3 Material and methods
3.1 Material
3.1.3 Provided kit systems
Kit name Catalogue number Manufacturer
Absolute Blue qPCR Mix #AB-4138/B Thermo Fisher Scientific Cell proliferation ELISA BrdU
(colorimetric)
#11644807001 Roche Scientific
(Penzberg, Germany)
HotStar Taq Mastermix Kit #69504 Qiagen
(Hilden, Germany) iScript Select cDNA Synthesis
Kit
#170-8897 Bio-Rad
(Munich, Germany)
Material and methods 20
iQ SYBR Green Supermix #172-5006CUST Bio-Rad
(Munich, Germany) TaqMan® MicroRNA Reverse
Transcription Kit
#4366597 Applied Biosystems
(Foster City, CA, USA) 3.1.4 Solutions and buffers
3.1.4.1 Cell culture media, components and used cells Table 3.6: Cell type used in this work
cell type Catalogue number Manufacturer
Human Cardiac Fibroblasts (HCFs)
C-12375 PromoCell
(Heidelberg, Germany) Mus musculus cardiac cell line
derived from AT-1 mouse atrial cardiomyocyte tumor lineage (HL-1)
Claycomb WC,
LSU Health Sciences Center (New Orleans, LA, USA) Human Embryonic Kidney Cells
(HEK-293)
Cooperation-Partner Prof.
Engelhardt
(TU Munich/University of Würz-burg, Germany)
Table 3.7: Cell culture medium and components
Medium/Component Catalogue number Manufacturer
Claycomb medium #51800C Sigma-Aldrich (Saint Louis, MI,
USA) Dulbecco´s Modified Eagle
Medium (DMEM)
#41965039 Life Technologies (Darmstadt, Germany)
Dulbecco´s Modified Eagle Medium (DMEM) phenol red free
#21063029 Life Technologies (Darmstadt, Germany)
Dulbecco´s Phosphate Buffered Saline (D-PBS)
#14190094 Life Technologies (Darmstadt, Germany)
Fetal Bovine Serum (FBS) #10270-106 Life Technologies (Darmstadt, Germany)
Fibroblast Basal Medium 3, phenol red-free
#C23235 PromoCell (Heidelberg,
Ger-many)
Fibroblast Growth Medium 3 Kit #C23130 PromoCell (Heidelberg, Ger-many)
L-Glutamine #56-85-9 Sigma-Aldrich (Saint Louis, MI,
USA)
Norepinephrine bitartrate salt #A0937-1G Sigma-Aldrich (Saint Louis, MI, USA)
Opti-MEM® #51985026 Life Technologies (Darmstadt,
Germany)
Penicillin-Streptomycin #15140-122 Life Technologies (Darmstadt, Germany)
Trypsin-EDTA 0.05% #25300-054 Life Technologies (Darmstadt,
Germany)
Table 3.8: Fibroblast Growth Medium-3 (FGM-3) for HCFs
Component amount/concentration of
supplement/
500 ml FGM-3
FBM-3 450 ml
FBS 0.1 ml/ml
Basic Fibroblast Growth Factor (bFGF) (recombinant human)
1 ng/ml
Insulin (recombinant human) 5 µg/ml Penicillin/Streptomycin 5 ml
Table 3.9: Claycomb medium for HL-1
Component amount/concentration of
supplement/
500 ml Claycomb medium
Claycomb medium 500 ml
FBS 0.10 ml/ml
Norepinephrine 0.1 mM
L-glutamine 2 mM
Penicillin/Streptomycin 100 U/ml: 100 µg/mL
Table 3.10: DMEM medium for HEK-293
Component amount/concentration of
supplement/
500 ml DMEM
DMEM 450 mL
FBS 50 mL
Penicillin/Streptomycin 5 mL 3.1.4.2 SDS-Page and Western blot
Table 3.11: Gel recipe for collection gel (SDS-PAGE, 12%)
Component volume/gel
1.5 M Tris pH 8.8 / 0.4% (w/v) SDS
1.95 ml
Rotiphorese® Gel 30 3.0 ml
dH2O 2.5 ml
10% (w/v) APS 50 µl
TEMED 5 µl
Material and methods 22
Table 3.12: 10x SDS PAGE electrophoresis buffer
Component Amount/L Final concentration (10x)
Glycine 144 g 1.92 M
SDS 10 g 1% (w/v)
Tris 30 g
ad dH2O to 1000 ml
250 mM
Table 3.13: 10x Western Blot transfer buffer
Component Amount/L Final concentration (10x)
Glycine 144 g 1.92 M
Tris 30 g
ad dH2O to 1000 ml
250 mM
Table 3.14: 1x TBST Western blot washing buffer
Component Amount/L Final concentration (10x)
NaCl 2.42 g
Tris 8.0 g 66.67 mM
Tween20 1 ml
ad dH2O to 1000 ml, adjust pH 7.6 with HCl
0.1% (v/v)
Table 3.15: Luminol reagent for Western blot detection
Solution volume per blot
25 mg luminol in 50 ml 0.1 M Tris-HCl pH 8.6
2 ml
10 mg p-cumaric acid in 10 ml DMSO
0.8 ml
H2O2 (30% (v/v)) 2.4 µl
dH2O 3 ml
3.1.5 Oligonucleotides and probes Table 3.16: siRNA applied in this work
siRNA Catalogue number Manufacturer
SignalSilence® ATG7 siRNA #6604 Cell Signaling Technology
(Danvers, MA, USA)
SignalSilence® Control siRNA #6568 Cell Signaling Technology
(Danvers, MA, USA)
Table 3.17: mirVana miRNA mimic applied in this work
mirVana miRNA mimic Assay ID Manufacturer
hsa-miR-27a-5p MC13096 Life Technologies (Darmstadt,
Germany)
hsa-miR-26a-1-3p MC12758 Life Technologies (Darmstadt,
Germany)
hsa-miR-29a-5p MC13096 Life Technologies (Darmstadt,
Germany)
hsa-miR-129a-5p MC10195 Life Technologies (Darmstadt,
Germany)
hsa-miR-181a-3p MC10381 Life Technologies (Darmstadt,
Germany)
hsa-miR-671-5p MC12599 Life Technologies (Darmstadt,
Germany) mirVana miRNA Mimic negative
control
#4464058 Life Technologies (Darmstadt,
Germany) Table 3.18: TaqMan miRNA/gene detection assays applied in this work
(pri-)miRNA/gene Assay ID Manufacturer
Cel-miR-39 000200 Applied Biosystems
(Foster City, CA, USA)
hsa-miR-26a-1-3p 002443 Applied Biosystems
(Foster City, CA, USA)
hsa-miR-27a-5p 002445 Applied Biosystems
(Foster City, CA, USA)
hsa-miR-29a-5p 002447 Applied Biosystems
(Foster City, CA, USA)
hsa-miR-129a-5p 000590 Applied Biosystems
(Foster City, CA, USA)
hsa-miR-181a-3p 000516 Applied Biosystems
(Foster City, CA, USA)
hsa-miR-451a 001141 Applied Biosystems
(Foster City, CA, USA)
hsa-miR-671-5p 197647_mat Applied Biosystems
(Foster City, CA, USA)
hsa-miR-4783-5p 464947_mat Applied Biosystems
(Foster City, CA, USA)
RNU48 001006 Applied Biosystems
(Foster City, CA, USA) Table 3.19: QuantiTect Primer assays applied in this work
Gene Catalogue Number Manufacturer
hsa COL1A1 QT00037793 Qiagen (Hilden, Germany)
hsa COL3A1 QT00058233 Qiagen (Hilden, Germany)
hsa CTGF QT00052898 Qiagen (Hilden, Germany)
hsa TGFβ QT00000728 Qiagen (Hilden, Germany)
Material and methods 24
Table 3.20: PCR Primers
Gene sequence forward primer (5’-3’) sequence reverse primer (5’-3’)
hsa 18S rRNA AGTCCCTGCCCTTTGTACACA GATCCGAGGGCCTCACTAAAC
hsa α-SMA CCTGACTGAGCGTGGCTATT GATGAAGGATGGCTGGAACA
hsa MMP2 TGACATCAAGGGCATTTCAGGAGC GTCCGCCAAATGAACCGGTCCTTG
hsa p21 GCAGACCAGCATGACAGATTTC GGATTAGGGCTTCCTCTTGGA
3.1.6 Antibodies, enzymes and standards Table 3.21: Primary antibodies applied in this work
Antibody Catalogue Number Manufacturer
αAPG7 sc-376212 Santa Cruz Biotechnology
(Santa Cruz, CA, USA)
αCOL1A1 HPA008405 Sigma-Aldrich
(Saint Louis, MI, USA)
αCTGF ab6992 Abcam
(Cambridge, UK)
αGAPDH ab8245 Abcam
(Cambridge, UK)
αNBR-1 9891 Cell Signaling Technology
(Danvers, MA, USA)
αLC3B ab48394 Abcam
(Cambridge, UK)
αSMA 59 Abcam
(Cambridge, UK)
α SQSTM1/p62 56416 Abcam
(Cambridge, UK) Table 3.22: Secondary antibodies applied in this work
Antibody Catalogue Number Manufacturer
α-mouse-IgG-HRP 7076 Cell Signaling Technology
(Danvers, MA, USA)
α-rabbit-IgG-HRP 7074 Cell Signaling Technology
(Danvers, MA, USA) Precision Protein™ StrepTactin
HRP conjugate
161-0380 Bio-Rad
(Munich, Germany)
3.2 Methods
Different kinds of methods were conducted including cell culture, molecular and protein bio-chemistry and cell biology experiments.
3.2.1 Cell culture
Cell culture experiments comprised cultivating and passaging of different cell lines, treating cells with selected natural compounds as well as miscellaneous transfection assays.
3.2.1.1 Cultivation and passaging of cells
Human Cardiac Fibroblasts (Invitrogen) were cultured in fibroblast basal medium (FBM-3) supplemented with 10 % (v/v) fetal bovine serum (FBS), supplements and 1 % (v/v) penicil-lin/streptomycin (normal medium). Human embryonic kidney cell line (HEK293) was grown in DMEM media with high glucose and stable glutamine supplemented with 10% (v/v) FBS and 1% (v/v) penicillin/streptomycin. Mus musculus cardiac cell line derived from AT-1 mouse atrial cardiomyocyte tumour lineage (HL-1) was cultured in Claycomb medium supplemented with 10% (v/v) FBS, 0.1 mM (v/v) norepinephrine, 2 mM (v/v) L-glutamine and 1% (v/v) peni-cillin/streptomycin. After reaching a state of 70-90 % confluence, cells were splitted and seeded into appropriate plates for experiments. For passaging, cells were washed with warm PBS and 3 mL/T75 flask of pre-warmed 1× Trypsin/EDTA was added. After 3 min of incuba-tion at 37°C, attachment of cells was visualized by microscopy control and the digesincuba-tion was stopped by adding 8 mL/T75 flask of cold DMEM containing 10 % (v/v) FBS. The suspension was transferred into a new tube and centrifuged at 300 × g for 5 min at 4°C. After discarding the supernatant, the cell pellet was re-dissolved in 1mL/T75 flask cell culture medium. Count-ing of cells was performed by dilutCount-ing 10 µL of cell suspension in 10 µL Trypan blue-Solution (v/v), filling 10 µL of mixture in one counting chamber and placing the chamber into the au-tomatic cell counter (Invitrogen). After adjusting the cell concentration, the needed amount of cell suspension was transferred into new plates. Cells were grown in a humidified incubator with 5 % CO2 and 37°C. Experiments with HCFs were performed using cells at passage 6 to 9.
3.2.1.2 Treatment of cells with natural compounds
Cells were treated with the natural compound Geldanamycin, Anisomycin, Bufalin, Gitoxigen-in, 10-HydroxycampothecGitoxigen-in, Piplartine, all provided by green pharma company, Quercetin (Sigma Aldrich), Spermidine (Sigma Aldrich) and Torin 1 (Merck Millipore). Normal medium with 10 % (v/v) FBS, containing defined amount of DMSO or H2O, served as control. Three days before treatment, cells were split and grown in fresh cell culture medium to reach 70-80% confluence. The lyophilized natural compounds Geldanamycin, Anisomycin, Bufalin, Gitoxigenin, 10-Hydroxycampto-thecin, Piplartine and Quercetin were diluted in DMSO re-ceiving 6 mM (w/v) stock solutions which were sterile filtered and stored at -80°C. Torin 1 was stored at -20°C as 2 mM stock diluted in DMSO. The defined amount of stock solution was diluted in fresh cell culture medium to achieve the determined concentration of natural compound. For accomplishing one DMSO control, the defined amount of stock solution was calculated for the highest concentration of natural compound, usually 20 µM Quercetin, and pre-dilution of the other stock solutions was performed each time of experiment to maintain the same volume added to the cell culture medium.
Material and methods 26
The same procedure was implemented for Spermidine being solved in water, stored at -20°C and owning its sole H2O control. For treatment, supernatant of cells was replaced by new cell culture medium supplemented with natural compound stock/diluted stock solution. After 24 h of incubation, cells were processed as needed for the different assays.
3.2.1.3 Transfection assay
HCFs were temporarily transfected using small noncoding RNAs (miRNAs) or small inhibitory RNAs (siRNAs) according to manufacturer´s protocol. One day before siRNA transfection and two days before miRNA transfection, cells were seeded into 6-well-plates (siRNA trans-fection) respectively 12-well-plates (miRNA transtrans-fection) to reach 70-80% confluence. 150 nM siRNA or 30 nM miRNA were mixed with OptiMEM-I. In a separate tube, 4 µL/6-well re-spectively 2 µL/12-well Lipofectamine2000TM were combined with OptiMEM-I. After incuba-tion of 5 min, the same amount of siRNA/miRNA complex was joined with Lipofec-tamine2000TM mixture, gently mixed and incubated for 20 min at RT. After removing the su-pernatant, 1 mL/6-well respectively 500 µL/12-well of this combination was added to the cells and incubated for 4 hours under humidified conditions at 37°C and 5% CO2. Afterwards, the transfection complex was replaces by fresh FBM-3 supplemented with 10 % FBS (v/v), 1 % penicillin/streptomycin (v/v) and supplements. Transfection efficiency was monitored 48 h post-transfection by rt-PCR analysis.
3.2.2 Molecular biochemistry
Molecular biochemistry experiments included isolation of total RNA, followed by reverse transcription and quantification of mRNA expression via real-time polymerase chain reaction.
MiRNA next generation sequencing was performed to investigate miRNA profile.
3.2.2.1 Isolation of total RNA
After 24 h of treatment, HCFs were taken up in 1000 µL Trifast and incubated for 5 min at room temperature (RT). Homogenization was performed by pipetting up and down and the solution was transferred into a new tube. After adding 200 µL Chloroform, the reaction mix-ture was shaken by hand for 15 seconds, then incubated for 8 min at RT and centrifuged at 12.000 × g for 15 min at 4°C. For precipitation, 500 µL of the aqueous phase was combined with 500 µL Isopropanol in a new tube. After incubating for 15 min on ice, the reaction mix was centrifuged again at 12.000 × g for 10 min at 4°C. The pellet was washed in 1 mL 75%
(v/v) ethanol, followed by centrifugation at 12.000×g for 10 min at 4°C. After drying, the RNA pellet was dissolved in 20 µL DEPC-treated water. The amount of RNA was measured with Gene 5 program, Take 3 session, using the microplate reader in a photometer (Biotek). For determination of RNA concentration, the absorbance was measured at 260 nm (A260) and 280 nm (A280).
An A260/A280 ratio between 1.8 and 2.0 indicated a sufficient purity of RNA. The samples were stored at -80°C for further use.
3.2.2.2 Reverse Transcription for mRNA expression analysis
Reverse transcription of mRNA was performed using iScript select cDNA synthesis kit (Bio-Rad) in conformity with the manufacturer´s instructions.100-1000 ng total RNA was tran-scribed using random primer for enlarging synthesis of cDNA and being able to use 18S rRNA for normalization in real-time PCR. For single sample, 4 µL 5x iScript reaction mix, 2 µL random primer and 1 µL iScript reverse transcriptase were combined and supplemented with 13 µL of defined amount of RNA diluted in nuclease free water. Synthesis of cDNA was realized with the PCR Thermocycler (Biometra) including subsequent conditions: 5 min at 25°C, 30 min at 42°C, 5 min at 85°C and hold at 4°C. Samples were diluted 1:3 with nucle-ase free water and stored at -20°C until further handling.
3.2.2.3 Quantification of mRNA expression via real-time polymerase chain reaction Real-time polymerase chain reaction (real-time PCR) was performed to analyse variation in gene expression due to different treatment conditions utilizing iScript select cDNA synthesis kit (Biorad). During this process, nucleic acids are amplified and quantified by the detection of intercalated fluorescent dye. Fluorescence increases proportionally with the amount of PCR-products. According to the manufacturer’s instructions, 5 µL iQ SYBR Green Supermix, containing the fluorescent dye SYBR Green, 2.5 µL nuclease free water and 0.5 µL 10 µM forward and reverse primer of interest or 10× Quantitect (Qiagen) primer assays were mixed for each sample and pipetted into a 384-well-plate (Biorad). The reaction mixture was sup-plemented with 2 µL cDNA. 18S rRNA was amplified as internal reference. In order to check for potential primer artefact, samples were pipetted in duplicates and as blanks (water in-stead of cDNA). Standard dilution series (1:1, 1:5, 1:25, 1:125) were prepared for each inves-tigated gene to generate a standard curve for relative quantification. 45 cycles of denatura-tion, annealing of forward and reverse primer and DNA elongation with a thermostable DNA polymerase were performed using CFX-384 real-time thermal cycler (Bio-Rad). The cycling condition were 95°C for 3min, 45 cycles of 95°C for 15 sec, 60°C for 30sec and 72°C for 40 sec, finally producing the melting curve and holding at 15°C.
3.2.2.4 miRNA next generation sequencing
Isolation of total RNA was performed suspending HCFs in Qiazol (Qiagen) instead of Trifast and following the manufacturers protocol (miRNeasy mini kit). miRNA next generation se-quencing was performed by bioinformatics core facility of Dr. Geffers (Helmholtz centre, Braunschweig).
Material and methods 28
3.2.3 Protein biochemistry
Protein biochemistry encompassed isolation of proteins, determining protein concentration and separating proteins by SDS Polyacrylamide gel electrophoresis to further investigate discrepancy of different treatment conditions by western blot.
3.2.3.1 Isolation of proteins
Human cardiac fibroblasts were harvested, prior 24 h of treatment. The supernatant was dis-carded and cells were washed two times in PBS. After being detached with 400 µL Tryp-sin/EDTA at 37°C, trypsinization was stopped with DMEM containing 10 % (v/v) FBS. The suspension was transferred into a new tube and centrifuged at 300 × g for 5 min at 4°C. The pellet was suspended in PBS and transferred into a new tube. After centrifuging at 4000 rpm for 5 min at 4°C, the pellet was either shock-frozen by liquid nitrogen and stored at -80°C or processed. Cells were lysed by suspending the cell pellet in 60 µL cell lysis buffer supple-mented by 1mg/ml protease-blocker Pefabloc SC on ice for 10 minutes. This procedure was supported by pipetting up and down as well as shock-freezing the samples in liquid nitrogen and thawing for two times. The homogenate was centrifuged at 8000×g for 5 min at 4°C. The supernatant, containing the soluble proteins, was transferred into a new tube and shock-frozen in liquid nitrogen to be stored at -80°C.
3.2.3.2 Determination of protein concentration
The concentration of protein was quantified by Bradford Assay. 1 µL of protein solution was mixed with 800 µL H2O and 200 µL RotiQuand and incubated for 5 minutes. The absorption of the sample was measured against a reference, containing 1 µL lysis buffer instead, in an UV spectral photometer at 575 nm. The protein concentration was determined by comparing the specific absorption rate with a standard curve of bovine serum albumin [0.2-20 mg/ml].
3.2.3.3 SDS Polyacrylamide gel electrophoresis (SDS-Page)
Based on their relative molecular weight, proteins can be separated by using SDS-Page. 15 µg protein solution was mixed with 6× loading Buffer supplemented by 1:5 DTT. DTT is nec-essary to reduce disulphide bridges. The loading buffer contains SDS, an anionic detergents, which supports the denaturation of secondary and tertiary structure by interacting with non-covalent binding and likewise changes the electrical charge to a negative one. Both contents, DTT and SDS, are necessary to obtain separation by molecular weight and not by intrinsic electrical charge. The proteins were completely denatured through heating the reaction mix at 95°C for 5 minutes. 30 µL of this protein suspension was loaded into one lane of 12%
acrylamide gel. As a reference, 2.5-4 µL Precision Plus Protein WesternC Standard was
ap-plied. The electrophoretic separation was carried out in an electrophoretic chamber for 90-120 min at 20-30 mA each gel in 1× SDS-PAGE buffer.
3.2.3.4 Western Blot
The wet electroblotting method was used to transfer separated proteins from the acrylamide gel to the polyvinylidene difluoride membrane (PVDF). Before starting the transfer, the PVDF membrane was activated with 100% Methanol for one minute. After being rinsed in deionised water for two minutes, the PVDF membrane, together with foam pads and filter paper, was incubated with Western Blot transfer buffer. The Western Blot stack was assembled. The transfer was performed at constant 30 V overnight at 4°C in Western Blot transfer buffer.
The next day, the PVDF membrane was cut to have pieces containing different areas (de-pending on the size of protein) of interest and then blocked with 5 % milk in 1× TBST for one hour. After rinsing the membranes three times in 1× TBST, the pieces of membranes were incubated with their defined antibody solution made out of 5% milk in 1× TBST and the nec-essary amount of antibody (Table 3.23).
Table 3.23: Concentration of primary and secondary antibodies used for western blot
protein primary antibody secondary antibody molecular weight
APG7 1:500 mouse monoclonal anti-human
1:10000 HRP-conjugated
anti-mouse 71 kDa
COL1A1 1:1000 rabbit polyclonal anti-human
1:10000 HRP-conjugated
anti-rabbit 100, 150 kDa
CTGF 1:2500 rabbit polyclonal anti-human
1:10000 HRP-conjugated
anti-rabbit 37-78 kDa
GAPDH 1:20000 mouse monoclonal anti-human
NBR-1 1:1000 rabbit monoclonal anti-human
SQSTM1/p62 1:5000 mouse monoclonal anti-human
1:10000 HRP-conjugated
anti-mouse 62 kDa
Material and methods 30
The incubation time varied depending on the antibody from 1 hour to overnight. Next, the membranes were rinsed in 1× TBST for three times and then incubated with the correspond-ing secondary antibody conjugated with horseradish peroxidase (HRP) (Table 3.23) for one hour. Subsequently, the membranes were rinsed three times in 1× TBST. To detect the bands of antibodies, the membranes were incubated with 3 mL H2O, 2 mL Luminol solution, 800 µL Coumaric acid and 2.4 µL H2O2 for 2 minutes and developed via X-ray films in the dark. The time of development was dependent on the antigen. The intensity of signal was analysed by ImageJ.
3.2.4 Cell biology
Cell biology experiments included analysis of cell proliferation by BrdU-assay as well as analysis of cell death and cell cycle by flow cytometry.
3.2.4.1 Cell proliferation assay
Analysis of proliferation of HL-1, HEK293 and HCFs was performed using Cell Proliferation ELISA (Roche) based on Bromodeoxyuridine (BrdU) incorporation during DNA synthesis and colorimetric quantification according to the manufacturer´s instructions. BrdU interacts as a pyrimidine analogue and is incorporated into the DNA instead of thymidine during the S-phase of DNA synthesis. This technique allows perceiving cell proliferation indirectly by im-munoassay. Three days before starting, cells were seeded into 96-well plates to reach 70-80% confluence. Starting the assay, BrdU 1% labelling solution and the defined amount of cell culture medium was mixed in a tube to achieve a final concentration of 10 µM BrdU. The prepared BrdU labelling solution was portioned into new tubes and supplemented by the needed amount of stock solution/diluted stock solution of natural compound (see 2.2.1.2 treatment of cells with natural compound). Cells were labelled with BrdU by incubating with prepared medium containing BrdU and defined amount of compound for 24 h under humidi-fied conditions at 37°C and 5% CO2. After removal of labelling solution, cells were fixed and denatured by adding 200 µL/well FixDenat solution and incubation for 30 min at RT. As anti-body, Anti-BrdU-POD solution was prepared by diluting anti-BrdU POD stock solution 1:100 with antibody dilution solution. This solution compromises monoclonal antibody from mouse-mouse hybrid cells conjugated with peroxidase. The FixDenat solution was replaced by anti-BrdU-POD solution and incubated for 90 min at RT. After three times of washing with PBS to remove free BrdU-antibody-particles, 100 µL/well substrate solution was added and incubat-ed in the dark. Substrate conversion by peroxidase was detectincubat-ed photometrically with a mul-tiwell reader after 15 min of incubation time for HEK293 and HL-1 and 30 min for HCFs. As reference, untreated cells of each cell line passed through the complete process.
Optical density was quantified at 370 nm and values directly correlated to the amount of DNA synthesis and hence, the number of proliferating cells in each well.
3.2.4.2 Flow cytometry for cell death and cell cycle analysis
Flow cytometry analysis was performed using Guava easyCyte Flow cytometer applying dif-ferent assays as described in 2.2.4.1. and 2.2.4.2. . Cells were harvested and fixed as re-quired in each assay. Multiple physical characteristics of single cells are measured by flow cytometry including analysis of relative size, relative granularity/internal complexity and retive fluorescence intensity of each particle. While flowing through a microcapillary, cells la-belled with specified fluorophores are excited by laser. The detected emitted fluorescence is converted into electronic signals and processed by a software.(86,87) Different subgroups of cells due to different treatments and thus different fluorescent labelling can be identified.
Within this thesis, cell death rate as well as cell cycle arrest was explored by flow cytometry.
Within this thesis, cell death rate as well as cell cycle arrest was explored by flow cytometry.