Supplementary Figure 1 Analysis of genes which were less and more expressed in sid2 tga1 tga4 mutant twenty-four hours after SA treatment comparing to SA-inducible genes in sid2 background A Venn diagram was used to analyze the relation of SA-inducible genes in sid2 (gray circle) and genes which were more (red circle) and less (green circle) expressed in sid2 tga1 tga4 mutant after SA treatment.
B The group of 803 genes, which were not SA-inducible in sid2 but were less expressed in the sid2 tga1 tga4 mutant background was analyzed for the GO (Gene Ontology) enrichment in biological processes (light green bars). The Arabidopsis genome was used as a background set (black bars). Indicated in red are GO terms which were previously found to be downregulated in tga1 tga4 mutant (Li et al, 2019).
0 10 20 30 40 photosynthesis, light harvesting in photosystem I
protein-chromophore linkage
110
E The group of 1200 genes, which were not SA-inducible in sid2 but were more expressed in the sid2 tga1 tga4 mutant background was analyzed for the GO (Gene Ontology) enrichment in biological processes (light red bars). The Arabidopsis genome was used as a background set (black bars).
Differentially expressed genes were determined as FC (fold change (log2 FC ≥ 1 or FC ≤ -1), p < 0.05).
Statistical analysis was performed using RobiNA software. Gene Ontology analysis platform was used for the GO enrichment analysis (http://geneontology.org/). The software uses Arabidopsis genome reference list consisting of 27581 genes. Statistical analysis was performed using Fisher test and False discovery rate (FDR) < 0.05(B), FDR < 10-5 (C). Top 14 significant are shown.
Supplementary Figure 2 Treatment with SA caused induction of genes involved in defense response against bacterium and other organisms.
A 7.8 % of Arabidopsis genome was induced 8h after SA treatment. The group of 2145 genes that were SA-inducible in sid2 after eight hours was analyzed for the GO enrichment in biological processes using Arabidopsis genome as background.
0
111
B 4.4 % of Arabidopsis genome was induced twenty-four hour after SA treatment. The group of 1218 genes that were SA-inducible in sid2 after twenty-four hours was analyzed for the GO enrichment in biological processes using Arabidopsis genome as background.
Differentially expressed genes were determined as FC (fold change (log2 FC ≥ 1 or FC ≤ -1), p < 0.05).
Statistical analysis was performed using RobiNA software. Gene Ontology analysis platform was used for the GO enrichment analysis (http://geneontology.org/). The software uses Arabidopsis genome reference list consisting of 27581 genes. Statistical analysis was performed using Fisher test and False discovery rate (FDR) < 10-16(A), FDR < 10-19 (B). Top 20 most significant are shown.
Supplementary Figure 3 Complementation of tga1 tga4 mutant is not influenced by the redox state of four critical cysteine residues.
qRT-PCR analysis of DLO1, BGL2 and PR1 transcript levels after SA treatment of wild-type and tga1 tga4 plants complimented either with empty vector (EV), TGA1 genomic clone (TGA1g) or TGA1 genomic clone carrying mutations in the four critical cysteine residues (TGA1gr) under native promoter. Four-week-old plants were sprayed either with mock or 1mM SA at 1 h after the subjective dawn and further incubated for 8 h. Transcript levels were normalized to transcript level of UBQ5. Bars represent the average ± SEM of four to six plants of each genotype. Experiment was repeated once with similar results. All data shown here are from the same experiment.
Statistical analysis was performed using two-way ANOVA followed by Bonferroni’s post-hoc test.
Lowercase letters indicate significant differences (P < 0.05) between mock-treated samples; uppercase letters indicate significant differences (P < 0.05) between SA-treated samples. EV-empty vector, TGA1-TGA1 genomic clone, TGA1gr-TGA1 genomic clone with four cysteines mutated, mock-water, SA-salicylic acid.
112
Supplementary Figure 4 Induction of DLO1, BGL2 and PR1 genes after SA treatment is regulated by clade I and II TGA transcription factors and NPR1.
A qRT-PCR analysis of DLO1, BGL2 and PR1 transcript levels after SA treatment of sid2, sid2 tga1 tga4 and sid2 tga2 tga5 tga6. Four-week-old plants were sprayed either with mock or 1mM SA at 1 h after the subjective dawn and further incubated for 8 h. Transcript levels were normalized to transcript level of UBQ5. Bars represent the average ± SEM of four to six plants of each genotype. Experiment was repeated once with similar results. Shown data are taken from the same experiment.
B qRT-PCR analysis of DLO1, BGL2 and PR1 transcript levels after SA treatment of sid2 and sid2 npr1.
Four-week-old plants were sprayed either with mock or 1mM SA at 1 h after the subjective dawn and further incubated for 8 h. Transcript levels were normalized to transcript level of UBQ5. Bars represent the average ± SEM of four to seven plants of each genotype. Experiment was repeated once with similar results. Shown data are taken from the same experiment.
Statistical analysis was performed using two-way ANOVA followed by Bonferroni’s post-hoc test.
Lowercase letters indicate significant differences (P < 0.05) between mock-treated samples; uppercase letters indicate significant differences (P < 0.05) between SA-treated samples. mock-water, SA-salicylic acid
113
Supplementary Figure 5TGA2/TGA5/TGA6 and NPR1 control SARD1 expression downstream of SA.
A qRT-PCR analysis of SARD1 transcript levels after SA treatment of sid2, sid2 tga1 tga4 and sid2 tga2 tga5 tga6. Four-week-old plants were sprayed either with mock or 1mM SA at 1 h after the subjective dawn and further incubated for 8 h. Transcript levels were normalized to transcript level of UBQ5. Bars represent the average ± SEM of four to six plants of each genotype. Experiment was repeated once with similar results. Shown data are taken from the same experiment.
B qRT-PCR analysis of DLO1, BGL2 and PR1 transcript levels after SA treatment of sid2 and sid2 npr1.
Four-week-old plants were sprayed either with mock or 1mM SA at 1 h after the subjective dawn and further incubated for 8 h. Transcript levels were normalized to transcript level of UBQ5. Bars represent the average ± SEM of four to seven plants of each genotype. Experiment was repeated once with similar results. Shown data are taken from the same experiment
Statistical analysis was performed using two-way ANOVA followed by Bonferroni’s post-hoc test.
Lowercase letters indicate significant differences (P < 0.05) between mock-treated samples; uppercase letters indicate significant differences (P < 0.05) between SA-treated samples. mock-water, SA-salicylic acid
114
Supplementary Figure 6 TGA1 antibody is specific for TGA1 protein
Escherichia coli (BL1 strain) bacterium was transformed with a plasmid containing TGA1-GFP, TGA2-GFP, TGA4-GFP and GFP gene regulated by a T7 promoter and an empty vector (EV) control plasmid.
Isopropyl-ß-D-thiogalactopyranoside (IPTG) induces the expression by removing the lac-repressor on the T7 polymerase gene. T7 polymerase subsequently activates the T7 promoter. Bacterial cultures were harvested 3 hours after IPTG induction. Cells were sonicated and lysate was centrifuged.
Supernatant was mixed with 4x SDS loading buffer. Diluted samples were mixed with E. coli expressing empty vector in 1 to 10 ratios.
A Western blot analysis of protein extracts of E. coli expressing TGA1-GFP, TGA2-GFP, TGA4-GFP and GFP gene regulated by a T7 promoter and an empty vector (EV). TGA1 protein was detected using TGA1 antibody.
B Western blot analysis of protein extracts of E. coli expressing TGA1-GFP, TGA2-GFP, TGA4-GFP and GFP gene regulated by a T7 promoter and an empty vector (EV). GFP protein fusions were detected using GFP antibody.
EV-empty vector, GFP-Green Fluorescent Protein, kDa-kilo Dalton. Experiment was performed by Dyari Mohammed.
~ 70 kDa
~ 30 kDa
α TGA1
Coomassie Blue
TGA1-GFP TGA2-GFP TGA4-GFP GFP TGA1-GFP TGA2-GFP TGA4-GFP GFP EV
undiluted 1:10
TGA1-GFP TGA2-GFP TGA4-GFP GFP TGA1-GFP TGA2-GFP TGA4-GFP GFP EV
undiluted 1:10
α GFP
A B
115
Supplementary Figure 7 Alignment of genomic ROXY15 with chimeric ROXY15 from roxy11-15 and roxy11-15 tga1 tga4 mutant generated by CRISPR-Cas9.
ROXY11-15 genes are organized in a fifteen kilobase long cluster at the chromosome four of Arabidopsis thaliana. We used CRISPR-Cas9 technology to knock out the whole cluster of genes. To do so, we designed three types of oligonucleotides, named A, B and C, each targeting different sets of genes from the cluster. The major goal of this CRISPR-Cas9 approach was to cause the deletion of five genes with oligonucleotides targeting the outermost genes ROXY15 and ROXY11.
roxy11-15 tga1 tga4 had a 26 base pair deletion upstream of PAM (green) sequence targeted by oligonucleotide (red) resulting in chimeric product of ROXY15 (black) and ROXY11 (brown) gene.
roxy11-15 had a 5 base pair insertion upstream of PAM (green) sequence of oligonucleotide (red) resulting in chimeric product of ROXY15 (black) and ROXY11 (brown) gene. Nucleotide number of chromosome four of Arabidopsis thaliana is shown in black boxes above sequences. Single nucleotide differences between ROXY15 and ROXY11 genes are underlined.
ROXY15 (At4g15660) roxy11-15 tga1 tga4
CTTGTTGCATGTCACACACAATCAAGACTCTCTTCTTAGACCTTGGCGTGAACCCGACAAT CTTGTTGCATGTCAC - - - CTTGGCGTGAACCCGACGAT
8926051 8937644
roxy11-15
TGGAGAAGATACAAAAGATGATCTCCGAGA- - - - -AGTCGGTAGTAATATTTAGCAATA TGGAGAAGATACAAAAGATGATCTCCGAGATCTTTAGTCGGTAGTGATCTTTAGCAAGA
8925937 8937579 ROXY15 (At4g15660)
116
Supplementary Figure 8 Alignment of genomic ROXY6-9 with mutant alleles from roxy6-9 generated by CRISPR-Cas9.
roxy6 had a single base pair insertion upstream of PAM (green) sequence resulting in frame shift.
roxy7 had a single base pair deletion upstream of PAM (green) sequence resulting in frame shift.
roxy8 had 16 base pair deletion resulting in frame shift.
roxy9 had 7 base pair deletion resulting in frame shift.
All frame shifts led to premature stop codon. Nucleotide number of chromosomes of Arabidopsis thaliana is shown in black boxes above sequences. Nucleotide differences between wild-type and mutated alleles are marked in brown and underlined.
ROXY7 (At2g30540) roxy7
GTTGCATGTCCTATGCGGTCCAAGTACTTTTCCAAGACCTTGGGGTTCACCCAACAGTCCA GTTGCATGTCCTATG- GGTCCAAGTACTTTTCCAAGACCTTGGGGTTCACCCAACAGTCCA
13011491
roxy6
ROXY6 (At1g06830) ATGGACAAAGTTATGAGAATGTCGTCCGAAAAAGGGG- TGGTTATATTTACCAAGAGCTC ATGGACAAAGTTATGAGAATGTCGTCCGAAAAAGGGGGTGGTTATATTTACCAAGAGCTC
2097175
ROXY9 (At2g47880) roxy9
CGAAGAGCTCATGTTGTCTCTGCTACGCCGTTCAAATCCTGTTCCGTGACCTTAGGGTTCA CGAAGAGCTCATGTTGTCTCTGCTACGC- - - -ATCCTGTTCCGTGACCTTAGGGTTCA
1965172
ROXY8 (At3g62960)
roxy8 TGTCTCTGCTACGCCGTGCAAATCCTTTTCCGTGATCTTAGGGTTCAACCAACAATCCACG 23268842
TGTCTCTGCTACG- - - -TCCGTGATCTTAGGGTTCAACCAACAATCCACG