Steffi Gäbler-Schwarz1, Katharine M. Evans2, Paul K. Hayes3 and Linda K. Medlin4
1Alfred Wegener Institute for Polar and Marine Research, Am Handelshafen 12, D-27570 Bremerhaven, Germany, 2Royal Botanic Garden Edinburgh, 20A Inverleith Row, Edinburgh, EH3 5LR, UK, 3Faculty of
Science, University of Portsmouth, St Michael's Building, White Swan Road, Portsmouth PO1 2DT, UK,
4Observatoire Océanologique de Banyuls-sur-mer, Laboratoire Arago, BP 44, 66651 Banyuls-sur-mer, France
Abstract
We report the characterization of eight new microsatellite loci for the polar prymnesiophyte Phaeocystis antarctica using 89 strains isolated from all gyres within the Antarctic region.
The number of alleles for the eight loci ranged from five to 25. The mean observed and expected heterozygosities across the entire region ranged from 0.425 to 0.804 and 0,681 to 0.905, respectively. Calculations of observed heterozygosities for individual gyres ranged from 0.250 to 1.000.
Keywords: microsatellites, P. antarctica
117
Phaeocystis antarctica Karsten forms large, nearly monospecific blooms in seasonal ice zones and in Antarctic continental waters [1] where it plays an important role in biogeochemical cycles [2-4]. Verity et al. (2007) [5] suggested that this blooms could indicate a life-history strategy that is more successful than competing with other phytoplankton species.
Furthermore, this may also indicate that P. antarctica is genetically more diverse than other species. Thus, a set of genotypes could be dominant within a discrete set of environmental parameters. Preliminary genetic analysis [6] revealed high levels of genetic diversity within P.
antarctica populations from each of the three major continental gyres. Here we describe the characterization of eight new microsatellite loci for P. antarctica and report on the initial genetic characterisation of P. antarctica strains of different geographical origin.
Total DNA was isolated from P. antarctica (SK23, Antarctica, 63°15´S, 58°20´W, CSIRO Division of Fisheries, Hobart, Tasmania). Nuclear DNA was purified by ultracentrifugation through a caesium chloride-ethidium bromide density gradient [7-8] and used to create a microsatellite-enriched library, following a slightly modified protocol based on [9-10]. Cloned fragments were amplified using M13 forward and reverse primers (MWG Biotech) and sequenced using the BigDye® Terminator v3.1 Cycle sequencing Kit and ABI 3130xl sequencer (Applied Biosystems, Germany). In total, 150 clones were directly sequenced, 127 (85%) contained microsatellite motifs. The STAMP package [11] was used to design primer pairs flanking repeat regions. Altogether 119 non-redundant clones were used for marker design. For 28 loci, more than one primer set was automatically designed using PRIMER3 [12]. In total, 42 primer sets for these 28 loci were tested and PCR products were obtained for 34 of these (81%), yielding the expected amplification products for 24 of the 28 loci (86%):
the 20ȝL amplification reactions contained the components listed in Table 5.1 and 10–20 ng DNA template. The PCR conditions were an initial denaturation at 94°C for 1 min followed by 50 cycles of 94°C for 15 sec, Ta for 20 sec and extension of 70°C for 30 sec; followed by a final extension of 70°C for 10 min and 4°C on hold: a Mastercycler gradient thermal cycler (Eppendorf) was used for these reactions. Eight microsatellite primer pairs (Table 5.2) generated amplification products and 5´-fluorescently labelled forward primers (6-FAM or HEX) were used in repeat amplification reactions using clonal P. antarctica isolates from different sampling locations in the Antarctic (Prydz Bay, Antarctic Circumpolar Current, Amundsen Sea & McMurdo Sound, Weddell Sea). The size of the amplified products was determined against a ROX dye Standard (Applied Biosystems: size range - 50 to 500 bp).
Fragments were analysed on an ABI 3130xl sequencer and genotyping was performed with
Genemapper v4.0 (Applied Biosystems). The loci, primer sequences, core sequences, optimal annealing temperature, size range of the alleles, number of alleles observed, number of non-amplifying samples or null alleles and heterozygosity values for these loci are listed in Table 5.2. This data was retrieved using the software GenAlex, v6.2 [13]. The observed number of alleles at the eight loci ranged from six to 25 and the observed mean heterozygosities values (mean = entire ecosystem) ranged from 0.425 (SE 0.149) to 0.804 (SE 0.069), suggesting a high degree of diversity within the Antarctic region. GenAlex v6.2 was also used to detect deviations from Hardy-Weinberg equilibrium at each locus and to test for linkage equilibrium between pairs of loci. There was no evidence observed for linkage disequilibrium among loci.
Tests for departure from HWE were highly significant in all loci.
Acknowledgements
We thank S. Strieben and V. Levkov for their help with cultures of P. antarctica and the German Science Foundation (DFG ME 1480) for financial support.
119 References
1 El-Sayed SZ, Biggs DC & Holm-Hansen O: Phytoplankton standing crop, primary productivity and near-surface nitrogenous nutrient fields in the Ross Sea, Antarctica. Deep Sea Res. 1993, 30: 871-886
2 Smith WO, Carlson CA, Ducklow HW, Hansell DA: Growth dynamics of Phaeocystis antarctica-dominated plankton assemblages from the Ross Sea. Mar Ecol Prog Ser 1998, 168: 229-244.
3 Arrigo KR, Robinson DH, Worthen DL, Dunbar RB, DiTullio GR, VanWoert M, Lizotte MP: Phytoplankton community structure and the drawdown of nutrients and CO2 in the Southern Ocean. Science 1999, 283: 365-367
4 Vaillancourt RD, Sambrotto RN, Green S, Matsuda A: Phytoplankton biomass and photosynthetic competency in the summertime Metz Glacier Region of East Antarctica.
Deep-Sea Res II 2003, 50: 1415-1440.
5 Verity PG, Brussaard CP, Nejstgaard JC, van Leeuwe MA, Lancelot C, Medlin LK (2007) Current understanding of Phaeocystis ecology and biogeochemistry, and perspectives for future research. Biogeochemistry 83:311-330
6 Gaebler S, Hayes PK & Medlin LK: Methods used to reveal genetic diversity in the colony forming prymnesiophytes Phaeocystis antarctica, P. globosa and P. pouchetii – preliminary results. Biogeochemistry 2007, 83:19-27.
7 Doyle JJ, Doyle JL (1990), Isolation of plant DNA from fresh tissue. Focus, 12, 13-15 8 Lange M (1997), Phylogeny and Taxonomy of the genus Phaeocystis
(Prymnesiophyceae). Dissertation, University of Bremen 170 pp.
9 Evans KM, Hayes PK: Microsatellite markers for the cosmopolitan marine diatom Pseudo-nitzschia pungens. Mol Ecol Notes 2004, 4: 125-126.
10 Edwards KJ, Barker JHA, Daly A, Jones C, Karp A: Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques 1996, 20: 758-760.
11 Kraemer, L., Beszteri, B., Gäbler-Schwarz, S., Held, C., Leese, F., Mayer, C., Pohlmann, K., Frickenhaus, S.(2009). STAMP: Extensions to the STADEN sequence analysis package for high throughput interactive microsatellite marker design, BMC Bioinformatics, 10, 41.
12 Whitehead Institute for Biomedical Research/MIT Center for Genome Research
13 Peakall, R., and P. E. Smouse. (2006) GENALEX 6: genetic analysis in Excel.
Populationgenetic software for teaching and research. Molecular Ecology Notes 6:288-295.
121
Table 5.1 Microsatellites reaction Mastermix. *FAM/HEX
Microsatellites mix Volume
MilliQ 9.0 μl
10 x HotMaster Taq-buffer with 25 mM Mg2+
2.0 μl Eppendorf, Germany
F* primer (10 mM) 1.0 μl Thermo-elektron, Germany R primer (10 mM) 1.0 μl MWG, Germany
Betain (5 M) 2.0 μl Sigma, Germany dNTP´s (10 mM) 2.0 μl Eppendorf, Germany BSA (10x) 1.0 μl Biolabs, England HotMaster Taq-polymerase (5 U/μl) 0.15 μl Eppendorf, Germany
Table 5.2 Attributes of eight microsatellites loci isolated fromP. antarctica strain SK23 tested on 89 P. antarctica isolates. Ta=annealing temperature; allele size range (bp), NA=number of alleles, and N0 number of non-amplifying samples or null alleles. Isolates tested are from following regions: PB = Prydz Bay, ACC = Antarctic Circumpolar Current, AM & MS = Amundsen Sea & McMurdo Sound, WS = Weddell Se Locus Primer Sequence Core sequenceTa (°C)
Size range (bp)
NA N0 HO HE EcosytemNo. gen Pant_26F F 5’-GTT AAC TCA CGT GTT AGC GC-3’ (CA)n 54 66-265 14 3 0,667 0,865 PB 21 R 5’-GAG AGA CCA TGT GTT ATG GG-3’ 6 1 0,389 0,742 ACC 7 6 0 0,545 0,690 AM & MS 8 7 16 0,250 0,426 WS7 8,250 1,931
0,463 0,091
0,681 0,093
Mean SE
43 Pant_36R F GTTTAAAGAAGGCCAGTGAA (GT)n 46 84-400 18 12 0,800 0,922 PB 15 R CTGACTCCCAAAGCAATAAC 19 3 0,688 0,883 ACC 16 16 0 0,727 0,926 AM & MS 11 10 26 1,000 0,889 WS5 15,750 2,016 41 0,804 0,069
0,905 0,011
Mean SE
47 Pant_37F F 5’-GTA CAA GCC TCC CGC GT -3’ (GT)n 54 90-278 13 8 0,579 0,878 PB 16 R 5’-AGT ACA GAC CCC GTT ATG -3’ 11 4 0,500 0,765 ACC 11 16 0 0,818 0,905 AM & MS 11 7 27 0,600 0,840 WS5 11,750 1,887 39 0,624 0,068
0,847 0,030
Mean SE
43
Locus Primer Sequence Core sequenceTa (°C)
Size range (bp)
NA N0 HO HE Ecosytem No. Pant_42F F 5’-GAC AGC GAG GTG GAC CCT GG-3’ (GT) n 48 204-370 25 6 0,714 0,939 PB R 5’-ATA TTC AGG CAC TGA TCG AC-3’ 14 1 0,889 0,853 ACC 15 1 1,000 0,920 AM & MS 12 23 0,444 0,889 WS 16,500 2,901 0,762 0,121
0,900 0,019
Mean SE Pant_55F F 5’-AGG TTT CGC TTT AAT CAC AA-3’ (GA)n 50 84-360 12 18 0,444 0,901 PB R 5’-GAA TCA AGT ACC TCT CGC CTG-3 21 2 0,588 0,929 ACC 13 2 0,667 0,895 AM & MS 5 27 0,000 0,800 WS 12,750 3,276 49 0,425 0,149
0,881 0,028
Mean SE Pant1_121F F 5’-GAA ATA CTG CCT GAG CGA C-3’ (TG)nTA(TG)nTT(TG)nTA 48 138-328 12 4 0,609 0,813 PB R 5’-GAA GTA AAA CAG ACA CGG GA-3’ 13 1 1,000 0,815 ACC 16 2 0,667 0,883 AM & MS 11 9 0,826 0,816 WS 12,000 0,408 16 0,775 0,088
0,832 0,017
Mean SE Pant_135F F 5’-AAT GGA GGT GAT TGG TAG AC -3’ (TG)nTa(TG)nTACA 50 144-398 14 10 0,647 0,872 PB R 5’-TAT CTA AAC TGG CAC AAG CA -3’ 17 2 0,824 0,758 ACC 16 0 0,909 0,921 AM & MS 13 16 0,313 0,816 WS 15,000 0,913 28 0,673 0,132
0,842 0,035
Mean SE
Locus Primer Sequence Core sequenceTa (°C)
Size range (bp)
NA N0 HO HE Ecosytem Pant_142F F 5’-GAG AGA TTA CTG GGT GGT GA-3’ (TG) n54 60-163 10 3 0,458 0,784 PB R 5’-TTG ATC GCT TGG TTT TTA TT-3’ 10 1 0,944 0,847 ACC 8 1 0,700 0,790 AM & MS 16 1 0,387 0,733 WS 11,000 1,732 6 0,622 0,126
0,788 0,023
Mean SE
125
In preparation for submission