasmid. Vector contains kanamycin resistance cassette (Chen et al., 2000).
pAN7-1 – vector contains Hpt gene controlled by the A. nidulans gpdA and trpC expression signals (Punt et al., 1987). Plasmid possesses ampicillin resistance cassette as selection marker for E. coli.
pGY1-GFP – plasmid based on plant expression vector pGY1 (Schweizer et al., 1999) that contains a 540-bp fragment of the CaMV 35S promoter and the CaMV 35S terminator separated by a multiple cloning site and cloned GFP gene sequence via BamHI restriction site. Vector possesses
ampicillin resistance cassette as selection marker for E. coli.
pSilent-Dual1 – vector for RNAi silencing in M. oryzae (Nguyen et al., 2008) contains two convergent opposing RNA polymerase II promoters: PtrpC and Pgpd from A.
nidulans. Plasmid possesses ampicillin resistance cassette as selection marker for E. coli and geneticin resistance cassette for selection in M. oryzae.
pPiRNAi - vector for RNAi silencing.
P. indica GPD and TEF promoters were used for construction of convergent dual promoter system and cloned in a vector harbouring the hygromycin B resistance gene cassette and separated with multicloning site. Vector possesses ampicillin resistance cassette as selection marker for E. coli. Plasmid was constructed by Yi Ding, MPI Marburg, Germany.
Vectors constructed during this study:
pTGTh - The sequences of GFP gene and CaMV terminator were cut from the plasmid pGY1-GFP using SpeI and SacI (Fermentas) and subsequently cloned into pGEMTeasy with previously inserted P. indica TEF promoter. The whole pTEF::GFP-tCaMV cassette was
integrated into the pBShhn-pTEF vector previously linearized with KpnI. Vector contains ampicillin resistance cassette as selection marker for E. coli.
71 pMZGFP - Vector was constructed using a PCR fusion strategy with overlapping primers for P. indica TEF promoter, the eGFP sequence from plasmid p123 (uGFP) and P. indica TEF terminator. The PCR fragment was inserted into the pBShhn-pTEF vector previously linearized with KpnI (Fermentas). Vector contains ampicillin resistance cassette as selection marker for E. coli.
pTGFPh - The vector contains uGFP sequence fused to Hpt gene. The uGFP sequence was amplified by PCR and inserted into the pBShhn-pTEF vector using the NheI and SmaI restriction sites. Vector possesses ampicillin resistance cassette as selection marker for E. coli.
pToGFP – The vector contain oGFP sequence fused to the Hpt. The uGFP sequence was exchanged with oGFP (P.
indica codon optimized GFP gene, synthesized by GenScript) using NheI and SmaI (NEB). Vector contains ampicillin resistance cassette as selection marker for E. coli.
pGOGFP - P. indica GPD promoter sequence was amplified and inserted into the pGEMTEasy vector. The nos terminator sequence was introduced with NotI and SacI (NEB) and the oGFP sequence was cloned upstream of the nos terminator with EcoRV (NEB). The pGPD::oGFP-tnos cassette was transferred into the pBShhn-pTEF vector using KpnI (NEB). Vector contains ampicillin resistance cassette as selection marker for E. coli.
pRNAi7534 – Plasmid constructed for RNAi analyses for piTam1 gene. The 131 bp long fragment of the gene PIIN_07534 was amplified by PCR and cloned between the piTEF and piGPD promoters with EcoRV. Vector contains hygromycin resistance for selection in P. indica and ampicillin resistance for selection in E. coli.
pToGFP –Vector used for promoter analyses of piTam1 gene. The piGPD promoter sequence was cut out with ApaI and HindIII (NEB) from the pGoGFP backbone and exchanged with 230 bp of the promoter region upstream of the piTam1 gene. Vector contains hygromycin resistance for selection in P. indica and ampicillin resistance for selection in E. coli.
Material and methods U. maydis transformation vectors:
p123 - Vector possesses an eGFP gene which is fused to the otef promoter and nos terminator. For selection in U.
maydis vector contains the carboxin resistance gene and for selection in E.
coli an ampicillin resistance gene.
Vector was kindly provided by Dr. G.
Döhlemann, MPI Marburg, Germany, (Aichinger et al., 2003).
p123_10496 - The eGFP sequence (752 bp) from vector p123 was cut out with BamHI and NotI (NEB) and exchanged with the full length of PIIN_10496
(1065 bp). For selection in U. maydis vector contains the carboxin resistance gene and for selection in E. coli an ampicillin resistance gene.
p123_3173 - The eGFP sequence (752 bp) from vector p123 was cut out with BamHI and NotI (NEB) and exchanged with the full length of PIIN_03173 (1014 bp). For selection in U. maydis vector contains the carboxin resistance gene and for selection in E. coli an ampicillin resistance gene.