Statistical analyses were performed using R software (v 3.1.0) (R Core Team, 2013).
Seedling development: To test whether genotypes differed in their responses to high temperature, and whether the genotypes’ responses differed dependent on the presence or absence of sucrose, linear mixed models were used as implemented in the lmer function in the lme4 package of the R software (Bates et al., 2014). The fixed part of the model included temperature (22°C vs. 30°C), medium (with vs. without sucrose) and genotype (WT, Δdeg10-1 and Δcat3-1), and all possible interactions. The random part of the model included plate and thermostat. Models with a binomial error term were used for seedling establishment and continuous development until day 18, a Poisson error term for the number of rosette leaves at day 10, and a Gaussian error term for primary root length at day 18. Then, post-hoc Tukey contrasts were used to test for differences between each of the genotype-treatment combinations through the glht function in the multcomp package (Hothorn et al., 2008).
Vegetative and reproductive growth: Linear mixed models were applied using the lme function in the nlme package (Pinheiro et al., 2015), in which the fixed part of the model included genotype and the random part included plant. Where appropriate, data was transformed to improve residual structure (Table 5 and Table 6).
A Appendix 85
A Appendix
Figure S 1: Mitochondrial localization of DEG10-GFP in vivo: Confocal fluorescence pictures of MitoTracker stained protoplasts isolated from two additional, independently transformed DEG10-GFP expressing plants (2&3) (a-e) or wildtype plants (WT) (f-j). The pictures are false-colored, both MitoTracker and Chl signals are depicted in red for a better visualization of co-localization in merged pictures. (a+f) green fluorescence (497 nm to 550 nm); (b+g): MitoTracker Orange (572 nm to 615 nm, depicted in red);(c+h) merge of GFP (green) and MitoTracker (red) fluorescence showing overlap (orange to yellow) of the most intense GFP signals with stained mitochondria except for some cases in which the mitochondria moved slightly between acquisition of the two pictures; (d+i) merge of GFP (green) and chlorophyll (Chl) auto-fluorescence (657 nm to 690 nm, depicted in red) showing very similar intensity ratios in WT and DEG10-GFP-expressing protoplasts; (e+j) merge of Chl auto-fluorescence (red) and a bright field image. In each panel, offset, gain and contrast settings are identical for DEG10-GFP expressing and WT protoplasts. Scale bars represent 5 µm.
86 A Appendix
Table S 1: Primers used for PCR reactions to characterize the Δdeg10-1 and Δcat3-1 T-DNA insertion mutants. Primers 17-22 are control primers, which were used pairwise in the order indicated
Number Namea Sequence 5´- 3´
1 CAT3-LP-1 AGCTATGCAGCGTCAAGCTTC 2 CAT3-LP-2 GCCCGTTTGTTCCGCTTTTGC 3 CAT3-LP-3 TGGGATTTCGCTCCTGCTTTGT 4 CAT3-RP-1 AGTCGCCAGATTCAACATAGTC 5 CAT3-RP-2 TGTAAATGCAACAAGTGTCCCGA 6 CAT3-RP-3 TTAAGCCAAAGAATGTCCAGAAGTGC 7 DEG10-LP-1 GCAATGATGTCTCGCCATTTATG 8 DEG10-LP-2 CAACGCACGCAGGTTCC
9 DEG10-LP-3 GTGCATCAATTTGATCAGCTTCC 10 DEG10-LP-4 ATGCTGCTCCGGTCATTTCGC 11 DEG10-RP-1 CATTGGAACAAGAGATGGTAATG 12 DEG10-RP-2 TCAAACCGCAGAACAAGAAGCC 13 DEG10-RP-3 CCACTACGAAGTTCACCATTCTCC 14 DEG10-RP-4 CTAGCTCCAAAGCATTCATACC 15 T-DNA-LB-1 TTCGGAACCACCATCAAACAG 16 T-DNA-RB-1 CAGACGTGAAACCCAACATAC
17 OAT-f AGTCTTGGATTAACTTAGGAGAG
18 OAT-r GTTCATAGGAAGCACCATATC
19 ProDH1-f TCTCCTCTATCCCAACCTCTG 20 ProDH1-r CGCAATCCCGGCGATTAATCTC 21 P5CR-f CACCATAATGGAGATTCTTCCGATTCC
22 P5CR-r TGTGAGGTGAAACAATAGCAG
aOAT = ornithine-δ-amino-transferase; ProDH1 = proline dehydrogenase 1; P5CR = pyrroline-5-carboxylate reductase; LP primers are orientated in the same direction as DEG10 and CAT3 transcription, while RP primers bind to the sense strand.
Publication 87
Publication
This thesis is based on the following manuscript:
Catharina V. Huber, Barbara Jakobs, Marc Stift, Gudrun Winter, Christiane Funk, Iwona Adamska, Pitter F. Huesgen, Dietmar Funck (2015). The mitochondrial protease DEG10 is important for root growth and seed yield in Arabidopsis. New Phytologist, MS-2015-20751, Submission date: 23.10.2015.
Author contributions 89
Author contributions
Unless stated otherwise, the experiments in this thesis were performed by myself or under my direct supervision. I analyzed the data sets and drafted the manuscript. In the project planning were involved Prof. Dr. Iwona Adamska, Dr. Dietmar Funck and Dr. Pitter Huesgen.
Chapter 2.1: CLSM pictures were taken by Dr. Gudrun Winter.
Chapter 2.2: Barbara Jakobs created Figure 10 in the context of her master thesis which was performed under my supervision. Dr. Bernard Lepetit was involved in the design and analysis of the qPCR experiments.
Chapter 2.3: TEM imaging and sample preparation were performed by the EM Center Konstanz. Prof. Dr. Christiane Funk and Patrik Storm (Umeå, Sweden) performed the experimental work of the field experiments and provided the pictures of Figure 22. Dr.
Marc Stift helped in the statistical analyses of the experiments for seedling development, vegetative and reproductive growth and provided the R script.
Chapter 2.4: Dr. Karlo Gasparic generated the deg10/deg14 double mutants. Dr. Bernard Lepetit was involved in the design and analysis of the qPCR experiments.
References 91
References
Agrawal GK, Bourguignon J, Rolland N, Ephritikhine G, Ferro M, Jaquinod M, Alexiou KG, Chardot T, Chakraborty N, Jolivet P, et al. 2011. Plant organelle proteomics: collaborating for optimal cell function. Mass Spectrom Rev 30(5): 772-853.
Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. 2002. Molecular Biology of the Cell. New York: Garland Science.
Albury MS, Elliott C, Moore AL. 2009. Towards a structural elucidation of the alternative oxidase in plants. Physiol Plant 137(4): 316-327.
Allorent G, Osorio S, Vu JL, Falconet D, Jouhet J, Kuntz M, Fernie AR, Lerbs-Mache S, Lerbs-Macherel D, Courtois F, et al. 2015. Adjustments of embryonic photosynthetic activity modulate seed fitness in Arabidopsis thaliana. New Phytol 205(2): 707-719.
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al. 2003. Genome-Wide Insertional Mutagenesis of Arabidopsis thaliana. Science 301(5633): 653-657.
Amm I, Sommer T, Wolf DH. 2014. Protein quality control and elimination of protein waste: the role of the ubiquitin-proteasome system. Biochim Biophys Acta 1843(1):
182-196.
Apel K, Hirt H. 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 55: 373-399.
Barceló AR. 1998. Hydrogen peroxide production is a general property of the lignifying xylem from vascular plants. Ann Bot 82(1): 97-103.
Barker M, de Vries R, Nield J, Komenda J, Nixon PJ. 2006. The deg proteases protect Synechocystis sp. PCC 6803 during heat and light stresses but are not essential for removal of damaged D1 protein during the photosystem two repair cycle. J Biol Chem 281(41): 30347-30355.
Basak I, Pal R, Patil KS, Dunne A, Ho HP, Lee S, Peiris D, Maple-Grodem J, Odell M, Chang EJ, et al. 2014. Arabidopsis AtPARK13, which confers thermotolerance, targets misfolded proteins. J Biol Chem 289(21): 14458-14469.
Bates D, Maechler M, Bolker B, Walker S. 2014. lme4: Linear mixed-effects models using Eigen and S4. R package version 1.1-7.
Baxter A, Mittler R, Suzuki N. 2014. ROS as key players in plant stress signalling. J Exp Bot 65(5): 1229-1240.
Ben-Zvi A, Miller EA, Morimoto RI. 2009. Collapse of proteostasis represents an early molecular event in Caenorhabditis elegans aging. Proc Natl Acad Sci U S A 106(35): 14914-14919.
Berg JM, Tymoczko JL, Stryer L. 2007. Biochemistry. New York: W. H. Freeman.
Birnbaum K, Shasha DE, Wang JY, Jung JW, Lambert GM, Galbraith DW, Benfey PN. 2003. A gene expression map of the Arabidopsis root. Science 302(5652):
1956-1960.
Blanco FJ, Rego I, Ruiz-Romero C. 2011. The role of mitochondria in osteoarthritis. Nat Rev Rheumatol 7(3): 161-169.
Blokhina O, Fagerstedt KV. 2010. Reactive oxygen species and nitric oxide in plant mitochondria: origin and redundant regulatory systems. Physiol Plant 138(4): 447-462.
92 References
Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Görlach J.
2001. Growth stage–based phenotypic analysis of Arabidopsis: A model for high throughput functional genomics in plants. The Plant Cell 13(7): 1499-1510.
Butaye KM, Goderis IJ, Wouters PF, Pues JM, Delaure SL, Broekaert WF, Depicker A, Cammue BP, De Bolle MF. 2004. Stable high-level transgene expression in Arabidopsis thaliana using gene silencing mutants and matrix attachment regions.
Plant J 39(3): 440-449.
Callis J, Browning KS, Spremulli L. 2015. Protein synthesis, folding and degradation. In:
Buchanan BB, Gruissem W, Jones RL eds. Biochemistry and molecular biology of plants. Chichester, UK: John Wiley and Sons.
Carpita NC, Ralph J, McCann M. 2015. The cell wall. In: Buchanan BB, Gruissem W, Jones RL eds. Biochemistry and molecular biology of plants. Chichester, UK: John Wiley and Sons.
Chaba R, Grigorova IL, Flynn JM, Baker TA, Gross CA. 2007. Design principles of the proteolytic cascade governing the sigmaE-mediated envelope stress response in Escherichia coli: keys to graded, buffered, and rapid signal transduction. Genes Dev 21(1): 124-136.
Chiti F, Dobson CM. 2006. Protein misfolding, functional amyloid, and human disease.
Annu Rev Biochem 75: 333-366.
Clausen T, Kaiser M, Huber R, Ehrmann M. 2011. HTRA proteases: regulated proteolysis in protein quality control. Nat Rev Mol Cell Biol 12(3): 152-162.
Clausen T, Southan C, Ehrmann M. 2002. The HtrA family of proteases: implications for protein composition and cell fate. Mol Cell 10(3): 443-455.
Clifton R, Lister R, Parker KL, Sappl PG, Elhafez D, Millar AH, Day DA, Whelan J.
2005. Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana. Plant Molecular Biology 58(2): 193-212.
Clifton R, Millar AH, Whelan J. 2006. Alternative oxidases in Arabidopsis: a comparative analysis of differential expression in the gene family provides new insights into function of non-phosphorylating bypasses. Biochim Biophys Acta 1757(7): 730-741.
Clough SJ, Bent AF. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal 16(6): 735-743.
Covington MF, Maloof JN, Straume M, Kay SA, Harmer SL. 2008. Global transcriptome analysis reveals circadian regulation of key pathways in plant growth and development. Genome Biol 9(8): R130.
Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR. 2005. Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiology 139(1): 5-17.
D'Arcy-Lameta A, Ferrari-Iliou R, Contour-Ansel D, Pham-Thi AT, Zuily-Fodil Y.
2006. Isolation and characterization of four ascorbate peroxidase cDNAs responsive to water deficit in cowpea leaves. Ann Bot 97(1): 133-140.
De Storme N, Geelen D. 2014. The impact of environmental stress on male reproductive development in plants: biological processes and molecular mechanisms. Plant Cell Environ 37(1): 1-18.
Duan Y, Zhang W, Li B, Wang Y, Li K, Sodmergen, Han C, Zhang Y, Li X. 2010. An endoplasmic reticulum response pathway mediates programmed cell death of root tip induced by water stress in Arabidopsis. New Phytol 186(3): 681-695.
Duchene AM, Giritch A, Hoffmann B, Cognat V, Lancelin D, Peeters NM, Zaepfel M, Marechal-Drouard L, Small ID. 2005. Dual targeting is the rule for organellar aminoacyl-tRNA synthetases in Arabidopsis thaliana. Proc Natl Acad Sci U S A 102(45): 16484-16489.
References 93
Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song KM, Pikaard CS. 2006.
Gateway-compatible vectors for plant functional genomics and proteomics. Plant Journal 45(4): 616-629.
Edwards K, Johnstone C, Thompson C. 1991. A simple and rapid method for the preparaton of plant genomic DNA for PCR analysis Nucleic Acids Research 19(6):
1349-1349.
Emanuelsson O, Nielsen H, Brunak S, von Heijne G. 2000. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300(4): 1005-1016.
Erhardt M. 2012. DEG proteases in Arabidopsis thaliana. Dissertation, Universität Konstanz, Konstanz.
Eubel H, Heazlewood JL, Millar AH. 2007. Isolation and subfractionation of plant mitochondria for proteomic analysis. In: Thiellement H, Zivy M, Damerval C, Mechin V eds. Methods in Molecular Biology, 49-62.
Fedyaeva AV, Stepanov AV, Lyubushkina IV, Pobezhimova TP, Rikhvanov EG.
2014. Heat shock induces production of reactive oxygen species and increases inner mitochondrial membrane potential in winter wheat cells. Biochemistry (Mosc) 79(11): 1202-1210.
Fernie AR, Carrari F, Sweetlove LJ. 2004. Respiratory metabolism: glycolysis, the TCA cycle and mitochondrial electron transport. Curr Opin Plant Biol 7(3): 254-261.
Franklin KA, Lee SH, Patel D, Kumar SV, Spartz AK, Gu C, Ye S, Yu P, Breen G, Cohen JD, et al. 2011. Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc Natl Acad Sci U S A 108(50): 20231-20235.
Frenkel M, Johansson Jänkänpää H, Moen J, Jansson S. 2008. An illustrated gardener's guide to transgenic Arabidopsis field experiments. New Phytologist 180(2): 545-555.
Friso G, Giacomelli L, Ytterberg AJ, Peltier JB, Rudella A, Sun Q, Wijk KJ. 2004. In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. Plant Cell 16(2): 478-499.
Fusconi A. 2014. Regulation of root morphogenesis in arbuscular mycorrhizae: what role do fungal exudates, phosphate, sugars and hormones play in lateral root formation?
Ann Bot 113(1): 19-33.
Gapper C, Dolan L. 2006. Control of plant development by reactive oxygen species.
Plant Physiol 141(2): 341-345.
Garcia-Lorenzo M, Sjodin A, Jansson S, Funk C. 2006. Protease gene families in Populus and Arabidopsis. BMC Plant Biol 6: 30.
Gasparic K. 2015. The DEG9 and DEG14 proteases in A. thaliana. Dissertation, Universität Konstanz, Konstanz.
Gibala M, Kicia M, Sakamoto W, Gola EM, Kubrakiewicz J, Smakowska E, Janska H. 2009. The lack of mitochondrial AtFtsH4 protease alters Arabidopsis leaf morphology at the late stage of rosette development under short-day photoperiod.
Plant Journal 59(5): 685-699.
Giraud E, Ho LH, Clifton R, Carroll A, Estavillo G, Tan YF, Howell KA, Ivanova A, Pogson BJ, Millar AH, et al. 2008. The absence of ALTERNATIVE OXIDASE1a in Arabidopsis results in acute sensitivity to combined light and drought stress.
Plant Physiol 147(2): 595-610.
Gray WM, Ostin A, Sandberg G, Romano CP, Estelle M. 1998. High temperature promotes auxin-mediated hypocotyl elongation in Arabidopsis. Proc Natl Acad Sci U S A 95(12): 7197-7202.
94 References
Gutiérrez-Alcalá G, Gotor C, Meyer AJ, Fricker M, Vega JM, Romero LC. 2000.
Glutathione biosynthesis in Arabidopsis trichome cells. Proc Natl Acad Sci U S A 97(20): 11108-11113.
Hanzawa T, Shibasaki K, Numata T, Kawamura Y, Gaude T, Rahman A. 2013.
Cellular auxin homeostasis under high temperature is regulated through a sorting NEXIN1-dependent endosomal trafficking pathway. Plant Cell 25(9): 3424-3433.
Haussuehl K, Huesgen PF, Meier M, Dessi P, Glaser E, Adamski J, Adamska I. 2009.
Eukaryotic GCP1 is a conserved mitochondrial protein required for progression of embryo development beyond the globular stage in Arabidopsis thaliana.
Biochemical Journal 423: 333-341.
Haußühl K, Andersson B, Adamska I. 2001. A chloroplast DegP2 protease performs the primary cleavage of the photodamaged D1 protein in plant photosystem II. Embo j 20(4): 713-722.
Helm M, Luck C, Prestele J, Hierl G, Huesgen PF, Frohlich T, Arnold GJ, Adamska I, Gorg A, Lottspeich F, et al. 2007. Dual specificities of the glyoxysomal/peroxisomal processing protease Deg15 in higher plants. Proc Natl Acad Sci U S A 104(27): 11501-11506.
Honys D, Twell D. 2004. Transcriptome analysis of haploid male gametophyte development in Arabidopsis. Genome Biol 5(11): R85.
Horn R, Gupta KJ, Colombo N. 2014. Mitochondrion role in molecular basis of cytoplasmic male sterility. Mitochondrion 19 Pt B: 198-205.
Hothorn T, Bretz F, Westfall P. 2008. Simultaneous Inference in General Parametric
OsAP65, a rice aspartic protease, is essential for male fertility and plays a role in pollen germination and pollen tube growth. J Exp Bot 64(11): 3351-3360.
Huang W, Yu C, Hu J, Wang L, Dan Z, Zhou W, He C, Zeng Y, Yao G, Qi J, et al.
2015. Pentatricopeptide-repeat family protein RF6 functions with hexokinase 6 to rescue rice cytoplasmic male sterility. Proc Natl Acad Sci U S A 10.1073/pnas.1511748112.
Huesgen PF. 2007. Functional genomics of Deg and GCP proteases in photosynthetic organisms. Dissertation, Universität Konstanz, Konstanz.
Huesgen PF, Miranda H, Lam X, Perthold M, Schuhmann H, Adamska I, Funk C.
2011. Recombinant Deg/HtrA proteases from Synechocystis sp. PCC 6803 differ in substrate specificity, biochemical characteristics and mechanism. Biochem J 435(3): 733-742.
Huesgen PF, Schuhmann H, Adamska I. 2006. Photodamaged D1 protein is degraded in Arabidopsis mutants lacking the Deg2 protease. FEBS Lett 580(30): 6929-6932.
Ivanova A, Law SR, Narsai R, Duncan O, Lee JH, Zhang B, Van Aken O, Radomiljac JD, van der Merwe M, Yi K, et al. 2014. A functional antagonistic relationship between auxin and mitochondrial retrograde signaling regulates Alternative Oxidase1a expression in Arabidopsis. Plant Physiol 165(3): 1233-1254.
Jacoby RP, Li L, Huang S, Pong Lee C, Millar AH, Taylor NL. 2012. Mitochondrial composition, function and stress response in plants. J Integr Plant Biol 54(11): 887-906.
Jakobs BD. 2015. Characterization of the physiological function of the mitochondrial protease DEG10 in Arabidopsis thaliana. Master thesis, Universität Konstanz, Konstanz.
References 95
Jakoby MJ, Falkenhan D, Mader MT, Brininstool G, Wischnitzki E, Platz N, Hudson A, Hulskamp M, Larkin J, Schnittger A. 2008. Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. Plant Physiol 148(3): 1583-1602.
Jefferson RA, Kavanagh TA, Bevan MW. 1987. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. Embo j 6(13): 3901-3907.
Jia F, Wan X, Zhu W, Sun D, Zheng C, Liu P, Huang J. 2015. Overexpression of mitochondrial phosphate transporter 3 severely hampers plant development through regulating mitochondrial function in Arabidopsis. PLoS One 10(6): e0129717.
Kapri-Pardes E, Naveh L, Adam Z. 2007. The thylakoid lumen protease Deg1 is involved in the repair of photosystem II from photoinhibition in Arabidopsis. Plant Cell 19(3): 1039-1047.
Karimi M, Inze D, Depicker A. 2002. GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7(5): 193-195.
Kavita P, Burma PK. 2008. A comparative analysis of green fluorescent protein and beta-glucuronidase protein-encoding genes as a reporter system for studying the temporal expression profiles of promoters. J Biosci 33(3): 337-343.
Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ. 2015. The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10(6): 845-858.
Kerchev PI, De Clercq I, Denecker J, Mühlenbock P, Kumpf R, Nguyen L, Audenaert D, Dejonghe W, Van Breusegem F. 2014. Mitochondrial perturbation negatively affects auxin signaling. Mol Plant 7(7): 1138-1150.
Kitazaki K, Arakawa T, Matsunaga M, Yui-Kurino R, Matsuhira H, Mikami T, Kubo T. 2015. Post-translational mechanisms are associated with fertility restoration of cytoplasmic male sterility in sugar beet (Beta vulgaris). Plant J 83(2):
290-299.
Kleinboelting N, Huep G, Kloetgen A, Viehoever P, Weisshaar B. 2012. GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.
Nucleic Acids Research 40(D1): D1211-D1215.
Kristen U. 1997. Use of higher plants as screens for toxicity assessment. Toxicol In Vitro 11(1-2): 181-191.
Kuromori T, Takahashi S, Kondou Y, Shinozaki K, Matsui M. 2009. Phenome analysis in plant species using loss-of-function and gain-of-function mutants. Plant and Cell Physiology 50(7): 1215-1231.
Kwasniak M, Pogorzelec L, Migdal I, Smakowska E, Janska H. 2012. Proteolytic system of plant mitochondria. Physiol Plant 145(1): 187-195.
Laemmli UK. 1970. Cleavage of structural proteins during assembly of head of bacteriophage T4. Nature 227(5259): 680-685.
Larkindale J, Vierling E. 2008. Core genome responses involved in acclimation to high temperature. Plant Physiol 146(2): 748-761.
LeCLere S, Schmelz EA, Chourey PS. 2010. Sugar levels regulate tryptophan-dependent auxin biosynthesis in developing maize kernels. Plant Physiol 153(1): 306-318.
Lipinska B, Fayet O, Baird L, Georgopoulos C. 1989. Identification, characterization, and mapping of the Escherichia coli htrA gene, whose product is essential for bacterial growth only at elevated temperatures. J Bacteriol 171(3): 1574-1584.
Lister R, Chew O, Lee MN, Heazlewood JL, Clifton R, Parker KL, Millar AH, Whelan J. 2004. A transcriptomic and proteomic characterization of the Arabidopsis mitochondrial protein import apparatus and its response to mitochondrial dysfunction. Plant Physiol 134(2): 777-789.
96 References
Liszkay A, van der Zalm E, Schopfer P. 2004. Production of reactive oxygen intermediates O2-, H2O2 and .OH by maize roots and their role in wall loosening and elongation growth. Plant Physiol 136(2): 3114-3123; discussion 3001.
Ljung K, Nemhauser JL, Perata P. 2015. New mechanistic links between sugar and hormone signalling networks. Curr Opin Plant Biol 25: 130-137.
López-Bucio J, Cruz-Ramirez A, Herrera-Estrella L. 2003. The role of nutrient availability in regulating root architecture. Curr Opin Plant Biol 6(3): 280-287.
Marks MD, Wenger JP, Gilding E, Jilk R, Dixon RA. 2009. Transcriptome analysis of Arabidopsis wild-type and gl3-sst sim trichomes identifies four additional genes required for trichome development. Mol Plant 2(4): 803-822.
Meeuse BJD. 1975. Thermogenic respiration in Aroids. Annu Rev Plant Physiol Plant Mol Biol 26: 117-126.
Meinke DW, Cherry JM, Dean C, Rounsley SD, Koornneef M. 1998. Arabidopsis thaliana: a model plant for genome analysis. Science 282(5389): 662, 679-682.
Meyer P. 2000. Transcriptional transgene silencing and chromatin components. Plant Mol Biol 43(2-3): 221-234.
Millar AH, Liddell A, Leaver CJ. 2007. Isolation and subfractionation of mitochondria from plants. In: Pon LA, Schon EA eds. Methods in Cell Biology, 2nd Edition:
Elsevier, 65-90.
Millar AH, Siedow JN, Day D. 2015. Respiration and photorespiration. In: Buchanan BB, Gruissem W, Jones RL eds. Biochemistry and molecular biology of plants.
Chichester, UK: John Wiley and Sons.
Mishra BS, Singh M, Aggrawal P, Laxmi A. 2009. Glucose and auxin signaling interaction in controlling Arabidopsis thaliana seedlings root growth and development. PLoS One 4(2): e4502.
Mitschke J, Fuss J, Blum T, Hoglund A, Reski R, Kohlbacher O, Rensing SA. 2009.
Prediction of dual protein targeting to plant organelles. New Phytol 183(1): 224-235.
Mogg U. 2014. Lokalisierung und physiologische Charakterisierung der Serinprotease DEG7 in Arabidopsis thaliana. Dissertation, Universität Konstanz, Konstanz.
Ng S, De Clercq I, Van Aken O, Law SR, Ivanova A, Willems P, Giraud E, Van Breusegem F, Whelan J. 2014. Anterograde and retrograde regulation of nuclear genes encoding mitochondrial proteins during growth, development, and stress.
Mol Plant 7(7): 1075-1093.
Padmanabhan N, Fichtner L, Dickmanns A, Ficner R, Schulz JB, Braus GH. 2009.
The yeast HtrA orthologue Ynm3 is a protease with chaperone activity that aids survival under heat stress. Mol Biol Cell 20(1): 68-77.
Pahlavanian AM, Silk WK. 1988. Effect of temperature on spatial and temporal aspects of growth in the primary maize root. Plant Physiol 87(2): 529-532.
Pan X, Chen Z, Yang X, Liu G. 2014. Arabidopsis voltage-dependent anion channel 1 (AtVDAC1) is required for female development and maintenance of mitochondrial functions related to energy-transaction. PLoS One 9(9): e106941.
Pattanaik S, Patra B, Singh SK, Yuan L. 2014. An overview of the gene regulatory network controlling trichome development in the model plant, Arabidopsis. Front Plant Sci 5: 259.
Pendle AF, Clark GP, Boon R, Lewandowska D, Lam YW, Andersen J, Mann M, Lamond AI, Brown JW, Shaw PJ. 2005. Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. Mol Biol Cell 16(1): 260-269.
Pfaffl MW, Horgan GW, Dempfle L. 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30(9): e36.
References 97
Pinheiro J, Bates D, DebRoy S, Sarkar D, R Core Team. 2015. Linear and Nonlinear Mixed Effects Models.
Polidoros AN, Mylona PV, Arnholdt-Schmitt B. 2009. Aox gene structure, transcript variation and expression in plants. Physiol Plant 137(4): 342-353.
Ponting CP. 1997. Evidence for PDZ domains in bacteria, yeast, and plants. Protein Sci 6(2): 464-468.
R Core Team 2013. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing.
Raghavendra AS, Padmasree K. 2003. Beneficial interactions of mitochondrial metabolism with photosynthetic carbon assimilation. Trends Plant Sci 8(11): 546-553.
Raimundo N. 2014. Mitochondrial pathology: stress signals from the energy factory.
Raimundo N. 2014. Mitochondrial pathology: stress signals from the energy factory.