Enzymes

Antarctic phosphatase New England Biolabs, Ibswich (USA)

Benzonase Merck, Darmstadt

Digestion enzymes New England Biolabs, Ibswich (USA) DNase, 10x DNase buffer New England Biolabs, Ibswich (USA)

Dpn1 New England Biolabs, Ibswich (USA)

MuLV reverse transcriptase Applied Biosystems, Darmstadt Pfu Polymerase II Stratagene, La Jolla (USA)

Proteinase K Invitrogen, Karlsruhe

T4-DNA-ligase and 10x buffer New England Biolabs, Ibswich (USA) 7.1.6 Primers and other oligomers

Oligonucleotides sequences were designed with the help of DNASTAR Lasergene 7 and were ordered from MWG, Ebersberg. The primer sequences used are listed in 7.2.2 or described when needed. Morpholino oligomers were obtained from GeneTools, LLC, Philomath (USA).

7.1.7 Plasmids obtained from different sources

For detailed informations plasmid cards are available at 8.3 except plasmids described in indicated publications or obtained from indicated people.

DBD Gal4 null Judd Rice [168]

pBluescript XL007a18 NIBB, Okazaki pBluescript XL213m10 NIBB, Okazaki pcDNA3.1 (-) myc His Invitrogen, Karlsruhe

pcDNA3.1 (+) hCDYL1a Flag HA Wolfgang Fischle [95]

pcDNA3.1(+) Invitrogen, Karlsruhe

pCMV Renilla Judd Rice [168]

pCS2+ Imagene (RZPD), Berlin

pCS2+ lacZ Annette Borchers [170]

pET11a New England Biolabs, Ibswich (USA)

UAS TK Judd Rice [168]

7.1.8 Bacteria

Escherichia coli BL21 (DE3) RIL (Stratagene, La Jolla) und DH5 (Invitrogen, Karlsruhe).

7.1.9 Cell lines

Origin Organism Medium Reference

HEK293 Embryonic Kidney

Human DMEM Wolfgang Fischle

HeLaS3 Cervical cancer

Human DMEM Wolfgang Fischle

MEF Embryonic Fibroblasts

Mouse MEF Thomas Jenuwein

NIH3T3 Fibroblasts Mouse DMEM Wolfgang Fischle

7.1.10 Peptides

Peptides were obtained from the Griesinger department of the Max Planck Institute of biophysical Chemistry.

Name Histone (aa)

Peptide sequence Modification Label

H3unmod H3 1-20 MARTKQTARKSTGGKAPRKQ - Biotin C-term H3K9me3 H3 1-20 MARTKQTARKSTGGKAPRKQ K9me3 Biotin C-term

7.1.11 Software

KaleidaGraph Version 4.0 Synergy Software, Reading (USA)

Lasergene 7 DNASTAR, Madison (USA)

Microsoft Office Microsoft Cooperation (USA)

MicroWin MSE, Muenster

R a language for statistival computing R Foundation for Statistical Computing, Vienna (Austria)

7.1.12 Others

10 cm cell culture dish Greiner, Solingen

10 cm Petri dish Greiner, Solingen

15 cm cell culture dish Sarstedt, Sarstedt 6-well, 12-well, 24-well plates Greiner, Solingen

Amersham ECL Hyperfilms GE Healthcare, Buckinghamshire (UK)

Bioruptor Diogenode, Liége (Belgium)

Centrifuge 5415 R Eppendorf, Hamburg

Centrifuge 5810 R Eppendorf, Hamburg

Coverslips d=1 cm VWR, Poole (UK)

Cryo Freezing controller Nalgene, Ohio (USA)

Cryotubes Greiner, Solingen

Freezer -150°C Thermo Scientific, Braunschweig Freezer -80°C Thermo Scientific, Braunschweig

Gel Doc 2000 BIO-RAD, Muenchen

Gel dryer Model 583 BIO-RAD, Muenchen

Hereaus Heracell 240 Incubator Thermo Scientific, Braunschweig Hereaus Kelvitron Incubator Thermo Scientific, Braunschweig Homogenizer 2 ml (DOUNCE) VWR, Darmstadt

Kodak X OMAT 2000 proccessor Carestream Health, New York (USA)

Leica TCS SP5 Leica, Wetzlar

Microinjector (Picospritzer) Parker, Cleveland (USA)

Microscale Ted Pella Inc., Redding (USA)

Microscope Axiovert 40CFL Zeiss, Jena

Mini-PROTEAN 3 Cells BIO-RAD, Muenchen

Multitron shaker (Bacteria) HT Infors, Braunschweig

Nanodrop ND-1000 Peqlab, Erlangen

Neubauer chamber BRAND, Wertheim

Nitrocellulose membrane BIO-RAD, Muenchen

Optiplates Perkin Elmer, Shelton (USA)

Orbitrap Xl mass spectrometer Thermo Scientific, Braunschweig PCR machine epgradient S Eppendorf, Hamburg

PlateChameleon Hidex, Turku (Finnland)

Scanner Perfection V750 PRO Epson, Meerbusch Stuart Gyrorocker SSL3 Sigma, Steinheim Sub-Cell-GT Agarose gel

electrophoresis

BIO-RAD, Muenchen

Superfrost Ultra Plus slides Thermo Scientific, Braunschweig Thermomixer comfort Eppendorf, Hamburg

7.2 Molecular biological methods

7.2.1 Polymerase chain reaction (PCR)

hCDYL1b, CDYL1c, xlCDYL1b and hPRMT5 were amplified from EST clones (hCDYL1b Image clone: IMAGE:6140263, xlCDYL1b EST-clone: XL213m10 and hPRMT5 Image full length cDNA clone: IRAUp969D1078D) with the indicated primers (Table 7-1). For detailed sequences see chapter 8.1. The 50 l reaction volume contained 0.5 g template, 1xPfu Polymerase reaction buffer, 200 M dNTPs, 1 mM of each primer pair and 1l of Pfu Polymerase II. The mixture was incubated in the PCR machine with the following protocol: 2 min 94ºC; 5x (30 sec 94ºC, 1 min 55ºC, 2.5 min 72ºC); 25x (30 sec 94ºC, 1 min 60ºC, 2.5 min 72ºC); 10 min 72ºC.

7.2.2 Cloning

Target DNA was amplified by PCR with indicated primers (Table 7-1). PCR products as well as target vectors were digested with indicated enzymes according to NEB protocols [171].

Then the digested vectors were dephosphorylated with Antarctic Phosphatase (NEB protocols [171]). The digested products were purified by PCR purification Kit and the concentration was determined by Nanodrop measurements at 260 nm. Then the DNA was ligated with DNA-ligase according to NEB protocols [171]. E. coli DH5 bacteria cells were transformed with the ligated DNA [172] and plated on ampicillin agar plates. The agar plates were incubated overnight at 37ºC. Single colonies were picked and cultured in 5 ml LB medium at 37ºC overnight. Plasmid DNA was extracted by MiniPrep Kit and 500 ng were digested by the cloning enzymes [171]. The digest was loaded on a 1% agarose gel containing 0.01%

ethidiumbromide (v/v) separated by electrophoresis in TBE buffer (20 min, 100V) using the Sub-Cell-GT system. Gels were visualized with Gel Doc 2000. Plasmids showing the right insert sizes were sequenced by MWG (Ebersberg) or Seqlab (Göttingen) using company provided primers.

Table 7-1 Cloned plasmids

Indicated inserts were cloned into corresponding vector. Plasmids were used for production of recombinat proteins in E.coli (EC), transfection in cell culture (CC), Luciferase assays (LC), Morpholino tests (MT) and microinjection in Xenopus laevis embryos (MI).

Use Vector Primers (Sequence 5’-3’) Cloning

sites 5’-3’

5’UTR xlCDYL1b FLAG

MT pCS2+ xlCDYL1b_5UTR_for

tttttgcaggatccggaggaggccgagcacac xlCDYL1b_rev

BamHI XhoI

tcatcaatttttctttg

hCDYL1b hinge EC pET11a hCDYL1b_hinge_for

aaggttcatatggagagcacattgaccagaacaaac hCDYL1b_hinge_rev

ggccattggatccttagaacggagatgtacctttcccg

NdeI BamHI

hCDYL1c EC pET11a hCDYL1b_for

aaggttcatatggatgcattaacagccaatgg

MI pCS2+ xlCDYL1b_for

cctggaggatccatggcttcagaggaactctac

xlCDYL1b Gal4 CC DBD Gal4 xCDYL1b_Gal4_for BamHI

xCDYL1b_Gal4_rev

The target plasmid was amplified with the indicated primers (Table 7-2) with the same reaction mix as described in 7.2.1. The reaction was incubated in the PCR machine with the following protocol: 2 min 94ºC; 3x (30 sec 94ºC, 1 min 57ºC, 2 min 72ºC); 17x (30 sec 94ºC, 1 min 63ºC, 2 min 72ºC); 10 min 72ºC. The products was purified with the PCR purification kit and digested with Dpn1 using the NEB protocol [171]. Next the DNA was transformed into E.coli DH5, plated and analyzed as described before (7.2.2).

Table 7-2 Primers for mutagenesis

Target Mutagenesis primer (Sequence 5’-3’) hCDYL1b

7.3 Biochemical methods

7.3.1 SDS-PAGE and Western Blot

Acrylamide gels were poured as described [173] and were used for gel electrophoresis with the Mini-PROTEAN 3 Cells. Gels were run in SDS running buffer for 30 min, 35 mA. Then the gels were blotted on nitrocellulose membranes with MiniTrans-Blot® using Transferbuffer (1 h, 100V) analyzed by mass spectrometry or stained with Coomassie (compare with 7.3.2). The membranes were stained with Ponceau solution (5 min, RT). For removal of the Ponceau excess the membrane was washed 3x with PBST. Next the membrane was blocked for 1 h with PBST including 5% fat free milk powder at RT. Afterwards the membrane was incubated with PBST (5% milk) including FLAG, myc, Lamin B, TBP, CDYL or PRMT5 in a 1:1000 dilution for 1 h, RT. Then the membrane was washed 3x

rabbit conjugated to HRP in a 1:2000 dilution in PBST (5% milk) for 1 h, RT. Washing steps (3x, 10 min) with PBST removed excess of antibody solution. The membrane was developed with ECL plus and the signals detected with Amersham ECL Hyperfilms. The film was developed with the Kodak X OMAT.

7.3.2 Coomassie staining

To stain acrylamide gels the stacking gel was removed and the separating gel was stained for 10 min in Coomassie solution under constant luffing. To remove the backround the gel was then placed in Destaining solution for at least 1 h. Afterwards the gel was scanned with the Epson Scanner.

7.3.3 Mass spectrometry and analysis of the results

The mass spectrometry analysis was performed by the mass spectrometry facility of Dr.

Henning Urlaub at the Max Planck Institute of biophysical Chemistry. SDS PAGE gels were stained with Coommassie and entire gel lanes were cut into 23 slices of equal size. Proteins within the slices were digested according to Shevchenko et al. [174]. Peptides were extracted and analyzed by LC-coupled tandem MS on an Orbitrap Xl mass spectrometer (Thermo Fisher Scientific). CID fragment spectra were searched against NCBInr database using MASCOT as search engine. Output files were subtracted according to the gi-numbers (NCBI) of the found proteins with the help of the statistical program R (for details of programming compare with 8.4). Arbitrary cut-off values of at least 2 unique found peptides per protein were used.

7.3.4 Protein expression

Plasmids containing the DNA of the protein of interest were transformed into E.coli BL21 RIL as described [172] and plated on ampicillin agar plates for incubation overnight at 37°C.

Single colonies were picked and cultured in 5 ml LB media at 37°C, 150 rpm until an OD of 0.5 determined by Nanodrop was reached. The adding of 0.2 mM IPTG induced the expression of the protein. After incubation time (4 h at 37°C) the bacteria were pelleted by cenrifugation (5 min, 4000 rpm). For methyltransferase assays the pellet was dissolved in 500 l of MAB 2x and the solution was sonicated for 30 min (30 sec pulse, 30 sec pause) with the Diogenode Bioruptor. Then the solution was centrifuged for 10 min, 16000 rpm. The resulting pellet was discarded and the supernatant was used as reaction educts for methyltransferase assays.

7.4 Cell-based methods

7.4.1 Cell culture

Thawing of cells – Cryotubes were thawed in a 37°C water bath and 1 ml of 37°C prewarmed cell line specific medium was added (7.1.9). Then cells were transferred to a 10 cm plate with 10 ml of 37°C prewarmed CO2–equilibrated medium. Afterwards the cells were incubated for overnight at 37°C in a 5% CO2 saturated atmosphere (Hereaus Heracell incubator). At the next day the medium was exchanged and the cells were cultivated until 80% confluence.

Maintenance of cells – For maintenance of cells the confluence level of the cell line was determined by the Microscope Axiovert with a 20x amplification lens. A confluence level of about 80% required cell splitting. For that the cells were washed once with 1x PBS. Then 0.5-2 ml (0.5 ml for a well of a 6-well plate, 1ml for 10 cm cell culture dish and 0.5-2 ml for a 15 cm cell culture dish) of Trypsin solution was added and incubated for 5 min 37°C. The detached cells were then diluted with 3 ml, 10 ml or 15 ml medium depending on the dish size respectively. Approximately 1/10 for HEK293 and HeLaS3 or 1/5 for MEF and NIH3T3 of the cells were seeded into new cell culture dishes.

Freezing of cells – For freezing the cells were grown to a confluence of about 70%. Then the cells were trypsinised as described in the former paragraph and an aliquot of 20 l were diluted with 20 l of Trypan Blue solution to stain dead cells. The living cells were counted with the help of a Neubauer chamber. The rest of the cells was centrifuged at 300xg, 5 min, RT. The cellular pellet was then resuspended in ice-cold Freezing medium (2x10⁶ cells/ml) and aliquoted in 1 ml cryotubes. The tubes rested in a precooled Cryo Freezing Controller at -80°C overnight and were then stored at -150°C.

7.4.2 Nuclear extraction

For nuclear extraction all buffers were used at 4°C and were supplemented with 1x protease inhibitor, 1 mM DTT and 1 mM PMSF. 4x10⁷ HEK293 or HelaS3 cells were scraped of the dish and centrifuged at 300xg, 5 min, 4°C. The cell pellet was washed 2x with PBS followed by centrifugation (300xg, 5 min, 4°C). Cells were resuspended in 500 l NE buffer A and transferred to a 1,5 ml tube. The resuspension was centrifuged (600xg, 5 min, 4°C) and the pellet was washed again with 500 l NE buffer A. Afterwards the pellet was resuspended in 500 l NE buffer B and incubated for 10 min on ice. The solution was mixed briefly after 5 and 10 min during incubation time. Next the isolated nuclei were pelleted with 600xg, 5 min, 4°C. Afterwards the supernatant was removed and the nuclear pellet was resuspended in 400

dounced every 5 min for 20 times, the 15 min incubation time was followed by an centrifugation of 10 min, 20000xg at 4°C. The nuclear extract was then transferred to a new tube and was diluted with 600 l of NE buffer C. Diluted extract was then used for immunoprecipitation. For detecting interaction partners of hCDYL1b FLAG and hPRMT5 myc the nuclear extract was diluted with 600 l NE buffer D.

7.4.3 Immunoprecipitation

For immunoprecipitation HEK293 cells were transfected with the plasmid of interest using the CaPO₄ transfection Kit. After two days of incubation on 37°C the proteins of the cells were extracted by the Nuclear extraction protocol. 5 l of the immunoprecipitating antibody (myc or Flag) was coupled to 40 l of mouse-IgG-magnetic beads for 3 h, RT under constant rotation. After washing (3x PBS) the beads were added to 1 ml of nuclear extract and were incubated 4 h or overnight at 4°C. Afterwards the beads were washed 6x with 1 ml PD150 at 4°C. For more stringency, especially for immunoprecipitated hPRMT5 myc protein used for methyltransferase assays, the six washing steps were performed with PD300. After washing the beads were either stripped with 1x Laemmli (5 min, 95°C) or resuspended in PD150.

7.4.4 Methyltransferase assay

For methyltransferase assays 5l beads covered with immunoprecipitated hPRMT5 myc (7.4.3) were incubated with E.coli expressed recombinant proteins (7.3.4) in a reaction mixture containing MAB 1x and 2 Ci S-[³H]adenosylmethionine (SAM) for 1,5 h at 30°C, 1200 rpm. The products were loaded on a SDS-page. The resulting gel was dried for 2 h, 80°C with the help of the gel dryer and exposed to an Amersham ECL Hyperfilm. The film was developed with the Kodak X OMAT.

7.4.5 Pulldown

To detect binding of proteins to modified histone peptides, 1 g of the biotinylated peptides (7.1.10) were bound to 40 l streptavidin coated beads for 3 h at RT, 1400 rpm. After binding the beads were washed 3x with PBS to get rid of the peptide excess. 1 ml of nuclear extract or

50 l of a in vitro transcription and translation reaction (TNT Quick coupled

Transcription/Translation System) were incubated with 40 l peptide-bound beads overnight at 4°C under constant rotation. On the next day the beads were washed 6x with 1 ml PD150 at 4°C. Then the beads were stripped with 20 l 1x Laemmli (5 min, 95°C) and loaded on a SDS-PAGE followed by mass spectrometry analysis or Western Blot analysis.

7.4.6 Dual luciferase assay

HEK293 cells were seeded into standard 12-well plates 24 h prior treatment at a concentration of 1.5x10⁵ cells/well. On the next day cells were transfected with a total amount of 1.2 g DNA per well. The total DNA contained 100 ng of the targeting plasmid UAS TK, which containes Gal4 binding sites and a tyrosine kinase promotor, 2 ng of CMV Renilla, a transfection control under CMV promotor control, the Gal4-tagged protein of interest in different amounts (2ng-50ng), and emty pcDNA3.1 vector to reach 1.2 g in total. The DNA was mixed with 100 l Serum-free DMEM GlutaMAX II. Per well 3,6 l Lipofectamine were added to 100 l Serum-free DMEM GlutaMAX II. The Lipofectamine solution was incubated for 5 min at RT and was then combined with the DNA solution followed by an incubation of 20 min, RT. The Lipofectamine/DNA complexes were then added to the HEK293 cells and were incubated for 24 h at 37°C/ 5% CO₂. Next day the cells were scraped off in medium and transferred to 1.5 ml Eppendorf tubes. Cells were pelleted by centrifugation of 5 min, 3000 rpm, RT. The supernatant was discarded. The cells were resuspended in 100 l of 1x PLB buffer and were incubated for 15 min, RT under constant agitation 1400 rpm. The lysed cells were centrifuged 1 min, 14000 rpm and 20 l of the supernatant was pipetted into one well of a 96-well Optiplate. 100 l of the “Firefly” solution and afterwards 100 l “Renilla” solution were then added to each well by the PlateChameleon. After each step the luminosity was counted. The measured values were transferred into Microsoft Exel and normalized against the control transfected cells and the Renilla signal.

7.4.7 Immunofluorescence

Cells were grown in 24 well plates on coverslips (d = 1 cm). If necessary the cells were transfected at 30% confluency with JetPei as described [175]. The immunstaining was then performed two days post transfection. First the cells were washed 2 times with PBS, covered with Fixation solution and incubated at 37°C for 15 min. Afterwards Fixation solution was removed and the cells were washed 1x with the Wash buffer. 500 l of the Permeabilization solution was added to the cells followed by an incubation for 10 min at RT. Next the the cells were incubated for 1 h at RT in Blocking solution. Then, primary antibodies were added directly on the coverslip diluted in a total volume of 65 l Blocking solution (H3 acetylated, H3K4me1, H3K4me2, H3K9me1, H3K9me2 and H3K9me3S10phos were used in a 1:200 dilution, H3K4me3, H3K9me3, Lamin and FLAG in a 1:1000 dilution) and incubated again for 1h, RT. This step was followed by 3x washing with 500 l of the Wash buffer and adding of the secondary antibodies diluted in 65 l total volume in Blocking

solution (rabbit-alexa-488 and/or mouse-alexa-555 1:2000). Excess of antibodies was removed with 3x washing with Wash Buffer. Then coverslips were dipped into water to remove other salt contaminations and were mounted with the mounting medium Mowiol to Superfrost Ultra Plus slides. Slides were dried overnight at RT and analysed with the confocal microscope Leica TCS SP5.

7.4.8 Membrane isolation

Nuclei were prepared as described for nuclear extraction (7.4.2). A sample of the cytosolic fraction was saved. The nuclei from 2x10⁷ cells were resuspended in 200 l LISM. 500 U Benzonase and 800 l of SB 8.5 were added. This resuspension was incubated under gentle stirring for 15 min at RT, and then 1 ml of ice-cold distilled water was added. After a centrifugation step of 30 min 16000xg the supernatant I was saved and the pellet resolved in

800 l of SB 7.4. 250 U of Benzonase was added and incubated for 15 min, RT under

constant rotation. After centrifugation of 30 min, 16000xg the supernatant II was removed and the pelleted membranes were dissolved in 20l NMSM. The supernatant I was combined with the supernatant II and was analysed together with the membranes. For salt treatment indicated amounts (100 mM to 500 mM) of KCl were added to NMSM. The membranes were pelleted (5 min, max speed, 4°C), supernatant was removed and 100 l of NMSM containing 100 mM, 200 mM, 300 mM, 400 mM or 500 mM KCl was added for 10 min, RT. Then membranes were pelleted again and the supernatant as well as the washed membranes were analyzed by Western Blot.

7.5 Xenopus laevis methods

7.5.1 Production and culturing of Xenopus laevis embryos

Female frogs were stimulated the evening prior egg collection by injection of 50 U of human chorionic gonadotropin (hCG) into the dorsal lymph sac. Injected frogs were kept at room temperature overnight and the eggs were collected approximately 14 h later. For testis preparation of males the frogs were placed on ice for 30 min, decapitated and then the belly was opened. Testis was removed, cleaned from fat tissue, placed in 1x MBS containing 1x PenStrep and stored at 4°C. For in vitro fertilization approximately one quarter of a testis was macerated in 1.5 ml 1x MBS. The eggs of a female frog were collected in a 10 cm Petri dish and 100 l of the testis mixture diluted in with 900 l of water was added. After 15 min incubation at room temperature 0.1x MBS was added until the Petri dish was full. The success of the fertilization was visualized by turning of the eggs with their animal pigmented

hemisphere located upwards. This process normally occurred 15-30 min after addition of the testis mixture. 30-60 min after fertilization the eggs were separated from the Petri dish and were transferred to a beaker. The buffer was removed and replaced with 0.1x MBS containing 2% (w/v) cysteine chloride, pH 8.0. Under gentle rotation the embryos were dejellyed for 2-4 min, then washed for 5 times with 0.1x MBS and placed in a new Petri dish. Unhealthy eggs were removed and the remaining were incubated at 14-20°C until the desired stages were reached or were injected directly.

7.5.2 In vitro synthesis of mRNA and obtainment of Morpholino oligomers

Messenger RNA was prepared from the plasmids lacZ pCS2+ [170] and CDYL1b pCS2+

with the help of the mMessage/Machine Kit. Morpholino oligomers were obtained from GeneTools, LLC (Philomath). The xlCDYL1b morpholino is located in the 5-UTR of the xlCDYL1b gene and has the sequence 5’-CCGGGCTGAGGAGATTACTTTCTTT-3’. For control Standard Control oligos were used. Morpholinos were tested with TNT kit of Promega by spiking the TNT reaction of pCS2+ 5UTR xlCDYL1b-FLAG plasmid with 2-200 M of xlCDYL1b Morpholino or control. Resulted transcription was analyed via SDS PAGE and Western Blot.

7.5.3 Microinjection of mRNA and Morpholinos

After dejellying, the fertilized eggs were transferred to 1x MBS /1% Ficoll (w/v) prior to injection. The injection needle was back loaded with the mRNA and the drop size was calibrated using a microscale. 4 nl of the solution containing 10-1000 pg of the in vitro prepared mRNA and/or 20 ng of indicated morpholinos was injected. For injection approximately 50 eggs were transferred to a glas slide and the buffer was removed. Then eggs were injected in all orientations to exclude positioning effects of mRNA using a microinjector. Injected eggs rested for 1 h at RT in 1x MBS/1% Ficoll solution. Then they

After dejellying, the fertilized eggs were transferred to 1x MBS /1% Ficoll (w/v) prior to injection. The injection needle was back loaded with the mRNA and the drop size was calibrated using a microscale. 4 nl of the solution containing 10-1000 pg of the in vitro prepared mRNA and/or 20 ng of indicated morpholinos was injected. For injection approximately 50 eggs were transferred to a glas slide and the buffer was removed. Then eggs were injected in all orientations to exclude positioning effects of mRNA using a microinjector. Injected eggs rested for 1 h at RT in 1x MBS/1% Ficoll solution. Then they

Im Dokument Functional characterization of CDY family proteins and their role in recognition of the heterochromatic histone H3K9me3 modification (Seite 118-0)