Using DZF domains to dimerize DNA-binding zinc-fingers

3.7.1 Overview

Previous studies have shown that DNA-binding C2H2 ZFs can be linked together into tandem arrays capable of binding to extended DNA sequences with increased affinity and specificity. However, only limited numbers of fingers can be linked together in order to create a functional protein. Several synthetic peptides consisting of more then three ZFs have been characterized but these peptides displayed only little enhancements in their DNA-binding affinity (reviewed in Wolfe et al., 2000; reviewed in Pabo et al., 2001; see also section 1.2.5). These limitations are likely to be due to structural or energetical problems that emerge when more then three fingers are present. To avoid this problem, alternative approaches were taken to design DNA-binding proteins with higher and more specific DNA binding affinity. One successful strategy involved the attachment of a dimerization domain to DNA-binding ZFs which enables these ZF to bind DNA in a cooperative manner. Different dimerization systems have been described which assemble DNA-binding ZFs on the DNA and enhance their specificities and affinities (Pomerantz et al., 1998; Wang and Pabo, 1999;

Wolfe et al., 2000; Wolfe et al., 2003). Thus, we were interested in testing if DZF domains can also be used as modules that could be applied to dimerize DNA binding C2H2 ZFs.

3.7.2 Setup

As an initial test of whether DZF domains can be used as dimerization elements we applied these domains to cooperatively assemble DNA-binding ZFs on the DNA. For some of the DZF domains (e.g. - Ikaros family of transcription factors) it has been shown that they mediate dimerization of their N-terminal DNA-binding zinc finger domain (Sun et al., 1996;

Morgan et al., 1997; Kelley et al., 1998). Thus, we hypothesized that these domains should be able to mediate dimerization of heterologous DNA-binding C2H2 ZFs as well. To begin exploring the possibility of dimerizing DNA-binding ZFs using DZF domains, the B2H system was adapted so that it could be used as a reporter system for detecting protein-DNA interactions mediated by dimerization.

The idea was to construct a fusion of finger 2 and 3 from Zif268 (ZF23) to the DZF domain of Ikaros. Finger 2 and 3 from Zif268 were chosen because previous studies have shown that these two fingers are not able to bind tightly to their specific DNA site due to low binding affinities. However, attaching a dimerization domain can mediate the cooperative binding of

Attach DZF

Figure 3.22 Schematic overview of the B2H system for testing if DZF domains can dimerize DNA-binding ZFs. (A) DNA-DNA-binding domains consisting of F2 and F3 of Zif268 but lacking F1 (numbered blue circles) fail to bind to their specific DBS (left side of Figure). Attachment of a dimerization element represented by the DZF domain (green double ovals) should mediate dimerization of the two DNA-binding ZFs, thus permitting them to bind to their composite DBS (right side of Figure). (B) The B2H system was used to detect cooperative binding of DZF-ZF23 fusion proteins to a composite DBS. In this setup Gal11P (dark pink) was fused to the C-terminus of F3 from Zif268 and its interacting partner Gal4 (light pink) was fused to the RNAP α-subunit. Assembling of the DNA-binding ZFs (numbered blue circles) on the composite DBS placed upstream of the lacZ reporter gene by DZF mediated dimerization should recruit the RNAP to the promoter via the interaction between Gal11P and Gal4, which should result in an activation of lacZ transcription. This Figure was kindly provided by K. Joung.

these two fingers to a composite DNA side consisting of two specific “half-sites” (Figure 3.22A, Wolfe et al., 2000). To detect the protein-DNA interactions, a B2H reporter strain must be used which bears a composite DNA-binding side consisting of two “half-sites”

known to be bound by ZF23 in the promoter region of the lacZ reporter gene. Furthermore, a fragment of the yeast Gal11P protein (GP) was connected to the C-terminus of the DZF-ZF23 fusion protein which will allow detection of DNA binding through its interaction with the yeast protein Gal4 (Joung et al., 2000; Hurt et al., 2003). To initiate activation of the lacZ reporter gene, the B2H reporter strain has to co-express Gal4 fused to the RNAP α-subunit with the DZF-Zif23-GP fusion protein. Cooperative binding of two DZF-Z23-GP fusion proteins to their composite DNA-binding site should then enable GP to recruit the RNAP to the promoter via its interaction with Gal4, which should in turn activate the expression of lacZ (Figure 3.22B).

3.7.3 Characterization of Ik-Zif268-Gal11P and Ik-Z23-Gal11P in the B2H system

Initial experiments to determine whether the Ik-Z23-GP fusion protein can be studied using this B2H setup were performed. First, we tested if the GP fragment is functional in the context of our Ikaros-Zif268 hybrid protein. Thus, the Ik-Zif268 fragment (containing all three DNA-binding ZFs) was fused to a fragment of the yeast GP protein using a flexible linker of the sequence GGGGS to create the Ik-Zif268-GP fusion. A C-terminal FLAG tag epitope was also added for Western blot analysis. Plasmids encoding the Ik-Zif268-GP fusion and the α-Gal4 hybrid protein were then introduced in the B2H strain harboring one Zif268 binding side and β-galactosidase assays were performed to assess the binding of this fusion protein to its DNA side. As shown in Figure 3.23, the Ik-Zif268-GP fusion protein can bind to its specific DNA site and efficiently activates transcription of the lacZ reporter gene compared with the Ik-Zif268 only control. This suggests that the GP protein is functional in the context of our fusion protein and can generally be used to detect DNA-binding through its interaction with the yeast protein Gal4.

F1 of the Zif268 protein was then deleted by PCR to create the Ik-Z23-GP hybrid protein. As expected, in contrast to the Ik-Zif268-GP, Ik-Z23-GP was not able to mediate activation of lacZ in the B2H system (Figure 3.23) suggesting that Finger 2 and 3 of Zif268 were not able to bind to the promoter consisting of one Zif268 DBS.

To further test whether the Ik-Z23-GP protein is stably expressed, Western blot analysis was performed. This should rule out that the abolished activation of lacZ is due to a lack of protein. Thus, whole cell lysates from the cultures used for the β-galactosidase assays were resolved by SDS-polyacrylamide gel electrophoresis. Western blot analysis was performed to visualize the hybrid proteins using an anti-FLAG antibody that recognizes the C-terminal FLAG tag epitope. We found that the Ik-Z23-GP protein is stably expressed (data not shown) and concluded that Ik-Z23-GP could not bind with high affinity to the Zif268 binding side because it contained only two DNA-binding ZFs.

3.7.4 Dimerization of Ik-Z23-GP using the DZF domain

We next wanted to determine whether the attached DZF domains can be used to mediate cooperative binding of two 2-Finger Zif268 domains to a composite DNA side composed of two half-sites. To assess cooperative DNA-binding by the Ik-Z23-GP protein, appropriate B2H reporter strains were constructed that harbor composite DNA-binding sites in the promoter region of the lacZ reporter gene. In these strains the six-base-pair binding sites (“half-site”) for each Ik-Z23-GP monomer are arranged in an inverted orientation. A series of B2H reporters were generated containing various spacings of the half-sites (Table 3.4) to find an arrangement optimal for DNA-binding (termed as 0, 1, 3 ... sites). To test whether Z23-GP can dimerize and subsequently bind to the inverted half-sites, plasmids expressing Ik-Z23-GP together with a plasmid encoding the α-GAL4 were introduced into each of the B2H reporter strains to assess β-galactosidase activities. It was found that none of the reporters exhibited high activation of the lacZ gene indicating that Ik-Z23-GP was not able to bind cooperatively as a dimer. Increasing the concentration of IPTG to produce more protein did

Figure 3.23 The B2H system can be used to study DZF mediated dimerization of DNA-binding ZFs. Plasmids encoding fusions between the Ik DZF domain, Gal11P (GP) and either Zif268 (Ik-Zif268-GP) or the Zif268 protein with a deleted F1 (Ik-Z23-GP) were co-transformed with the RNAP α-Gal4 plasmid into the reporter strain harboring only one Zif268 DBS and β-galactosidase assays were performed to assess the activity of these constructs. A control expressing the Ik DZF domain fused to Zif268 lacking the GP protein (Ik-Zif268) is also shown.

0

not improve the ability of Ik-Z23-GP to activate lacZ (data not shown).

Spacing (bp) Binding site

0 5’ – GCGTGGCCACGC – 3’

1 5’ - GCGTGGCCCACGC – 3’

3 5’ - GCGTGGGTCCCACGC – 3’

5 5’ - GCGTGGGTGGCCCACGC – 3’

7 5’ - GCGTGGGTGTAGCCCACGC – 3’

9 5’ - GCGTGGGTGGGTAGCCCACGC – 3’

11 5’ - GCGTGGGTGGGCTTAGCCCACGC – 3’

13 5’ - GCGTGGGTGGGCGATTAGCCCACGC – 3’

16 5’ - GCGTGGGTGGGCGACTATTAGCCCACGC – 3’

22 5’ - GCGTGGGTGGGCGACGCACAGTATTAGCCCACGC – 3’

Table 3.4 Composite DBSs for cooperative binding of F2 and F3 of Z23. The sequences of the different DBSs used to construct B2H reporter strains are given in the right column. The six base-pair binding sites (half-sites, 5’ – GCGTGG – 3’) recognized by the ZFs in each Ik-Z23-GP monomer are highlighted in red and green where the red triplet is recognized by F2 and the green triplet is recognized by F3 of Z23. The spacing between two sites is shown in the left column (indicated as numbers of base-pairs present in between the two half-sites). Note that only one DNA strand is shown and the second half-site is actually on the other strand (indicated by a reverse complement display of the actual half-site).

We suspected that our setup configuration might not provide the right geometry for the Ik-Z23 to bind cooperatively. Thus, we decided to adjust the configuration of the Ik-Ik-Z23 protein by optimizing the linker region between the Ikaros DZF domain and the Z23 DNA-binding domain. Different linkers of various length and flexibility (Table 3.5) were introduced since the geometry of our dimeric DNA-binding complex was unknown.

Linker name Linker sequence

L1 RFHMSGGSRVRTGSKTPPHERP

L2 AAA

L3 GGGGS L4 RFHMS

L5 RFHMSGGGGS L6 TGEKP

Table 3.5 Linkers used to connect the Ikaros DZF domain to the Z23. The right column shows the amino-acid sequences of the various linkers. Residues that represent the authentic C-terminal end of the Ikaros protein are highlighted in red and were only present in L1, L4 and L5. L2, L3 and L6 were directly fused to the final zinc-binding histidine of the DZF domain.

Plasmids encoding the different linker constructs were introduced into each of the B2H reporter strains and β-galactosidase activities were assessed. None of the various proteins in

combination with the different binding sites we tested was able to activate lacZ (data not shown). However, linker L6 (canonical TGEKP-type linker) improved the ability of Ik-Z23-GP to bind to the 0 site which stimulated transcription of lacZ gene nearly two-fold (Figure 3.24). Again, this effect could not be improved by adding more IPTG (thereby increasing the amount of protein, data not shown).

To further verify that this increased activation of lacZ depends on a cooperative binding of Ik-Z23-GP mediated by dimerization, the D18Q mutation was introduced into the attached DZF domain. The effect of this mutation was assessed in the 0 site reporter using various concentrations of IPTG. As shown in Figure 3.24, D18Q completely abolished the ability of Ik-Z23-GP to activate lacZ. This suggested that the DZF domain mediated a cooperative binding of Ik-Z23 to the two half-sites by dimerizing two Ik-Z23 molecules. We concluded that it was in principle possible to use the DZF domains as a dimerization element to assemble DNA-binding ZFs on specific DNA-sites although the cooperative binding of Ik-Z23 was not very strong. This again demonstrated the versatility of the C2H2 ZF motif.