Die Beobachtung, das Sp-Faktoren eine entscheidende Rolle an der Regulation vieler essentieller Gene zur Steuerung von Wachstum, Überleben, Invasion und Angiogenese besitzen, rückte Faktoren auch in den Mittelpunkt therapeutischer Studien mit Sp-Faktoren als Target. Hintergrund dieser Untersuchungen war es, expressionsmodulierende Moleküle zu identifizieren. Im Vorfeld wurde bereits von Papavassiliou et al. diskutiert, dass oberstes Ziel im Design eines Medikaments mit einem Transkriptionsfaktor als Target die lokale Begrenzung der Wirkung des Medikaments auf eine spezielle Zellreihe oder ein selektioniertes Gewebe sein muss (198). Vor diesem Hintergrund wurde gezeigt, dass eine Interferenz mit Sp1/Sp3 durch das Einbringen von siRNA sowie von Antisense-Oligonukleotiden möglich sei. Darüber hinaus ist die Konstruktion von Antikörpern und Decoy-Oligonukleotiden denkbar, die mit den Transkriptionsfaktoren bzw. der entsprechenden DNA interagieren (199). Des Weiteren wurde eine thermische Instabilität von Sp1 beschrieben, die zur Destruktion und Hemmung des Transkriptionsfaktors von Nutzen sein könnte (200). In einer Studie wurde unter Verwendung von EMSA-Untersuchungen mit Sp1 und Oligonukleotiden mit Sp1 Consensus-Sequenz durch Einsatz von Anthrazyklinen die Interaktion zwischen Protein und Sequenz inhibiert. Es zeigte sich ein kompetitives Bindungsverhalten zwischen Sp1 Proteinen und Anthrazyklinen und eine 35%ige Inhibition der Bindung (201). In Adenokarzinomzellen des Pankreas mit erhöhter Expression von Sp-Faktoren konnte gezeigt werden (187;190;202), dass die Applikation des Cyclooxygenase-2 (COX-2)-Inhibitors Celecoxib Angiogenese und Metastasierung durch Suppression der Sp1 vermittelten VEGF-A Expression reduziert, an der proximale GC-reiche Elemente des vegf-A Promotors im vorbeschriebenen Bereich zwischen -104 und -60 essentiell beteiligt waren (203). Außerdem wurde als zusätzlicher Wirkmechanismus ein verringertes Verhältnis von phosphoryliertem (P-Sp1) gegenüber dephosphoryliertem Sp1 beschrieben (203). Aus diesen Ergebnissen wurde gefolgert, dass sich die Wirkung
molekulare Mechanismus ergänzt potentielle transkriptionelle Regulationsmechanismen in der Regulation von Sp-Faktoren. Ähnliche Beobachtungen konnten durch Applikation des nicht-steroidalen Antirheumatikums (NSAR) Tolfenamid durch Abdelrahim et al. in Adenokarzinomzellen des Pankreas gemacht werden, indem nach Applikation eine signifikanten Abnahme der Expression von Sp1, Sp3, Sp4 und VEGFR-1 nachgewiesen wurde (187). In der Kolonkarzinom-Zelllinie SW480 ließ sich darüber hinaus erstmals eine Sp1-, Sp3- und zusätzlich Sp4-abhängige Regulation von VEGF-A nachweisen.
Die Degradation von Sp1 und Sp4 nach Applikation eines COX-2 Inhibitors führte zur verminderten Expression von VEGF und zeigte damit erstmals Sp4 im Rahmen der Tumorgenese (204). Die Ergebnisse dieser Arbeiten zeigen die für VEGFR-3 ermittelten Transkriptionsfaktoren Sp1 und Sp3 im Mittelpunkt der Interaktion mit Medikamenten und geben dabei eine Richtung vor, in der die wachstumsterminierenden Faktoren aus der Familie der Sp-Faktoren als Targets einer antiangiogenen und antikanzerösen Therapie dienen können. Jedoch bedarf es weiterführender Studien, die die in vitro demonstrierten molekularen Mechanismen der transkriptionellen Regulation von vegfr-3 und die Aktivierung durch Sp1 und Sp3 in vitro weiterführend untersuchen, um eine wachstumsterminerende Interaktion auf molekularer Ebene zu ermöglichen.
5 Zusammenfassung
Hintergrund:
VEGFR-3 besitzt als Bindungsstelle für die lymphangiogenen Faktoren VEGF-C und VEGF-D eine entscheidende Bedeutung für physiologische Prozesse der Lymphangiogenese während der Embryogenese. Die Bedeutung von VEGFR-3 für die Regulation der Lymphangiogenese wurde durch die Assoziation mit pathogenetischen Schritten der Tumorgenese und Metastasierung verdeutlicht, in denen eine vermehrte Expression in einer Vielzahl solider Tumoren nachgewiesen wurde. Während für andere Vertreter der VEGF-/VEGFR-Familie bereits Transkriptionsfaktoren und entscheidende regulative Elemente der transkriptionellen Regulation beschrieben worden sind, fehlen für das vegfr-3 Gen trotz seiner großen Bedeutung für lymphangiogenetische Prozesse wesentliche Kenntnisse über die molekularen, strukturellen und funktionellen
Mechanismen.
Methode:
Durch molekularbiologischen Techniken wurde der vegfr-3 Promotor kloniert, um mittels 5’-Promotoranalyse unter Generierung von Reportergenkonstrukten essentielle Promotorelemente und strukturelle Charakteristika zu ermitteln. Transiente Transfektionen in Endothelzellen zeigten ein Minimalpromotorelement, das als Sonde für EMSA-Studien zur Identifikation nukleärer Transkriptionsfaktoren diente. Durch Synthetisierung von Mutanten zum Einsatz als DNA-Sonde wurde die funktionelle Rolle der identifizierten Transkriptionsfaktoren bestimmt sowie im heterologen Promotorsystem ohne mammalischer Transkriptionsfaktoren untersucht. Anschließend wurden die identifizierten strukturellen und funktionellen, molekularen Charakteristika des vegfr-3 Promotors im Vergleich zu den Vertretern der VEGF-/VEGFR-Familie interpretiert.
Ergebnisse:
Erstmals wurden mit Sp1 und Sp3 aus der Familie der Zinkfinger-bindenen Proteine essentielle Transkriptionsfaktoren für die Regulation des vegfr-3 Gens beschrieben, die an (5')-101 TCCCGGGCCCGCCTCCGGCCCCCGCCCCGCCCCGCC -66(3') binden.
Damit wurde für vegfr-3 ein essentielles, regulatives GC-reiches Element im proximalen Promotorbereich identifiziert. Für beide Transkriptionsfaktoren wurde eine
konservierte GC-reiche Elemente mit ähnlichem Nukleotidmuster im Vergleich zu anderen Vertretern der VEGF-/VEGFR-Familien nachgewiesen werden.
Diskussion:
Mit der Analyse der transkriptionellen Regulation des vegfr-3 Promotors wurde ein weiteres Gen aus der VEGF-/VEGFR-Familie identifiziert, an dessen Regulation Sp1 und Sp3 beteiligt sind. Beide Transkriptionsfaktoren wurden bereits für die Regulation wachstumsterminierender Gen-Promotoren und Angiogenese-Gene beschrieben.
Neben VEGFR-3 wurden auch Sp1 und Sp3 in der Tumorgenese verschiedener Tumorentitäten nachgewiesen. Sp1 wurde als unabhängiger, molekularer Marker für das Magenkarzinom und das kolorektale Karzinom beschrieben, in denen auch die erhöhte Expression von VEGFR-3 identifiziert wurde.
Schlussfolgerung:
In dieser Arbeit konnten basale transkriptionelle Regulationsmechanismen der Genexpression von vegfr-3 gezeigt werden. Die Ergebnisse sind bedeutungsvoll für ein besseres Verständnis der molekularen Regulation von vegfr-3 und sollen für weiterführende Untersuchungen die Grundlage für eine umfassendere physiologische und pathobiologische Einordnung bieten.
6 Literaturverzeichnis
1. Goldman E. The growth of malignant disease in man and the lower animals with special reference to the vascular system. Lancet , 1236-1240. 1907.
2. Greenblatt M, Shubi P. Tumor Angiogenesis: Transfilter Diffusion Studies in the Hamster by the Transparent Chamber Technique. J Natl Cancer Inst 1968; 41(1):
111-24.
3. Folkman J, Merler E, Abernathy C, Williams G. Isolation of a Tumor Factor Responsible for Angiogenesis. J Exp Med 1971; 133(2): 275-88.
4. Folkman J. Tumor Angiogenesis: Therapeutic Implications. N Engl J Med 1971;
285(21): 1182-6.
5. Gullino PM. Angiogenesis and Oncogenesis. J Natl Cancer Inst 1978; 61(3): 639-43.
6. Yancopoulos GD, Davis S, Gale NW, Rudge JS, Wiegand SJ, Holash J.
Vascular-Specific Growth Factors and Blood Vessel Formation. Nature 2000;
407(6801): 242-8.
7. Neufeld G, Cohen T, Gengrinovitch S, Poltorak Z. Vascular Endothelial Growth Factor (VEGF) and Its Receptors. FASEB J 1999; 13(1): 9-22.
8. Makinen T, Veikkola T, Mustjoki S et al. Isolated Lymphatic Endothelial Cells Transduce Growth, Survival and Migratory Signals Via the VEGF-C/D Receptor VEGFR-3. EMBO J 2001; 20(17): 4762-73.
9. Skobe M, Hawighorst T, Jackson DG et al. Induction of Tumor
Lymphangiogenesis by VEGF-C Promotes Breast Cancer Metastasis. Nat Med 2001; 7(2): 192-8.
10. Stacker SA, Caesar C, Baldwin ME et al. VEGF-D Promotes the Metastatic Spread of Tumor Cells Via the Lymphatics. Nat Med 2001; 7(2): 186-91.
11. Stacker SA, Achen MG, Jussila L, Baldwin ME, Alitalo K. Lymphangiogenesis and Cancer Metastasis. Nat Rev Cancer 2002; 2(8): 573-83.
12. Armstrong E, Kastury K, Aprelikova O et al. FLT4 Receptor Tyrosine Kinase Gene Mapping to Chromosome Band 5q35 in Relation to the T(2;5), T(5;6), and T(3;5) Translocations. Genes Chromosomes Cancer 1993; 7(3): 144-51.
13. Galland F, Karamysheva A, Mattei MG, Rosnet O, Marchetto S, Birnbaum D.
Chromosomal Localization of FLT4, a Novel Receptor-Type Tyrosine Kinase Gene. Genomics 1992; 13(2): 475-8.
15. Ferrara N, Gerber HP. The Role of Vascular Endothelial Growth Factor in Angiogenesis. Acta Haematol 2001; 106(4): 148-56.
16. Lymboussaki A, Olofsson B, Eriksson U, Alitalo K. Vascular Endothelial Growth Factor (VEGF) and VEGF-C Show Overlapping Binding Sites in Embryonic Endothelia and Distinct Sites in Differentiated Adult Endothelia. Circ Res 1999;
85(11): 992-9.
17. Olofsson B, Jeltsch M, Eriksson U, Alitalo K. Current Biology of VEGF-B and VEGF-C. Curr Opin Biotechnol 1999; 10(6): 528-35.
18. Risau W. Mechanisms of Angiogenesis. Nature 1997; 386(6626): 671-4.
19. Carmeliet P, Ferreira V, Breier G et al. Abnormal Blood Vessel Development and Lethality in Embryos Lacking a Single VEGF Allele. Nature 1996; 380(6573):
435-9.
20. Breier G, Albrecht U, Sterrer S, Risau W. Expression of Vascular Endothelial Growth Factor During Embryonic Angiogenesis and Endothelial Cell
Differentiation. Development 1992; 114(2): 521-32.
21. Plate KH, Breier G, Weich HA, Risau W. Vascular Endothelial Growth Factor Is a Potential Tumour Angiogenesis Factor in Human Gliomas in Vivo. Nature 1992;
359(6398): 845-8.
22. Hamada K, Oike Y, Takakura N et al. VEGF-C Signaling Pathways Through VEGFR-2 and VEGFR-3 in Vasculoangiogenesis and Hematopoiesis. Blood 2000; 96(12): 3793-800.
23. Huang HY, Ho CC, Huang PH, Hsu SM. Co-Expression of VEGF-C and Its Receptors, VEGFR-2 and VEGFR-3, in Endothelial Cells of Lymphangioma.
Implication in Autocrine or Paracrine Regulation of Lymphangioma. Lab Invest 2001; 81(12): 1729-34.
24. Wissmann C, Hocker M. [VEGF-C, VEGF-D and VEGF-Receptor 3: Novel Key Regulators of Lymphangiogenesis and Cancer Metastasis]. Z Gastroenterol 2002; 40(9): 853-6.
25. Silvestre JS, Tamarat R, Ebrahimian TG et al. Vascular Endothelial Growth Factor-B Promotes in Vivo Angiogenesis. Circ Res 2003; 93(2): 114-23.
26. Mould AW, Tonks ID, Cahill MM et al. Vegfb Gene Knockout Mice Display Reduced Pathology and Synovial Angiogenesis in Both Antigen-Induced and Collagen-Induced Models of Arthritis. Arthritis Rheum 2003; 48(9): 2660-9.
27. Olofsson B, Pajusola K, von Euler G, Chilov D, Alitalo K, Eriksson U. Genomic Organization of the Mouse and Human Genes for Vascular Endothelial Growth Factor B (VEGF-B) and Characterization of a Second Splice Isoform. J Biol Chem 1996; 271(32): 19310-7.
28. Yonekura H, Sakurai S, Liu X et al. Placenta Growth Factor and Vascular
Endothelial Growth Factor B and C Expression in Microvascular Endothelial Cells and Pericytes. Implication in Autocrine and Paracrine Regulation of
Angiogenesis. J Biol Chem 1999; 274(49): 35172-8.
29. Olofsson B, Pajusola K, Kaipainen A et al. Vascular Endothelial Growth Factor B, a Novel Growth Factor for Endothelial Cells. Proc Natl Acad Sci U S A 1996;
93(6): 2576-81.
30. Paavonen K, Horelli-Kuitunen N, Chilov D et al. Novel Human Vascular Endothelial Growth Factor Genes VEGF-B and VEGF-C Localize to
Chromosomes 11q13 and 4q34, Respectively. Circulation 1996; 93(6): 1079-82.
31. Gretschel S, Astrosini C, Vieth M et al. Markers of Tumour Angiogenesis and Tumour Cells in Bone Marrow in Gastric Cancer Patients. Eur J Surg Oncol 2007.
32. Stacker SA, Stenvers K, Caesar C et al. Biosynthesis of Vascular Endothelial Growth Factor-D Involves Proteolytic Processing Which Generates Non-Covalent Homodimers. J Biol Chem 1999; 274(45): 32127-36.
33. Thelen A, Scholz A, Benckert C et al. VEGF-D Promotes Tumor Growth and Lymphatic Spread in a Mouse Model of Hepatocellular Carcinoma. Int J Cancer 2008; 122(11): 2471-81.
34. von Marschall Z, Scholz A, Stacker SA et al. Vascular Endothelial Growth Factor-D Induces Lymphangiogenesis and Lymphatic Metastasis in Models of Factor-Ductal Pancreatic Cancer. Int J Oncol 2005; 27(3): 669-79.
35. Meyer M, Clauss M, Lepple-Wienhues A et al. A Novel Vascular Endothelial Growth Factor Encoded by Orf Virus, VEGF-E, Mediates Angiogenesis Via Signalling Through VEGFR-2 (KDR) but Not VEGFR-1 (Flt-1) Receptor Tyrosine Kinases. EMBO J 1999; 18(2): 363-74.
36. Ogawa S, Oku A, Sawano A et al. A Novel Type of Vascular Endothelial Growth Factor, VEGF-E (NZ-7 VEGF), Preferentially Utilizes KDR/Flk-1 Receptor and Carries a Potent Mitotic Activity Without Heparin-Binding Domain. J Biol Chem 1998; 273(47): 31273-82.
37. Wise LM, Veikkola T, Mercer AA et al.Vascular Endothelial Growth Factor (VEGF)-Like Protein From Orf Virus NZ2 Binds to VEGFR2 and Neuropilin-1.
Proc Natl Acad Sci U S A 1999; 96(6): 3071-6.
38. Shibuya M. Vascular Endothelial Growth Factor Receptor-2: Its Unique Signaling and Specific Ligand, VEGF-E. Cancer Sci 2003; 94(9): 751-6.
39. Shibuya M. Differential Roles of Vascular Endothelial Growth Factor Receptor-1 and Receptor-2 in Angiogenesis. J Biochem Mol Biol 2006; 39(5): 469-78.
40. Shibuya M. Vascular Endothelial Growth Factor (VEGF)-Receptor2: Its Biological Functions, Major Signaling Pathway, and Specific Ligand VEGF-E. Endothelium 2006; 13(2): 63-9.
41. Andre T, Kotelevets L, Vaillant JC et al. Vegf, Vegf-B, Vegf-C and Their
Receptors KDR, FLT-1 and FLT-4 During the Neoplastic Progression of Human Colonic Mucosa. Int J Cancer 2000; 86(2): 174-81.
42. Orre M, Rogers PA. VEGF, VEGFR-1, VEGFR-2, Microvessel Density and Endothelial Cell Proliferation in Tumours of the Ovary. Int J Cancer 1999; 84(2):
101-8.
43. Wey JS, Fan F, Gray MJ et al. Vascular Endothelial Growth Factor Receptor-1 Promotes Migration and Invasion in Pancreatic Carcinoma Cell Lines. Cancer 2005; 104(2): 427-38.
44. Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, Breitman ML, Schuh AC. Failure of Blood-Island Formation and Vasculogenesis in Flk-1-Deficient Mice. Nature 1995; 376(6535): 62-6.
45. Kaipainen A, Korhonen J, Mustonen T et al. Expression of the Fms-Like Tyrosine Kinase 4 Gene Becomes Restricted to Lymphatic Endothelium During
Development. Proc Natl Acad Sci U S A 1995; 92(8): 3566-70.
46. Petrova TV, Makinen T, Makela TP et al. Lymphatic Endothelial Reprogramming of Vascular Endothelial Cells by the Prox-1 Homeobox Transcription Factor.
EMBO J 2002; 21(17): 4593-9.
47. Suzuki H, Watabe T, Kato M, Miyazawa K, Miyazono K. Roles of Vascular Endothelial Growth Factor Receptor 3 Signaling in Differentiation of Mouse Embryonic Stem Cell-Derived Vascular Progenitor Cells into Endothelial Cells.
Blood 2005; 105(6): 2372-9.
48. Dumont DJ, Jussila L, Taipale J et al.Cardiovascular Failure in Mouse Embryos Deficient in VEGF Receptor-3. Science 1998; 282(5390): 946-9.
49. Veikkola T, Jussila L, Makinen T et al. Signalling Via Vascular Endothelial Growth Factor Receptor-3 Is Sufficient for Lymphangiogenesis in Transgenic Mice. EMBO J 2001; 20(6): 1223-31.
50. Lymboussaki A, Partanen TA, Olofsson B et al. Expression of the Vascular Endothelial Grwoth Factor C Receptor VEGFR-3 in Lymphatic Endothelium of the Skin and in Vascular Tumors. Am J Pathol 1998; 153: 395-403.
51. Lyon MF, Glenister PH. Chylous Ascites (Chy). Mouse News Lett 1984; 71: 26.
52. Brice G, Child AH, Evans A et al. Milroy Disease and the VEGFR-3 Mutation Phenotype. J Med Genet 2005; 42: 98-102.
53. Evans AL, Bell R, Brice G et al. Identification of Eight Novel VEGFR-3 Mutations in Families With Primary Congenital Lymphoedema. J Med Genet 2003; 40(9):
697-703.
54. Makinen T, Jussila L, Veikkola T et al.Inhibition of Lymphangiogenesis With Resulting Lymphedema in Transgenic Mice Expressing Soluble VEGF Receptor-3. Nat Med 2001; 7(2): 199-205.
55. Ji R, Miura M, Kato S. Expression of VEGFR-3 and 5-Nase in Regenerating Lymphatic Vessels of the Cutaneous Wound Healing. Microsc Res Tech 2004;
64: 279-86.
56. Witmer AN, van Blijswijk BC, Dai J et al.VEGFR-3 in Adult Angiogenesis. J Pathol 2001; 195(4): 490-7.
57. Paavonen K, Puolakkainen P, Jussila L, Jahkola T, Alitalo K. Vascular
Endothelial Growth Factor Receptor-3 in Lymphangiogenesis in Wound Healing.
Am J Pathol 2000; 156(5): 1499-504.
58. Timke C, Krause MF, Oppermann HC, Leuschner I, Claviez A. Interferon Alpha 2b Treatment in an Eleven-Year-Old Boy With Disseminated
Lymphangiomatosis. Pediatr Blood Cancer 2005.
59. Geleff S, Schoppmann SF, Oberhuber G. Increase in Podoplanin-Expressing Intestinal Lymphantic Vessels in Inflammatory Bowl Disease. Virchows Arch 2003; 442: 231-7.
60. Chen L, Hamrah P, Cursiefen C, Zhang Q, Pytowski B, Streilein J, et al. Vascular Endothelial Growth Factor Receptor 3 Mediates Induction of Corneal
Alloimmunity. Nat Med 2004; 10: 813-5.
61. He Y, Karpanen T, Alitalo K. Role of Lymphangiogenic Factors in Tumor Metastasis. Biochim Biophys Acta 2004; 1654(1): 3-12.
62. Kubo H, Cao R, Brakenhielm E, Makinen T, Cao Y, Alitalo K. Blockade of Vascular Endothelial Growth Factor Receptor-3 Signaling Inhibits Fibroblast Growth Factor-2-Induced Lymphangiogenesis in Mouse Cornea. Proc Natl Acad Sci U S A 2002; 99(13): 8868-73.
63. Shimizu K, Kubo H, Yamaguchi K et al. Suppression of VEGFR-3 Signaling Inhibits Lymph Node Metastasis in Gastric Cancer. Cancer Sci 2004; 95(4): 328-33.
64. Padera TP, Kuo AH, Hoshida T et al. Differential Response of Primary Tumor Versus Lymphatic Metastasis to VEGFR-2 and VEGFR-3 Kinase Inhibitors Cediranib and Vandetanib. Mol Cancer Ther 2008.
65. Hoshida T, Isaka N, Hagendoorn J et al. Imaging Steps of Lymphatic Metastasis
66. Sugaya M, Watanabe T, Yang A et al. Lymphatic Dysfunction in Transgenic Mice Expressing KSHV K-Cyclin Under the Control of the VEGFR-3 Promoter. Blood 2005; 105(6): 2356-63.
67. Witte D, Thomas A, Ali N, Carlson N, Younes M. Expression of the Vascular Endothelial Growth Factor Receptor-3 (VEGFR-3) and Its Ligand VEGF-C in Human Colorectal Adenocarcinoma. Anticancer Res 2002; 22(3): 1463-6.
68. Jennbacken K, Vallbo C, Wang W, Damber JE. Expression of Vascular Endothelial Growth Factor C (VEGF-C) and VEGF Receptor-3 in Human
Prostate Cancer Is Associated With Regional Lymph Node Metastasis. Prostate 2005; 65(2): 110-6.
69. Zeng Y, Opeskin K, Baldwin ME et al. Expression of Vascular Endothelial Growth Factor Receptor-3 by Lymphatic Endothelial Cells Is Associated With Lymph Node Metastasie in Prostate Cancer. Clin Cancer Res 2004; 10: 5137-44.
70. He Y, Kozaki K, Karpanen T et al. Suppression of Tumor Lymphangiogenesis and Lymph Node Metastasis by Blocking Vascular Endothelial Growth Factor Receptor 3 Signaling. J Natl Cancer Inst 2002; 94(11): 819-25.
71. Kojima H, Shijubo N, Yamada G, Ichimiya S, Abe S, Satoh M, Sato N. Clinical Significance of Vascular Endothelial Growth Factor-C and Vascular Endothelial Growth Factor Receptor 3 in Patients With T1 Lung Adenocarcinoma. Cancer 2005; 104(8): 1668-77.
72. Hong YK, Foreman K, Shin JW et al. Lymphatic Reprogramming of Blood Vascular Endothelium by Kaposi Sarcoma-Associated Herpesvirus. Nat Genet 2004; 36(7): 683-5.
73. Jüttner S, Wissmann C, Jöns T et al.Vascular Endothelial Growth Factor-D and Its Receptor VEGFR-3: Two Novel Independent Prognostic Markers in Gastric Adenocarcinoma. JCO 2004.
74. Li R, Younes M, Wheeler TM, Scardino P, Ohori M, Frolov A, Ayala G.
Expression of Vascular Endothelial Growth Factor Receptor-3 (VEGFR-3) in Human Prostate. Prostate 2004; 58(2): 193-9.
75. Gunningham SP, Currie MJ, Han C et al.The Short Form of the Alternatively Spliced Flt-4 but Not Its Ligand Vascular Endothelial Growth Factor C Is Related to Lymph Node Metastasis in Human Breast Cancers. Clin Cancer Res 2000;
6(11): 4278-86.
76. Krishnan J, Kirkin V, Steffen A et al. Differential in Vivo and in Vitro Expression of Vascular Endothelial Growth Factor (VEGF)-C and VEGF-D in Tumors and Its Relationship to Lymphatic Metastasis in Immunocompetent Rats. Cancer Res 2003; 63(3): 713-22.
77. He Y, Rajantie I, Pajusola K et al. Vascular Endothelial Cell Growth Factor Receptor 3-Mediated Activation of Lymphatic Endothelium Is Crucial for Tumor
Cell Entry and Spread Via Lymphatic Vessels. Cancer Res 2005; 65(11): 4739-46.
78. Yonemura Y, Fushida S, Bando E et al. Lymphangiogenesis and the Vascular Endothelial Growth Factor Receptor (VEGFR)-3 in Gastric Cancer. Eur J Cancer 2001; 37(7): 918-23.
79. Padera TP, Kadambi A, di Tomaso E et al. Lymphatic Metastasis in the Absence of Functional Intratumor Lymphatics. Science 2002; 296(5574): 1883-6.
80. Niki T, Iba S, Tokunou M, Yamada T, Matsuno Y, Hirohashi S. Expression of Vascular Endothelial Growth Factors A, B, C, and D and Their Relationships to Lymph Node Status in Lung Adenocarcinoma. Clin Cancer Res 2000; 6(6): 2431-9.
81. Valtola R, Salven P, Heikkila P et al. VEGFR-3 and Its Ligand VEGF-C Are Associated With Angiogenesis in Breast Cancer. Am J Pathol 1999; 154(5):
1381-90.
82. Stacker SA, Baldwin ME, Achen MG. The Role of Tumor Lymphangiogenesis in Metastatic Spread. FASEB J 2002; 16(9): 922-34.
83. Partanen TA, Arola J, Saaristo A et al. VEGF-C and VEGF-D Expression in Neuroendocrine Cells and Their Receptor, VEGFR-3, in Fenestrated Blood Vessels in Human Tissues. FASEB J 2000; 14(13): 2087-96.
84. Su JL, Yen CJ, Chen PS et al. The Role of the VEGF-C/VEGFR-3 Axis in Cancer Progression. Br J Cancer 2007; 96(4): 541-5.
85. Clarijs R, Schalkwijk L, Hofmann UB, Ruiter DJ, de Waal RM. Induction of Vascular Endothelial Growth Factor Receptor-3 Expression on Tumor Microvasculature As a New Progression Marker in Human Cutaneous Melanoma. Cancer Res 2002; 62(23): 7059-65.
86. Kamba T, Tam BY, Hashizume H et al. VEGF-Dependent Plasticity of
Fenestrated Capillaries in the Normal Adult Microvasculature. Am J Physiol Heart Circ Physiol 2006; 290(2): H560-H576.
87. Kubo H, Fujiwara T, Jussila L et al. Involvement of Vascular Endothelial Growth Factor Receptor-3 in Maintenance of Integrity of Endothelial Cell Lining During Tumor Angiogenesis. Blood 2000; 96(2): 546-53.
88. Hirakawa S, Hong YK, Harvey N, Schacht V, Matsuda K, Libermann T, Detmar M. Identification of Vascular Lineage-Specific Genes by Transcriptional Profiling of Isolated Blood Vascular and Lymphatic Endothelial Cells. Am J Pathol 2003;
162(2): 575-86.
89. Hong YK, Lange-Asschenfeldt B, Velasco P et al.VEGF-A Promotes Tissue
90. Kunstfeld R, Hirakawa S, Hong YK et al. Induction of Cutaneous Delayed-Type Hypersensitivity Reactions in VEGF-A Transgenic Mice Results in Chronic Skin Inflammation Associated With Persistent Lymphatic Hyperplasia. Blood 2004.
91. Neuchrist C, Erovic BM, Handisurya A et al. Vascular Endothelial Growth Factor C and Vascular Endothelial Growth Factor Receptor 3 Expression in Squamous Cell Carcinomas of the Head and Neck. Head Neck 2003; 25(6): 464-74.
92. Van Trappen PO, Steele D, Lowe DG et al. Expression of Vascular Endothelial Growth Factor (VEGF)-C and VEGF-D, and Their Receptor VEGFR-3, During Different Stages of Cervical Carcinogenesis. J Pathol 2003; 201(4): 544-54.
93. Yokoyama Y, Charnock-Jones DS, Licence D et al. Expression of Vascular Endothelial Growth Factor (VEGF)-D and Its Receptor, VEGF Receptor 3, As a Prognostic Factor in Endometrial Carcinoma. Clin Cancer Res 2003; 9(4): 1361-9.
94. Iljin K, Karkkainen MJ, Lawrence EC et al. VEGFR3 Gene Structure, Regulatory Region, and Sequence Polymorphisms. FASEB J 2001; 15(6): 1028-36.
95. Karkkainen MJ, Petrova TV. Vascular Endothelial Growth Factor Receptors in the Regulation of Angiogenesis and Lymphangiogenesis. Oncogene 2000;
19(49): 5598-605.
96. Fournier E, Rosnet O, Marchetto S et al. Interaction With the Phosphotyrosine Binding Domain/Phosphotyrosine Interacting Domain of SHC Is Required for the Transforming Activity of the FLT4/VEGFR3 Receptor Tyrosine Kinase. J Biol Chem 1996; 271(22): 12956-63.
97. Fournier E, Dubreuil P, Birnbaum D, Borg JP. Mutation at Tyrosine Residue 1337 Abrogates Ligand-Dependent Transforming Capacity of the FLT4 Receptor.
Oncogene 1995; 11(5): 921-31.
98. Pajusola K, Aprelikova O, Pelicci G, Weich H, Claesson-Welsh L, Alitalo K.
Signalling Properties of FLT4, a Proteolytically Processed Receptor Tyrosine Kinase Related to Two VEGF Receptors. Oncogene 1994; 9(12): 3545-55.
99. Wang JF, Zhang X, Groopman JE. Activation of Vascular Endothelial Growth Factor Receptor-3 and Its Downstream Signaling Promote Cell Survival Under Oxidative Stress. J Biol Chem 2004; 279(26): 27088-97.
100. Iljin K, Dube A, Kontusaari S, Korhonen J, Lahtinen I, Oettgen P, Alitalo K. Role of Ets Factors in the Activity and Endothelial Cell Specificity of the Mouse Tie Gene Promoter. FASEB J 1999; 13(2): 377-86.
101. Kondo K, Hiratsuka S, Subbalakshmi E, Matsushime H, Shibuya M. Genomic Organization of the Flt-1 Gene Encoding for Vascular Endothelial Growth Factor (VEGF) Receptor-1 Suggests an Intimate Evolutionary Relationship Between the 7-Ig and the 5-Ig Tyrosine Kinase Receptors. Gene 1998; 208(2): 297-305.
102. Moller B, Rasmussen C, Lindblom B, Olovsson M. Expression of the Angiogenic Growth Factors VEGF, FGF-2, EGF and Their Receptors in Normal Human Endometrium During the Menstrual Cycle. Mol Hum Reprod 2001; 7(1): 65-72.
103. Moller B, Ronnerdag M, Wang G, Odlind V, Olovsson M. Expression of Vascular Endothelial Growth Factors and Their Receptors in Human Endometrium From Women Experiencing Abnormal Bleeding Patterns After Prolonged Use of a Levonorgestrel-Releasing Intrauterine System. Hum Reprod 2005; 20(5): 1410-7.
104. Fink L, Seeger W, Ermert L et al. Real-Time Quantitative RT-PCR After Laser-Assisted Cell Picking. Nat Med 1998; 4(11): 1329-33.
105. Nordeen SK. Luciferase Reporter Gene Vectors for Analysis of Promoters and Enhancers. Biotechniques 1988; 6(5): 454-8.
106. Schäfer G, Cramer T, Suske G, Kemmner W, Wiedenmann B, Höcker M.
Oxidative Stress Regulates Vascular Endothelial Growth Factor-A Gene
Transcription Through Sp1- and Sp3-Dependent Activation of Two Proximal GC-Rich Promoter Elements. J Biol Chem 2003; 278(10): 8190-8.
107. Suske G. The Sp-Family of Transcription Factors. Gene 1999; 238(2): 291-300.
108. Philipsen S, Suske G. A Tale of Three Fingers: the Family of Mammalian Sp/XKLF Transcription Factors. Nucleic Acids Res 1999; 27(15): 2991-3000.
109. Jiang JG, DeFrances MC, Machen J, Johnson C, Zarnegar R. The Repressive Function of AP2 Transcription Factor on the Hepatocyte Growth Factor Gene Promoter. Biochem Biophys Res Commun 2000; 272(3): 882-6.
110. Black AR, Black JD, Azizkhan-Clifford J. Sp1 and Kruppel-Like Factor Family of Transcription Factors in Cell Growth Regulation and Cancer. J Cell Physiol 2001;
188(2): 143-60.
111. Jackson TA, Taylor HE, Sharma D, Desiderio S, Danoff SK. Vascular Endothelial Growth Factor Receptor-2: Counter-Regulation by the Transcription Factors, TFII-I and TFII-IRD1. J Biol Chem 2005; 280(33): 29856-63.
112. Hata Y, Duh E, Zhang K, Robinson GS, Aiello LP. Transcription Factors Sp1 and Sp3 Alter Vascular Endothelial Growth Factor Receptor Expression Through a Novel Recognition Sequence. J Biol Chem 1998; 273(30): 19294-303.
113. Chilov D, Kukk E, Taira S et al. Genomic Organization of Human and Mouse Genes for Vascular Endothelial Growth Factor C. J Biol Chem 1997; 272(40):
25176-83.
114. Grillot DA, Gonzalez-Garcia M, Ekhterae D et al. Genomic Organization, Promoter Region Analysis, and Chromosome Localization of the Mouse Bcl-x Gene. J Immunol 1997; 158(10): 4750-7.
115. Ikeda T, Wakiya K, Shibuya M. Characterization of the Promoter Region for Flt-1 Tyrosine Kinase Gene, a Receptor for Vascular Endothelial Growth Factor.
Growth Factors 1996; 13(3-4): 151-62.
116. Finkenzeller G, Sparacio A, Technau A, Marme D, Siemeister G. Sp1
Recognition Sites in the Proximal Promoter of the Human Vascular Endothelial Growth Factor Gene Are Essential for Platelet-Derived Growth Factor-Induced Gene Expression. Oncogene 1997; 15(6): 669-76.
117. Jimenez SK, Sheikh F, Jin Y et al.Transcriptional Regulation of FGF-2 Gene Expression in Cardiac Myocytes. Cardiovasc Res 2004; 62(3): 548-57.
118. Luster TA, Rizzino A. Regulation of the FGF-4 Gene by a Complex Distal Enhancer That Functions in Part As an Enhanceosome. Gene 2003; 323: 163-72.
119. Xie K, Wei D, Huang S. Transcriptional Anti-Angiogenesis Therapy of Human Pancreatic Cancer. Cytokine Growth Factor Rev 2006; 17(3): 147-56.
120. Kageyama R, Merlino GT, Pastan I. Epidermal Growth Factor (EGF) Receptor Gene Transcription. Requirement for Sp1 and an EGF Receptor-Specific Factor.
J Biol Chem 1988; 263(13): 6329-36.
121. Shin TH, Paterson AJ, Grant JH, III, Meluch AA, Kudlow JE. 5-Azacytidine Treatment of HA-A Melanoma Cells Induces Sp1 Activity and Concomitant Transforming Growth Factor Alpha Expression. Mol Cell Biol 1992; 12(9): 3998-4006.
122. Zhang X, Li Y, Dai C, Yang J, Mundel P, Liu Y. Sp1 and Sp3 Transcription Factors Synergistically Regulate HGF Receptor Gene Expression in Kidney. Am J Physiol Renal Physiol 2003; 284(1): F82-F94.
123. Sorensen P, Wintersberger E. Sp1 and NF-Y Are Necessary and Sufficient for Growth-Dependent Regulation of the Hamster Thymidine Kinase Promoter. J Biol Chem 1999; 274(43): 30943-9.
124. Kutoh E, Margot JB, Schwander J. Identification and Characterization of the Putative Retinoblastoma Control Element of the Rat Insulin-Like Growth Factor Binding Protein-2 Gene. Cancer Lett 1999; 136(2): 187-94.
125. Spencer JA, Misra RP. Expression of the SRF Gene Occurs Through a Ras/Sp/SRF-Mediated-Mechanism in Response to Serum Growth Signals.
Oncogene 1999; 18(51): 7319-27.
126. Dong L, Wang W, Wang F et al. Mechanisms of Transcriptional Activation of Bcl-2 Gene Expression by 17beta-Estradiol in Breast Cancer Cells. J Biol Chem 1999; 274(45): 32099-107.
127. Li F, Altieri DC. Transcriptional Analysis of Human Survivin Gene Expression.
Biochem J 1999; 344 Pt 2: 305-11.