RNA analysis

RNA was extracted either with Trizol (Invitrogen; Karlsruhe, Germany) according to the manufacturer’s instructions or using the QIAGEN miRNeasy Kit (Quiagen; Hilden, Germany) and quantified using spectrophotometry.

2.2.4.2 Thiouridine-Labeling; Biotinylation of labeled mRNA; Separation of RNA fractions

Schneider S2 cells were transfected with the 2’-O-Methyl antisense oligo of interest. On day 2 after transfection cells were splitted in 3 x 10⁶ cells/ml and incubated over night.

50 µM thiouridine was added to a final concentration of 100µM. Cells were incubated at 25^◦C for 60 min, centrifuged at 4^◦C at 1200 rpm for 4 min and resuspended in 6 ml Trizol.

An incubation at RT for 5 min allowed the nucleoprotein complexes to dissolve. 1 ml of chloroform was added and shaked vigorously for 15 sec. The mix was then incubated at RT for 2-3 min and centrifuged at 4500 rpm for 45 min at 4^◦C. The aqueous upper phase containing the RNA was transferred to a new Falcon tube. 1/2 the reaction volume of RNA precipitation solution (1.2 M NaCitrate, 0.8 M NaCl) and isopropanol were added, mixed well, incubated at RT for 10 min and afterwards centrifuged at 4500 rpm for 30 min at 4^◦C. The supernatant was removed and an equal volume of 75% EtOH added.

The falcon tube was vortexed and centrifuged at 4500 rpm for 30 min at 4^◦C. Again the supernatant was removed, followed by a brief centrifugation to spin down remaining ethanol. The RNA pellet was dissolved in 100µl of 1xTE (10 mM Tris, 1 mM EDTA) per 100µg expected RNA yield by heating to 65^◦C for 10 min in a shaker. For biotinylation following contents were mixed an incubated at RT for 1.5 h with rotation:

30-100µg total RNA

2µl Biotin-HDDP (1 mg / ml DMF) per 1 µg RNA 1µl 10 x Biotinylation Buffer per 1 µg RNA

(100 mM Tris pH 7.4, 10 mM EDTA) 7µl RNase free H₂O per 1µg RNA

For the following chloroform extraction the initial volume should be at least 500 µl.

An equal volume of chloroform was added and the contents mixed vigorously. After an incubation of 2-3 min tubes were centrifuged at full speed for 5 min. Next the upper phase was transferred into new tubes and the extraction step was repeated.

For RNA precipitation 1/10 the reaction volume of 5M NaCl, an equal volume of isopropanol and 2 µl of glycogene were added. Next the tubes were centrifuged at 20,000 g for 20 min. The supernatant was removed and an equal volume of 75% ethanol added.

The tubes were again centrifuged at 20,000 g for 10 min followed. Finally the RNA was resuspended in 100 µl 1 x TE.

For separation of labeled and unlabeled RNA the biotinylated RNA samples were heated to 65^◦C for 10 min and immediately placed on ice for 5 min. Up to 100 µg (max.

100 µl) of biotinylated RNA were added to 100 µl of streptavidin beads and incubated with rotation for 15 min. TheµMacs columns were placed into the magnetic stand and 0.9 ml of washing buffer (100 mM Tris pH 7.5, 10 mM EDTA, 1 M NaCl, 0.1 % Tween20) were added to the columns for pre-running and equilibration. Next the beads (RNA) were applied to the columns. The columns were washed 3 x with 0.9 ml 65^◦C washing buffer and 3x with 0.9 ml room temperature washing buffer. As the unbound RNA needs to be recovered, the flow-through and the first wash were collected for subsequent precipitation.

The two fractions were combined and the unbound RNA was recovered by using 200µl of the sample with the RNeasy MinElute Cleanup Kit analog to the bound RNA.

Next 700µl of Buffer RLT (RNeasy MinElute Cleanup Kit) were pipetted into new 2 ml Eppendorf cups. RNA was eluted directly into Buffer RLT by placing the Eppendorf cups underneath the columns and adding 100 µl Elution Buffer (100 mM DTT) to the columns. A second elution was performed round 3 min later. Next was continued with the RNeasy MinElute Cleanup Protocol following the manufacturer’s instructions. 500µl of 96-100 % ethanol were added to the diluted RNA and mixed thouroughly by pipetting.

700µl of the sample were applied to an RNeasy MinElute spin column in a 2 ml collection tube. The tube was centrifuged for 15 s at >8000g. Next the flow-through was discarded and the remaining 700 µl of the sample were applied, the centrifugation repeated and the flow-through discarded again. The spin columns were transferred into a new 2 ml collection tube. 500 µl Buffer RPE were pipetted onto the spin column and centrifuged for 15 s at >8000g to wash the column. The flow-through was discarded. Next 500 µl of

80% ethanol were added to the spin column and centrifuged for 2 min at >8000g. The flow-through and the collection tube were discarded. The spin columns were transferred into new 2 ml collection tubes, the caps were opened and then the tubes were centrifuged at full speed for 5 min. The flow-through and the collection tube were discarded again.

To elute, the spin column was transferred to a new 1.5 ml collection tube, 14-20µl RNase free water was pipetted directly onto the center of the silica-gel membrane and the tube was centrifuged for 1 min at full speed. The RNA was now ready for microarray analysis.

2.2.4.3 Northern Blotting

2-10µg of RNA were separated on a 20% Sequagel Acrylamide/Urea gel (National Diag-nostics; Atlanta, USA) at 250V for 1.5 hours. RNA was then transferred to a positively charged Nylon membrane (Roche Diagnostics; Mannheim, Germany) by semi-dry blot-ting for 30 min at 20V. Membranes were transferred to hybridizing tubes and incubated in Church Buffer for prehybridization for at least 1h in a hybridization oven under con-stant rotation at 37^◦C. Probes were labeled by incubating following contents for 1 h at 37^◦C:

9 µl H₂O

2 µl 10x PNK buffer

2 µl 5 mM probe oligonucleotide (=10 pmol) 1 µl PNK (Fermentas)

6 µl [γ³²P] ATP 20 µl

Unbound radioactive nucleotides were removed using a Sephadex G-25 spin column (Roche Diagnostics; Mannheim, Germany). Labeled oligonucleotide anti-sense probes were added to 5 ml of Church Buffer for over-night hybridization. Hybridization was carried out at 37^◦C for DNA-probes or 65^◦C for 2’-OMe-probes. Membranes were washed three times for 15 min in 2x SSC + 0,1% SDS and exposed to Phosphoimager Screens (Fujifilm; Tokyo, Japan) for up to 1 week. Screens were scanned using a Typhoon scanner (Amersham Biosciences) and band intensities were quantified using Multi Gauge software (Fujifilm; Tokyo, Japan). Membranes were immersed in 1% SDS heated to boiling in a conventional microwave and allowed to sit there for 5 min before they could be reused for prehybridization.

Probe for Northern Blotting Sequence 5’ - 3’

miR-277 2’-OMe as probe TGTCGTACCAGATAGTGCATTTA bantam 2’-OMe as probe AATCAGCTTTCAAAATGATCTCA Probe B (CG4068 B) as probe GGAGCGAACTTGTTGGAGTCAA 2.2.4.4 Analysis of mRNA levels and miRNA levels by qRT-PCR

100 ng - 1µg of total RNA extract was reverse transcribed according to the Superscript II Reverse Transcriptase protocol (Invitrogen; Karlsruhe, Germany):

1µl oligo(dT) (500µg/ml) or 50-250 ng random primers xµl 100 ng - 1µg RNA

1µl dNTP Mix (10 mM each) xµl H₂O

12µl

The mixture was heated to 65^◦C for 5 min and quick chilled on ice. The contents of the tube were briefly centrifuged. Then following components were added:

4µl 5X First-Strand Buffer 2µl 0.1 M DTT

1µl RiboLock RNase inhibitor 1µl SuperScript II RT

The contents of the tube were mixed gently. If oligo(dT) primers were used, an incuba-tion at 42^◦C for 52 min followed. If random primers were used, an incubation at 25^◦C for 12 min followed, next an incubation at 42^◦C for 50 min. The reaction was inactivated by heating at 70^◦C for 15 min. 100 µl of water were added to get a final volume of 120 µl.

The qPCR reaction mix was as follows, according to the DyNAmo Flash SYBR Green qPCR Kit (Finnzymes; Finland).

Reaction mix for one well of a 96-well plate:

5µl Master Mix

0.5µl each Oligo (10µM) 0.2µl ROX

2.8µl H₂O 9µl

9 µl of reaction mix and 1 µl of RT-reaction (or 10ng genomic DNA) per well was

amplified in an ABI PRISM 7000 qPCR cycler (Applied Biosystems; Foster City, USA) using the following conditions:

10 sec 50^◦C 3 min 94^◦C 40 cycles:

30 sec 95^◦C 30 sec 59^◦C 30 sec 70^◦C

Cycle of Threshold values (CT-values) usually determined via the auto-CT function and manually adjusted if necessary.

100 ng of total RNA extract was reverse transcribed according to the Qiagen miScript protocol:

4 µl miScript RT buffer (5x) 0.3-0.7 µl total RNA

14.3-14.7 µl H₂O

1 µl miScript enzyme mix 20 µl

Samples were incubated at 37^◦C for 60 min and then inactivated at 95^◦C for 5 min.

100 µl of water were added to make a final volume of 120 µl. The qPCR reaction mix was as follows:

Reaction mixes for 14 reactions (for 1 row of 96-well plate):

70 µl Quantitect SyBr-green mix (2x) 35 µl H₂O

14 µl miScript universal primer (5µM) 7 µl miScript specific primers (10µM)

9 µl of reaction mix and 1 µl of RT-reaction per well was amplified in an ABI PRISM 7000 qPCR cycler (Applied Biosystems; Foster City, USA) using the following conditions:

15 min 94^◦C 40 cycles:

20 sec 94^◦C 30 sec 55^◦C 30 sec 70^◦C

Cycle of Threshold values (CT-values) usually determined via the auto-CT function and manually adjusted if necessary. The 2S-1 primer from the miScript kit was used as a control.

2.2.4.5 Analysis of miRNA levels by microarrays

Labeling of samples for array analysis was performed using the GeneChip 3’ IVT labeling assay (Affymetrix) with 100 ng input RNA by Kerstin Maier (AG Cramer). Samples were hybridized to GeneChip Drosophila Genome 2.0 microarrays following the instructions from the supplier (Affymetrix). Computational analysis of differential expression was done by Björn Schwald (AG Tresch).

2.2.4.6 Deep sequencing

Small RNAs were isolated and libraries for Solexa sequencing were prepared essentially as described by (Czech et al., 2008). Solexa sequencing was carried out at Fasteris (Plan-Les-Ouates, Switzerland). For previously published deep sequencing data, the FASTA files were retrieved from NCBI GEO (GSM239041, GSM239050, GSM239051, GSM239052, GSM280089) and mapped onto the target sequences using BOWTIE (http://bowtie-bio.sourceforge.net/) with the option -v0 to force selection of only perfectly matching sequences. Pre-processing of sequences and analysis of the BOWTIE output files were done using PERL scripts. The sequence data are available at NCBI GEO under the accession number GSE16958.

2.2.5 Drosophila melanogaster methods