IV. Results
2.1 Publication 2: Spinal poly-GA inclusions in a C9orf72 mouse model trigger
Spinal poly-GA inclusions in a C9orf72 mouse model trigger motor deficits and inflammation without neuron loss
published as
Schludi MH, Becker L, Garrett L, Gendron TF, Zhou Q, Schreiber F, Popper B, Dimou L, Strom TM, Winkelmann J, von Thaden A, Rentzsch K, May S, Michaelsen M, Schwenk BM, Tan J, Schoser B, Dieterich M, Petrucelli L, Hölter SM, Wurst W, Fuchs H, Gailus-Durner V, Hrabe de Angelis M, Klopstock T, Arzberger T, Edbauer D. Spinal poly-GA inclusions in a C9orf72 mouse model trigger motor deficits and inflammation without neuron loss. Acta Neuropathol.2017.doi:10.1007/s00401-017-1711-0
Acta Neuropathol
DOI 10.1007/s00401-017-1711-0 ORIGINAL PAPER
Spinal poly‑GA inclusions in a C9orf72 mouse model trigger motor deficits and inflammation without neuron loss
Martin H. Schludi1,2 · Lore Becker3 · Lillian Garrett3,4 · Tania F. Gendron5 · Qihui Zhou1,2 · Franziska Schreiber1 · Bastian Popper6 · Leda Dimou7,8 · Tim M. Strom9 · Juliane Winkelmann2,10,11,12 · Anne von Thaden1 ·
Kristin Rentzsch1 · Stephanie May1 · Meike Michaelsen1 · Benjamin M. Schwenk1 · Jing Tan10 · Benedikt Schoser13 · Marianne Dieterich1,2,13 · Leonard Petrucelli5 · Sabine M. Hölter3,4 · Wolfgang Wurst1,2,4,14 · Helmut Fuchs3 · Valerie Gailus‑Durner3 · Martin Hrabe de Angelis3,15,16 · Thomas Klopstock1,2,13 · Thomas Arzberger1,2,17,18 · Dieter Edbauer1,2,19
Received: 9 January 2017 / Revised: 4 April 2017 / Accepted: 4 April 2017
© The Author(s) 2017. This article is an open access publication
transgenic mice showed abnormal gait and progressive balance impairment, but showed normal hippocampus-dependent learning and memory. Apart from microglia acti-vation we detected phosphorylated TDP-43 but no neuronal loss. Thus, poly-GA triggers behavioral deficits through inflammation and protein sequestration that likely contrib-ute to the prodromal symptoms and disease progression of C9orf72 patients.
Keywords ALS · FTLD · FTD · MND · C9orf72 · Neurodegeneration · Neurological disorder · Mouse model Abstract Translation of the expanded (ggggcc)n repeat in
C9orf72 patients with amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) causes abundant poly-GA inclusions. To elucidate their role in pathogenesis, we generated transgenic mice expressing codon-modified (GA)149 conjugated with cyan fluorescent protein (CFP).
Transgenic mice progressively developed poly-GA inclu-sions predominantly in motoneurons and interneurons of the spinal cord and brain stem and in deep cerebellar nuclei. Poly-GA co-aggregated with p62, Rad23b and the newly identified Mlf2, in both mouse and patient sam-ples. Consistent with the expression pattern, 4-month-old
Electronic supplementary material The online version of this article (doi:10.1007/s00401-017-1711-0) contains supplementary material, which is available to authorized users.
* Dieter Edbauer dieter.edbauer@dzne.de
1 German Center for Neurodegenerative Diseases (DZNE) Munich, Feodor-Lynen-Straße 17, 81377 Munich, Germany
2 Munich Cluster for System Neurology (SyNergy), Feodor-Lynen-Straße 17, 81377 Munich, Germany
3 German Mouse Clinic, Institute of Experimental Genetics, German Research Center for Environmental Health, Helmholtz Zentrum München, Ingolstädter Landstrasse 1, 85764 Neuherberg, Germany
4 Institute of Developmental Genetics, German Research Center for Environmental Health, Helmholtz Zentrum München, Ingolstädter Landstrasse 1, 85764 Neuherberg, Germany
5 Department of Neuroscience, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA
6 Department of Anatomy and Cell Biology, Biomedical Center, Ludwig-Maximilians-University Munich, Großhaderner Str. 9, 82152 Planegg-Martinsried, Germany
7 Physiological Genomics, Biomedical Center, Ludwig-Maximilians-University Munich, Großhaderner Str. 9, 82152 Planegg-Martinsried, Germany
8 Molecular and Translational Neuroscience, Department of Neurology, University of Ulm, Albert-Einstein-Allee 11, 89081 Ulm, Germany
9 Institut für Humangenetik, Helmholtz Zentrum München, 85764 Munich, Germany
10 Institut für Neurogenomik, Helmholtz Zentrum München, 85764 Munich, Germany
11 Neurologische Klinik, Klinikum rechts der Isar, Technische Universität München, 81675 Munich, Germany
12 Institut für Humangenetik, Klinikum rechts der Isar, Technische Universität München, 81675 Munich, Germany
13 Department of Neurology, Friedrich-Baur-Institute, Klinikum der Ludwig-Maximilians-Universität München, Ziemssenstr.
1a, 80336 Munich, Germany
Acta Neuropathol
1 3
Introduction
A (ggggcc)n hexanucleotide repeat expansion upstream of the coding region of C9orf72 is the most common genetic cause of amyotrophic lateral sclerosis (ALS) and fronto-temporal dementia (FTD), with some patients showing symptoms of both diseases [7]. Patients usually carry sev-eral hundred or thousand ggggcc repeats compared to less than 30 in the general population. The repeat expansion inhibits C9orf72 expression, and sense and antisense tran-scripts may cause toxicity by sequestering RNA-binding proteins in nuclear foci [6, 28]. Moreover, both sense and antisense repeat transcripts are translated from all reading frames into aggregating dipeptide repeat (DPR) proteins (poly-GA, -GP, -GR, -PA, and -PR) [1, 22, 23, 40]. The rel-ative contribution of these putrel-ative pathomechanisms, and their link to the co-occurring TDP-43 pathology present in patients with C9orf72 ALS/FTD, are under intense debate.
Generating mouse models for C9orf72 repeat expansion diseases has been surprisingly challenging [13]. Complete loss of C9orf72 does not cause neurodegeneration, but does affect autophagy, particularly in the immune system, and leads to splenomegaly [15, 25]. High level viral expression of a relatively short (ggggcc)66 repeat expansion leads to rapid neurodegeneration accompanied by DPR and TDP-43 pathology [5]. In contrast, expressing lower levels of an expanded repeat in its endogenous context leads to vari-able results. Two BAC transgenic mouse lines showed the characteristic RNA foci and DPR inclusions of C9orf72 ALS/FTD, but no neuron loss or behavioral symptoms [24, 26], while two similar mouse models additionally showed cognitive symptoms [15, 19]. The more dramatic effects in the viral system may be due to higher expression lev-els and altered processing of exonic repeat expression [34]. Together, these models strongly support gain of func-tion toxicity as the main cause of C9orf72 ALS/FTD, but
cannot differentiate the contribution of sense and antisense RNA transcripts and the five DPR species. Viral expression of the most abundant DPR species, poly-GA, in the mouse brain causes mild neurodegeneration and cognitive symp-toms without TDP-43 pathology, but this system showed no expression in the spinal cord [37]. In patients, DPR proteins are less common in the spinal cord than in the brain, but they are also found in upper and lower motoneurons [31].
To elucidate the specific contribution of poly-GA to disease pathogenesis, we aimed to generate a transgenic mouse model with poly-GA expression levels compara-ble to C9orf72 ALS/FTD patients. We chose a Thy1-based expression vector for neuron-specific expression of poly-GA [9]. Here, we report in-depth pathological and pheno-typic analyses of these mice focusing on the motor system.
Methods
Generation of Thy1 (GA)149‑CFP mice
We inserted a multiple cloning site into the pUC18 based murine Thy1.2 vector using synthetic oligonucleotides [9].
This allowed us to insert a cDNA encoding (GA)149, 31 amino acids corresponding to the 3′ region of the poly-GA reading frame in patients [22] and cyan fluorescent pro-tein (CFP) (sequence shown in Fig. S1a). Compared to the previous (GA)149-GFP construct [21] only the fluorescent protein had been changed. Linearized vector was injected into C57BL/6-derived zygotes and transferred into pseu-dopregnant CD1 females (PolyGene). GA-CFP mice were kept in the C57BL/6N background. Mice were PCR geno-typed using the following primers (tccaggagcgtaccatcttc;
gtgctcaggtagtggttgtc). We confirmed maintenance of the full length transgene with PCR amplification (Expand Long Template PCR System, Roche, 11681842001; gatc-caagcttgccaccatg; tctagctctgccactccaag) and sequencing.
The transgene integration site was determined by whole genome sequencing according to standard protocols using the TruSeq DNA PCR-Free Library Preparation Kit and an Illumina HiSeq 4000 with 150 bp paired-end reads result-ing in about 58× coverage from two lanes. Sequences mates mapping to different chromosomes were analyzed using the Integrative Genomics Viewer (IGV) [33].
Immunohistochemistry of mouse and patient tissue After killing, 1-, 3-, 6-, and 12-month-old mice were transcar-dially perfused with 1% sterile PBS and tissue was then forma-lin fixated for 2 days. Histological stainings were performed on 5–8 µm thick sections from paraffin-embedded tissue. For spi-nal cord tissue, an additiospi-nal decalcification step with 5% for-mic acid for 5 days was performed after formalin fixation. After
14 Chair of Developmental Genetics, Technische Universität München, Freising-Weihenstephan, Germany
15 Chair of Experimental Genetics, School of Life Science Weihenstephan, Technische Universität München, Alte Akademie 8, 85354 Freising, Germany
16 German Center for Diabetes Research (DZD), Ingolstädter Landstr. 1, 85764 Neuherberg, Germany
17 Center for Neuopathology and Prion Research, Ludwig-Maximilians-University Munich, Feodor-Lynen-Straße 23, 81377 Munich, Germany
18 Department of Psychiatry and Psychotherapy, Ludwig-Maximilians University Munich, Nußbaumstraße 7, 80336 Munich, Germany
19 Institute for Metabolic Biochemistry, Ludwig-Maximilians-University Munich, Feodor-Lynen-Straße 17, 81337 Munich, Germany
Acta Neuropathol
deparaffinization in xylene and dehydration in graded ethanol, the paraffin sections were treated with citrate buffer (pH 6) for 20 min in the microwave. Mlf2 IHC staining was more promi-nent when the citrate retreatment was followed by 20 min incu-bation in 80% formic acid or 5–25 min incuincu-bation with 0.1 µg/
µl proteinase K in 10 mM Tris/HCl pH 7.6 at 37 °C. Afterwards the slides were incubated with primary antibody overnight at 4 °C. For ChAT, an additional incubation with rabbit anti-goat-IgG was performed the next day for 1 h at room temperature.
The slides were detected by the DCS SuperVision 2 Kit (DCS innovative diagnostic-system, Hamburg, Germany) according to the manufacturer’s instructions. Iba1 and GFAP immuno-histochemistry was performed with the Ventana BenchMark XT automated staining system (Ventana) using the UltraView Universal DAB Detection Kit (Roche). For Nissl staining, the deparaffinized slides were incubated in 70% ethanol overnight.
After 30 min in Cresyl violet and 1 min in 96% ethanol the slides were processed in 100% ethanol with glacial acetic acid.
Bright-field images were taken by CellD, Olympus BX50 Soft Imaging System (Olympus, Tokyo, Japan).
For immunofluorescence, after deparaffinization and citrate antigen retrieval, the slides were incubated with primary antibody overnight at 4 °C and the following day incubated for 1 h at room temperature with secondary Alexa Fluor labeled antibodies. For Mlf2 immunofluores-cence staining, a 1 min treatment at 37 °C with 0.05 µg/
µl proteinase K in 10 mM Tris/HCl pH 7.6 was neces-sary before citrate antigen retrieval. After the nuclei were counterstained with DAPI, the slices were incubated for 1 min in 0.2% Sudan black B and mounted with Fluoro-mount Aqueous Mounting Medium (Sigma, F4680). Fluo-rescent images were taken using a LSM710 confocal laser scanning system (Carl Zeiss, Jena, Germany) with 20x or 40x/63x oil immersion objectives.
Antibodies
α-GFP (1:1000, Clonetech 632592), α-GA clone 5F2 [20]
(purified mouse monoclonal, WB unlabeled 1:50; IHC HRP labeled 5F2 1:2500, labeled by AbD Serotec HRP-labeling Kit LNK002P; biotinylated 5F2 7 ng/µl; MSD-labeled 5F2 10 ng/µl, MSD-labeled by Meso Scale MSD Sulfo-Tag NHS-Ester R91AN-1), α-GA-CT (C-terminal tail) clone 5C3 [22] (rat monoclonal, 1:50), α-p62/SQSTM1 (IF 1:100, IHC 1:1000, MBL, PM045), α-pTDP-43 (Ser409/
Ser410) clone 1D3 [20] (purified rat monoclonal, 1:50), α-TDP-43 (1:1000, Cosmo Bio, TIP-TD-P09), α-RanGAP1 (1:100, Abcam, ab92360), α-nucleolin (1:1000, Abcam, ab50729), α-CD68 (1:1000, Abcam, ab125212), α-Iba1 (1:500, Wako, 091-19741), α-GFAP (1:5000,Dako, Z0334), α-NeuN (1:1000, Abcam, ab177487), α-ChAT (IF 1:300, IHC 1:5000, Millipore, AB144P), α-Calnexin (1:3000, Enzo Life Science, SPA-860F), α-Calbindin
(1:300, Abcam, ab49899), α-Calretinin (1:1000, Abcam, ab702) α-Parvalbumin (1:750, Abcam, ab11427), α-Mlf2
#1 (1:1000, Sigma-Aldrich, HPA010811-100UL), α-Mlf2
#2 (1:1000, Santa Cruz, sc-166874), α-Laminin (1:200, Abcam, ab11575), α-goat-IgG (1:400, Dako, E0466), α-mouse Alexa Fluor 488 (1:500, Thermo Fischer Scien-tific, A11029), α-rabbit Alexa Fluor 488 (1:500, Thermo Fischer Scientific, A11034), α-rat Alexa Fluor 488 (1:500, Thermo Fischer Scientific, A11006), α-mouse Alexa Fluor 555 (1:500, Thermo Fischer Scientific, A21424), α-rabbit Alexa Fluor 555 (1:500, Thermo Fischer Scientific, A21429), α-rat Alexa Fluor 555 (1:500, Thermo Fischer Scientific, A21434), Streptavidin Alexa Fluor 488 (1:500, Thermo Fischer Scientific, S11223), nuclei were stained with DAPI (Roche Applied Science, Penzberg, Germany).
Immunoassay analysis of poly‑GA in tissue homogenates
Mouse brainstem and spinal cord samples and C9orf72 patient motor cortex samples were sonicated in 500–700 µl of cold RIPA buffer (137 mM NaCl, 20 mM Tris pH 7.5, 10% Glycin, 1% Triton X 100, 0.5% Na-deoxycholate, 0.1% SDS, 2 mM EDTA, protease and phosphatase inhibi-tors). 100 µl of this homogenized tissue stock solutions were diluted to 300 µl with RIPA and centrifuged at 100,000×g for 30 min at 4 °C. To avoid cross contamination, the RIPA-insoluble pellets were resuspended in 300 µl RIPA, re-son-icated and re-centrifuged. Afterwards the RIPA-insoluble pellets were sonicated in U-RIPA (RIPA buffer contain-ing 3.5 M Urea) and the protein concentration determined by Bradford assay. Streptavidin Gold multi-array 96-well plates (Mesoscale, L15SA-1) were blocked for 30 min with block solution (1% BSA, 0.05% Tween20 in PBS) and incu-bated with biotinylated α-GA clone 5F2 overnight at 4 °C.
Equal amounts of protein of all samples were added in duplicate wells for 2 h, followed by 2 h incubation with the secondary MSD-labeled α-GA clone 5F2. Serial dilution of recombinant GST-GA15 in blocking buffer was used to pre-pare a standard curve. The wells intensity of emitted light upon electrochemical stimulation was measured using the MSD Quickplex 520 and the background corrected by the average response obtained from blank wells. Sensitivity and specificity of the immunoassay were confirmed using puri-fied 15-mer DPRs fused to GST (Fig. S3a, b).
Phenotypic analysis of mice
The study was conducted in accordance with European and national guidelines for the use of experimental animals, and the protocols were approved by the governmental com-mittee (Regierungspräsidium Oberbayern, Germany). All experimenters were blind to the genotype.
Acta Neuropathol
1 3
Barnes maze (Stoelting Europe, Ireland) assay to test spatial, hippocampus-dependent long-term memory in mice was performed on a circular surface (diameter 91 cm) with 20 circular holes (diameter 5 cm) around its circumference [3]. Under one hole was an “escape box” (diameter 4 cm, depth 15 cm). The table surface was brightly lit by over-head lightning (900 lx). For each trial the mice had 3 min to find and hide in the “escape box”. For the statistical analy-sis failed attempts were set to 3 min.
In the balance beam test, the mice were placed on a wooden beam (round surface, length 58 cm, diameter 8 mm) and had 1 min to cross the beam. The test was fin-ished either when the mice reached the end of the stick, they dropped down or the time ran out. For the statistical analysis failed attempts were set to 1 min. The experiment-ers were blind to the genotype, and trials were either video documented or recorded by AnyMaze (Stoelting Europe).
AnyMaze Software was used to track the mice and to ana-lyze the data.
In the Rotarod test (Ugo Basile), we accelerated the spindle speed from 5 to 50 rpm over 5 min. The test fin-ished either after 5 min or when the mouse dropped down.
The average time of two trials with 1 h break in between was used.
Modified SHIRPA analysis and grip strength testing was performed as described [11].
The beam ladder consists of two Plexiglas screens con-nected with several metal beams of variable distance. The test is used to evaluate skilled walking of the mice. Mice traverse the ladder and foot slips of fore paws and hind paws are counted separately as well as the time to traverse the beam.
The open field test as an assessment of spontaneous exploratory and anxiety-related behavior in a novel envi-ronment was carried out as previously described [12, 14, 39]. It consisted of a transparent and infra-red light permea-ble acrylic test arena with a smooth floor (internal measure-ments: 45.5 × 45.5 × 39.5 cm). Illumination levels were set at approximately 150 lx in the corners and 200 lx in the middle of the test arena. Each animal was placed individu-ally into the middle of one side of the arena facing the wall and allowed to explore it freely for 20 min. For data anal-ysis, the arena was divided by the computer in two areas, the periphery defined as a corridor of 8 cm width along the walls and the remaining area representing the center of the arena (42% of the total arena). Data were recorded and analyzed using the ActiMot system (TSE, Bad Homburg, Germany).
Acoustic startle and its prepulse inhibition were assessed using a startle apparatus setup (Med Associates Inc., VT, USA) including four identical sound-attenu-ating cubicles. The protocol is based on the Eumorphia protocol (http://www.empress.har.mrc.ac.uk), adapted to
the specifications of our startle equipment, and constantly used in the primary screen of the GMC [30]. Background noise was 65 dB, and startle pulses were bursts of white noise (40 ms). A session was initiated with a 5-min-accli-mation period followed by five presentations of leader startle pulses (110 dB) that were excluded from statistical analysis. Trial types included prepulse alone trials at four different sound pressure levels (67, 69, 73, 81 dB), and trials in which each prepulse preceded the startle pulse (110 dB) by a 50 ms inter-stimulus interval. Each trial type was presented ten times in random order, organized in ten blocks, each trial type occurring once per block.
Inter-trial intervals varied from 20 to 30 s.
DNA constructs and lentivirus production
cDNA of rat Mlf2 (NCBI Gene ID: 312709) containing an N-terminal HA-tag was expressed from a lentiviral vector driven by human ubiquitin promoter (FUW2-HA). Pre-viously described (GA)175-GFP cDNA expressed from a synthetic gene lacking repetitive (ggggcc)n sequences with ATG start codon and EGFP was cloned in a lentiviral pack-ing vector (FhSynW2) containpack-ing the human synapsin pro-moter [21]. Lentivirus was produced in HEK293FT cells (Life Technologies) as described previously [10].
Cell culture, RNA isolation and immunoprecipitation Primary hippocampal neurons from embryonic day 19 rats were cultured and transduced with lentivirus as described previously [32]. Immunofluorescence staining was per-formed on 10 min PFA (4% paraformaldehyde and 4%
sucrose) fixed primary neurons. The primary and second-ary antibodies were diluted in GDB buffer (0.1% gelatin, 0.3% Triton X-100, 450 mM NaCl, 16 mM sodium phos-phate pH 7.4) and incubated over night at 4 °C or 1 h at room temperature. Confocal images were taken using a LSM710 confocal laser scanning system (Carl Zeiss, Jena, Germany) with 40× or 63× oil immersion objectives. RNA isolation and qPCR was performed as described previously [23] using the following primers (CD68 ttctgctgtggaaatg-caag and gagaaacatggcccgaagt; Iba1 acagcaatgatgaggatctgc and ctctaggtgggtcttgggaac; GFAP tttctcggatctggaggttg and agatcgccacctacaggaaa; ACTB atggaggggaatacagccc and ttctttgcagctccttcgtt; GAPDH caacagcaactcccactcttc and ggtccagggtttcttactcctt).
Patient material
Tissue samples of patient autopsy cases were provided by the Neurobiobank Munich, Ludwig-Maximilians-Univer-sity (LMU) Munich and collected according to the guide-lines of the local ethics committee.
Acta Neuropathol
Statistics and analysis
Statistical analysis was performed with GraphPad Prism software (version 7.01). For neuron and motoneuron count, images of the left and right anterior horns of the spinal cord were taken and all positively stained cells were manually counted. The count number represents the neurons/motoneurons averaged on one side. Experi-ments with two groups were analyzed by t test (unpaired, two-sided, t = size of the difference relative to the varia-tion; df = degrees of freedom). Behavioral data was ana-lyzed by two-way ANOVA with Bonferroni post hoc test (F = equality of variances).
Phospho‑TDP‑43 immunoassays
For phosphorylated TDP-43 measurements, sarkosyl-soluble and urea-soluble fractions of mouse spinal cord tissues were prepared as previously described [5]. In brief, 25–60 mg of tissue were subjected to a sequential extraction protocol using Tris–EDTA buffer (50 mM Tris pH 7.4, 50 mM NaCl, 1 mM EDTA), high salt Triton X-100 buffer, Triton X-100 buffer + 30% sucrose, and sarkosyl buffer. Sarkosyl-insol-uble material was further extracted in urea buffer. The pro-tein concentrations of sarkosyl-soluble fractions were deter-mined using a bicinchoninic acid assay (Thermo Scientific), whereas a Bradford assay was utilized to measure protein concentrations of urea-soluble fractions. Phosphorylated TDP-43 levels in both these fractions were evaluated using a sandwich immunoassay that utilizes MSD electrochemilu-minescence detection technology [15]. A mouse monoclo-nal antibody that detects TDP-43 phosphorylated at serines 409 and 410 (Cosmo Bio, #CAC-TIP-PTD-M01, 1:500) was used as the capture antibody. The detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (Proteintech, 12892-1-AP, 2 µg/ml). Response values corre-sponding to the intensity of emitted light upon electrochemi-cal stimulation of the assay plate using the MSD QUICK-PLEX SQ120 were acquired and background corrected using the average response from buffer only.
Results
Thy1 (GA)149‑CFP mice accumulate poly‑GA inclusions in the spinal cord and brainstem
We generated a Thy1-based vector to express (GA)149 using a synthetic sequence, which unlike the repeat expansion in patients has no extensive (ggggcc)n stretches, fused with a C-terminal fluorescent CFP tag (Figs. 1a, S1a). Since the relevance of the C-terminal tail of endogenous DPR prod-ucts is unknown, we additionally included 31 amino acids
translated from the endogenous locus in the poly-GA reading frame [22]. Using pronuclear injections into C57BL/6 mice, we generated a founder line (termed GA-CFP) with germline transmission and poly-GA expression. Transgenic mice were born at Mendelian frequency and did not differ in adult via-bility. Sequencing confirmed transmission of the full length open reading frame in all analyzed animals (n = 3, data not shown) and genomic PCR from different tissues further con-firmed the somatic stability of the synthetic repeat gene (Fig.
S1b). We identified the integration site using whole genome sequencing and validated our findings by PCR and Sanger sequencing (Fig. S2). Several transgene copies integrated on chromosome 14 about 330 kb downstream of the nearest tran-script, the long non-coding RNA 4930474H20Rik, strongly suggesting that no endogenous genes are disrupted.
Using immunohistochemistry, we characterized poly-GA protein expression in different brain regions in 4–6-month-old mice. Expression of the aggregated full length product was detected with antibodies targeting CFP, poly-GA or the C-terminal DPR tail (GA-CT) (Fig. S1c).
While most of the poly-GA inclusions were cytoplasmic, a few inclusions were observed in the nucleus (Fig. S1d). In GA-CFP mice, poly-GA-inclusion pathology was restricted to neurons of brain stem, cerebellar nuclei and spinal cord.
There were numerous poly-GA-immunopositive inclusions in large neurons of the brainstem, the lateral (dentate) and interposed cerebellar nuclei and (most abundantly) the anterior horn of the spinal cord, particularly in the cervical, thoracic and lumbar regions (Fig. 1b). Inclusion pathology was additionally observed in interneurons (Fig. S1e) in the laminae IV, V and VI of the posterior horn. No poly-GA inclusions were detected in the olfactory bulb, the molecu-lar and granumolecu-lar layer of the cerebellum, the hippocampus or the neocortex, including the motor cortex (Fig. 1b).
Next, we analyzed the progression of poly-GA pathology in GA-CFP mice with age. Inclusions were visible by IHC in the spinal cord and brain stem at 1 month of age, and the number and size of inclusions increased with age (Fig. 1c).
Consistent with these findings, levels of RIPA-insoluble poly-GA in brain stem and spinal cord lysates increased over time, as assessed using a poly-GA-specific immunoas-say (Figs. 1d, e, S3a, S3b), whereas no signal was detected in non-transgenic littermates. No poly-GA was detectable in the RIPA-soluble fraction of the spinal cord and brain-stem (Fig. S3c). Fair comparison of poly-GA levels in mice and patients is complicated by the different regional expres-sion pattern in mice and patients and variable poly-GA lev-els in patients. However, we measured the expression of poly-GA in spinal cord of 4–6-month-old GA-CFP mice and motor cortex of C9orf72 ALS/FTD patients with abun-dant poly-GA pathology by immunoassay (Fig. S3d) and additionally counted the frequency of neuronal poly-GA inclusions in the most affected regions of GA-CFP mice
Acta Neuropathol
1 3
and the neocortex of C9orf72 patients (Fig. S3e, f). Both assays show that poly-GA expression is not grossly exag-gerated in GA-CFP mice. Thus, GA-CFP mice are a suit-able model to address the pathomechanisms of poly-GA in the motor system.
Poly‑GA co‑aggregates with p62, Rad23b and the chaperone‑associated protein Mlf2
To investigate potential downstream effects of poly-GA expression, we analyzed whether poly-GA co-aggregates
with other proteins. Similar to findings in C9orf72 ALS/
FTD patients [23], the vast majority of poly-GA inclusions co-localized with p62 (Fig. 2a, b, first row and Table S1).
Rad23b, a known poly-GA-interacting protein involved in the ubiquitin proteasome pathway, also aggregated in GA-CFP mice (Fig. 2a, b, second row) similar to previ-ous reports [21, 37]. In contrast to overexpression of poly-GA in rat primary neurons [21], poly-GA-CFP mice showed no sequestration of Unc119 (Fig. S4a) and no mislocalization or co-localization of RanGAP1 with poly-GA (Fig. S4b first row, and Table S1), which is consistent with our cell
1 2 3 4 5 6 0
0.0 0.1 0.2 0.3 ATG-149xGA GA-CT CFP
...GAGAGAGAGAGAGAGAGAGAGAWSGRARGRARGGAAVAVPAPA…
Thy1
a
b
c
spinal cord
insoluble poly-GA [AU]
GA-CFP 4-6
2 3 4 5 6
1 wt
age in months
d
1 2 3 4 5 6 0
0.0 0.1 0.2
0.3 brainstem
insoluble poly-GA [AU]
GA-CFP 4-6
2 3 4 5 6
1
wt age in
months
e
Thy1
BO Ctx
DG
CA3
CBLgl CBLml BS
SCAt SCPt SCAl
SCPl GA-CT
CBLncl
GA-CT
3 months
1 month 6 months
BS BS BS
SC SC SC
Fig. 1 Expression and distribution pattern of poly-GA aggregates in GA-CFP mice. a Schematic diagram of the construct containing the murine Thy1 promoter driving expression of a synthetic gene encoding (GA)149 with its endogenous C-terminal tail fused to CFP.
(GA)149-CFP is replacing the endogenous coding region. b Distri-bution of GA aggregates show many inclusions in the spinal cord and brainstem and no aggregates in cortical regions, hippocampus or molecular and granular layer of the cerebellum. BO olfactory bulb, BS brainstem, CA3 cornu ammonis fields 3, CBLgl cerebellar granu-lar cell layer, CBLml cerebelgranu-lar molecugranu-lar cell layer, CBLncl lateral cerebellar nuclei, DG dentate gyrus, SCAl anterior horn of lumbar
spinal cord, SCAt anterior horn of thoracic spinal cord, SCPl poste-rior horn of lumbar spinal cord, SCPt posteposte-rior horn of thoracic spi-nal corn. Scale bars represent 20 µm. c Increasing number and accu-mulation of aggregates in spinal cord (SC; upper row) and brainstem (BS; lower row) of 1-, 3- and 6-month-old GA-CFP mice detected by immunohistochemical staining using GA-CT antibody. Scale bar represents 20 µm. Quantitative immunoassay of RIPA-insoluble poly-GA in the spinal cord (d) and brainstem (e) of 1–6-month-old poly- GA-CFP mice (n = 3 mice per time-point; measured in duplicates) shows increasing amounts of poly-GA in a time dependent manner. AU arbi-trary unit, data are shown as mean, minimum and maximum
Acta Neuropathol
culture data [17]. We also found no evidence of nucleolar pathology using nucleolin immunostaining (Fig. S4b sec-ond row).
Additionally, we analyzed whether poly-GA co-aggre-gates with proteins identified in poly-GA immunoprecipi-tates in primary hippocampal neurons in our recent mass spectrometry screen [21]. Among such proteins that had not been previously validated, the Hsp70-associated pro-tein, Mlf2, showed the strongest co-aggregation with poly-GA in the spinal cord of poly-GA-CFP mice, whereas no Mlf2 aggregates were detected in wildtype mice (Fig. 2a, b, third row). Co-transduction of HA-Mlf2 and (GA)175-GFP in primary hippocampal neurons of wildtype rats corroborated the sequestration of Mlf2 into poly-GA inclusions (Fig.
S4c). Moreover, endogenous Mlf2 was sequestered into
poly-GA inclusions in primary neurons transduced with (GA)175-GFP (Fig. S4d). These data led us to examine Mlf2 aggregation in C9orf72 ALS/FTD patients. We detected Mlf2 pathology in the frontal cortex and hippocampus of C9orf72 ALS/FTD patients but not healthy controls using two independent Mlf2 antibodies (Figs. 2c, S4e). In addi-tion, double immunofluorescence staining confirmed the co-aggregation of Mlf2 with poly-GA in C9orf72 patients (Fig. 2d, first row). While in GA-CFP mice Mlf2 was co-aggregating in ~55% of the poly-GA inclusions, in C9orf72 patients only 0.3–2.7% of the poly-GA aggregates showed Mlf2 sequestration, depending on the brain region (Table S2). However, we detected Mlf2 also occasionally in cyto-plasmic phospho-TDP-43 inclusions in C9orf72 patients (Fig. 2d, second row). Thus, our GA-CFP mice recapitulate
GA-CT
p62 Merge
DAPI GA-CFP
a p62
GA-CFP wildtype
Rad23b
SC SC
b
Mlf2 #1
C9orf72 Mlf2 #1
FCtx c healthy ctrl
GA Merge
Mlf2 #1 DAPI
d C9orf72
FCtx
GA-CT
Mlf2 #1 Merge
DAPI GA-CT
Rad23 Merge
DAPI
DG
pTDP-43 Merge DAPI Mlf2 #1
Fig. 2 GA-CFP mice develop p62, Rad23b and Mlf2 pathology similar to human C9orf72 mutation carriers. a Immunohistochemistry shows p62, Rad23b and Mlf2 aggregates in the spinal cord (SC) of 6-month-old GA-CFP mice but not of wildtype mice. b Immunoflu-orescence stainings show p62, Rad23b and Mlf2 positive inclusions that co-localize with poly-GA in the spinal cord of 6-month-old
GA-CFP mice. c Immunohistochemistry detects specific Mlf2 aggregates in the frontal cortex (FCtx) and dentate gyrus (DG) of C9orf72 ALS/
FTLD patients. d Double immunofluorescence reveals colocalization of Mlf2 aggregates with poly-GA and phosphorylated TDP-43 inclu-sions in C9orf72 patients. Scale bars represent 20 µm
Acta Neuropathol
1 3
the poly-GA component of pathology in C9orf72 ALS/
FTD patients, including the co-aggregation of poly-GA with p62, Rad23b and Mlf2.
Poly‑GA triggers mild TDP‑43 phosphorylation but no overt neuron loss
We next analyzed whether poly-GA expression drives neurodegeneration. Consistent with the expression pattern
of the Thy1 promoter, poly-GA was exclusively found in NeuN-positive neurons (Fig. 3a) and no expression was detectable in microglia or muscle fibers (Fig. S4f). How-ever, Nissl staining and NeuN immunostaining revealed no overt neuron loss in the spinal cord (Fig. 3b, c). Poly-GA was found in most choline acetyltransferase (ChAT) positive motoneurons in the anterior horn of the spinal cord (Fig. 3d), but ChAT immunostaining revealed no statistically significant loss of motoneurons at 6 months wildtype
wildtype
wt GA
0 5 10 15 20
wt GA
0 20 40 60 80 100
wt GA-CFP 0
500 1000 1500
GA-CFP Nissl
NeuN Neuron
count
n.s.
b c
GA-CFP a
GA-CT NeuNDAPI
GA-CT ChATDAPI
GA-CFP
d e GA-CFP
ChAT
f SC
SC SC
SC Motoneuron count
Area ofmotorneurons[µm2]
g wt GA
wt GA wt GA
n.s.
n.s.
wt GA
0 1 2 3 4 5
wt GA
0 5 10 15 20
h
pTDP-43 [ng/mg protein] pTDP-43 [ng/mg protein]
urea soluble sarkosyl soluble
*** n.s.
wtGA
wt GA
Fig. 3 GA-CFP mice show no evidence for neuronal loss but increased TDP-43 phosphorylation. a Double immunofluorescence of 6-month-old GA-CFP spinal cord tissue (SC) shows poly-GA inclu-sions exclusively in NeuN-positive cells. Scale bar represents 20 µm.
b, c Nissl staining and NeuN immunohistochemistry of 6-month-old GA-CFP and wildtype spinal cords. Scale bar represents 100 µm.
Quantitative analysis of NeuN-positive neurons shows no significant difference between wildtype and GA-CFP mice (nGA-CFP/wt= 3). d Immunostaining of poly-GA aggregates in choline acetyltransferase (ChAT)-positive motoneurons. Scale bar represents 20 µm. e–g Immunohistochemistry and quantitative analysis of ChAT-positive
motoneurons of 6-month-old mice in the anterior horn of the spinal cord revealed no statistically significant differences in neuron count (nGA-CFP/wt mice = 4) and size (nGA-CFP motoneurons = 228; nwt motoneu-rons = 195). Neurons were counted as described in the “Statistics”
section. Scale bar represents 100 µm. h Immunoassay for phos-phorylated TDP-43 in sarkosyl (1%)-soluble or urea (7M)-soluble spinal cord fractions from 6-month-old GA-CFP or wildtype (wt) mice. n(wt)= 12; n(GA-CFP)= 8. Unpaired t test (two-tailed; sarkosyl t = 0.3034, df = 18; urea t = 4.172, df = 18). Data are shown as box plot with whiskers at the 1st and 99th percentile. ***p < 0.001, ns not significant
Acta Neuropathol
(Fig. 3e–g). Furthermore, the size and shape of motoneu-rons in GA-CFP mice did not show signs of degeneration and were not discernible from the corresponding neurons in wildtype mice.
Next, we analyzed another neuropathological hallmark of ALS, namely TDP-43 phosphorylation, in aged GA-CFP mice. We quantified levels of phosphorylated TDP-43 (at serines 409 and 410) in the spinal cord of mice at 6 months of age by ELISA. Phosphorylated TDP-43 levels were approximately threefold higher in the urea-soluble (but sarkosyl-insoluble) fraction of GA-CFP mice compared to wildtype mice, but no difference was detected in the sarko-syl-soluble fraction (Fig. 3h). While mature TDP-43 inclu-sions and cytoplasmic TDP-43 mislocalization were not observed in GA-CFP mice, even at 12 months of age (Fig.
S4g, h; Table S1), these data may nonetheless indicate that poly-GA contributes to the onset of TDP-43 pathology.
Poly‑GA induces microglia activation without astrogliosis
Next, we analyzed the GA-CFP mice for signs of neuroinflam-mation. Immunohistochemistry for CD68 and Iba1 in 1- and 6-month-old mice revealed strong upregulation of these mark-ers of phagocytic microglia in the spinal cord of 6-month-old GA-CFP mice (Fig. 4a, b) while little microglia activation was detectable at 1 month of age. Quantitative RT-PCR fur-ther confirmed enhanced mRNA expression of CD68 and Iba1 (Fig. 4c, d). In contrast, GFAP immunostaining and mRNA expression analysis revealed no signs of poly-GA-induced astrogliosis (Fig. 4e, f). Furthermore, in the neocortex of GA-CFP mice, a region lacking poly-GA pathology, no activation of CD68, Iba1 or GFAP was detected (Fig. S5a). Thus, neu-ronal poly-GA expression induces regional microglia activa-tion in the absence of overt neuron loss in GA-CFP mice.
GA‑CFP mice develop progressive motor deficits
To analyze the functional consequences of poly-GA pathology and its downstream effects, we performed in depth phenotyping of mice at 3–4 months of age when poly-GA pathology starts building up. Open field testing revealed no signs of anxiety as GA-CFP and wildtype mice spent a similar time in the center of the arena, but the decreased rearing activity of GA-CFP mice may indicate decreased motor performance or alterations in the relevant brain circuits (Fig. 5a). The overall distance traveled was not significantly reduced in GA-CFP mice.
However, when walking across a beam ladder with irreg-ular step distance, male GA-CFP mice showed signifi-cantly more hind paw slips, without a difference in total traversing time (Fig. 5b). In the SHIRPA analysis, the majority of GA-CFP mice showed hind paw clenching
(84% compared to 35% of controls; Fig. 5c) and a broad, wagging gait (77% compared to 24% of controls). Grip strength of fore and hind limbs measured individually or combined was normal (data not shown). Decreased acoustic startle response and prepulse inhibition in GA-CFP mice suggest impaired sensorimotor gaiting and recruitment ability (Figs. S5b/c).
We repeated a subset of tests in 13–14-month-old mice.
At this age, both male and female mice took significantly longer to cross the beam ladder and slipped more often with their hind paws (Fig. 5d). In the SHIRPA analysis, 87% of GA-CFP mice showed hind paw clenching compared to 8%
of controls and abnormal gait (93% compared to 38% of controls) (Fig. 5e). However, out of the sixty mice used for this study, only three control mice and one GA-CFP mouse had died unexpectedly until the age of 16 months.
We additionally used an independent, smaller cohort of mice from 2–6 months of age for a longitudinal study focusing on memory function and motor coordination.
While GA-CFP and wildtype mice initially gained weight normally for the first 6 months (Fig. S5d), transgenic mice showed reduced body weight compared to wildtype litter-mates after 15 months (male wildtype 38.6 g ± 3.1, male GA-CFP 32.1 g ± 1.7, female wildtype 31.1 g ± 4.0, female GA-CFP 26.4 g ± 2.3; ANOVA genotype effect p < 0.001). Hippocampus-dependent spatial memory of all mice was tested weekly using the Barnes maze; at all time-points, GA-CFP mice performed like their wildtype littermates, indicating that their spatial memory was not impaired (Fig. S5e). Moreover, we used the accelerated rotarod as a test for overall motor performance. Within 6 months, no difference in the performance of motor plan-ning and physical condition was observed between GA-CFP mice and wildtype littermates (Fig. S5f). To measure balance and coordination more directly, mice were made to walk across a balance beam every week. The beam walk revealed progressive deficits in male and female transgenic mice (Fig. 5f, g). GA-CFP mice and their wildtype litter-mates showed similar performance from week 8 to 17, but from week 20 onward GA-CFP mice took a significantly longer time to cross the beam (Fig. 5f) or failed the test entirely by dropping down (Fig. 5g).
Taken together, GA-CFP mice develop progressive gait and balance impairments, while muscle strength and spatial memory are spared. These findings are consistent with the poly-GA pathology found exclusively in spinal cord, brain-stem and cerebellum.
Discussion
We generated the first germline transgenic mouse model of pure DPR pathology without (ggggcc)n repeat RNA