generated via RNA structure-mediated blockage of 3’ nucleases. The name and the genomic position of the end of the genes are given. The genomic positions of the most predominant 3’ end of these cDNAs accumulations were selected as potential mRNA 3’
ends and the corresponding 3’ UTR lengths (nt) were calculated. The optimal secondary structure and the minimum free energy (kcal/mol) of the inverted repeat (IR)/stem-loop predicted near the potential mRNAs 3’ ends were predicted using RNAfold Server (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi).
Potential inverted repeat (IR) near mRNA 3'end
Min. free energy (kcal/mol)
Comments/Reference
rps19 + 490 573 83 AAAAUACCCAAUAUCUUGCUAGAACAAGAUAUUGGGUAUUUU
((((((((((((((((((...)))))))))))))))))) -23.1 psbA - 619 532 87 AAAAUACCCAAUAUCUUGUUCUAGCAAGAUAUUGGGUAUUUU
(((((((((((((((((((....))))))))))))))))))) -25.2 Memon, et al., 1996 psbC + 11589 11659 70 UGGCUCGGUUAUUCUAUCUAGCCGAGCCA
(((((((((((...))))))))))) -18
psbM + 17320 17456 136 UAAAGUGUGGUAGAAAGAACUACAUAUAGUUUUUUCUACGACACUUUA
((((((((.(((((((((((((....))))))))))))).)))))))) -24.9 rpoC1 + 25403 25461 58 UCGGCGAUGCCCCUCCCCUUUGCUUUCGGGGGGCAUUCCGA
((((.((((((((((...)))))))))))))) -21.7
rps14 - 36940 36822 118 CCCUCUUUACCAUUCUGUAUAAAUGGACUAUUCUAUUUGUAUAGAUAUGGUAGAGGG
((((((..(((((((((((((((((((....)))))))))))))).))))))))))) -28.8 Kim, et al., 1993 rbcL + 56378 56505 127 UCGGCUCAAUCUUUUUUUUUAUAAAAAAGAUUGAGCCGA
(((((((((((((((((...))))))))))))))))) -24.7 Calie and Manhart, 1994 petA + 61333 61601 268 UCGGCACAAGAAAAAGGCUUUUUCUUGUGCCGA
(((((((((((((((...))))))))))))))) -20.2
APPENDICES | 149
psbJ - 62154 62066 88 CGGGUCCUUACCCCCUUUAUCUGAUUAGAGCGGAAAGGACCCG
(((((((((..((.(((((...))))).)).))))))))) -20.7 rps18 + 66774 66897 123 UUCCCGGAGUUCCCUCUCCGGGAA
(((((((((...))))))))) -16.4
psbT
(psbN) + 71208 71250 42 UAAGAAGUCUCCCAGAUAGGGGGACUUCUUA
(((((((((((((...))))))))))))) -20.1
the stem loop structure maps downstream of psbN on the opposite strand; may stabilize the psbN mRNA as well ndhD - 108033 107918 115 UUGAGAACCCUUUGAGAAGGCGCUCAAGGGGUUCUCAA
((((((((((((((((...)))))))))))))))) -25.4 3'-RACE (Appendix H) psaC - 109622 109566 56 ACCGAAGAAGCCUGUGCUCGAAAUAAUCGAGCACGGGCUUUUCUGGU
((((.((((((((((((((((...)))))))))))))))).)))) -31.5 cRT-PCR (Appendix H)
150 | APPENDICES
Appendix J: Potential mRNA 3’ termini revealed by sRNAs resembling PPR/PPR-like protein footprints. Unstructured sRNAs resembling the footprints of PPR/PPR-like proteins mapped downstream of 14 genes reveal potential mRNA 3’ termini.
These mRNA 3’ ends are proposed to be generated via protein-mediated blockage of 3’ nucleases. The gene name, strand, and the gene end genomic position are listed. In most cases, sRNAs represent populations with ends mapping within several nucleotides.
The genomic positions of the most predominant 3’ end of the associated sRNAs were assigned as the potential mRNA 3’ ends and the corresponding 3’ UTR lengths (nt) were calculated. The references for the eight of the barley mRNA 3’ ends, which are in agreement with 3’ termini mapped in other species, are given. Six were experimentally verified as 3’ termini in this study.
Gene Strand Gene end mRNA 3' end
3' UTR
length sRNA associated mRNA 3' ends Reference
rps16 - 5027 4890 137 TATCGTGCCAATCCAACATAAGCCCCT 3’-RACE (Appendix H)
atpI + 32091 32632 541 ATTGTATCCTTAACCATTTCTTTT Pfalz, et al., 2009; Prikryl, et al., 2011 atpF + 34744 34805 61 AATTTAGGCATTATTTTTCCCCTT Pfalz, et al., 2009
ycf3 - 42552 42443 109 AGAATTTCATTATATCCATTTCTTAT 3’-RACE (Appendix H)
rps4 - 45545 44585 960 TTTGTTTTTATGTTATTTTGTGAAG Hattori and Sugita, 2009; Zhelyazkova, et al., 2011 ndhJ - 48787 48515 272 AACTTTGTATCGCGCACATGACT 3’-RACE (Appendix H)
psaJ + 65345 65656 311 ATTGTATTCTTTAATTATTTCTCT Pfalz, et al., 2009; Prikryl, et al., 2011
clpP - 68250 68126 124 ATCAGGTTAAGATGGATCTAAACCAATCCATTTTT Meierhoff, et al., 2003; Zhelyazkova, et al., 2011 psbH + 71713 71816 103 GGTAGTTCGACCGCGGAATT Meierhoff, et al., 2003; Zhelyazkova, et al., 2011 petB + 73243 73309 66 CATATCGGGTAGGTTGTGGTATTTCATTGCT Barkan, et al., 1994; Fisk, et al., 1999
petD + 74661 74780 119 ATTATTTTATTATGATCCATTTCGCG 3’-RACE (Appendix H) rps7 - 89334 89023 311 ATGCAGTTACTAATTCATGATCTGGCATGT 3’-RACE (Appendix H) ndhE - 110387 110065 322 CAAAATTCAAGTCTCTTGGCTCTTTTCACGC 3’-RACE (Appendix H) ndhA - 112330 112255 75 CCCAAACAAGAGAAAGAAACATAT Zhelyazkova, et al., 2011
ACKNOWLEDGMENTS | 151
7 A
CKNOWLEDGEMENTSI would like to especially thank Prof. Thomas Börner for giving me the possibility to do my doctoral studies in his lab group and work on such an exciting topic. I am grateful for his full support and guidance throughout my PhD, for our long discussions, which stimulated my scientific thinking, and for his professional and at the same time relaxed and friendly attitude.
I would like to thank the Deutsche Forschungsgemeinschaft (SFB 429) and the Helmholtz Graduate School “Molecular Cell Biology” at the Max Delbrück Center for Molecular Medicine for financing my PhD project, and the Humboldt University Berlin for providing the infrastructure for my work.
I would especially like to thank Prof. Jörg Vogel, Dr. Cynthia Sharma and Dr. Konrad Förstner for their invaluable support in deep sequencing and bioinformatics analysis.
I am very grateful to Prof. Alice Barkan for introducing me into the PPR world and for her important contribution to that part of my project.
I would also like to thank Dr. Karsten Liere for his willingness to discuss work-related issues at any time and his helpful comments.
I would like to thank all current and former colleagues at the Department of Genetics for creating such an enjoyable working atmosphere. Special thanks go to Dr. Yan Zubo for showing me many technical tricks, Conny Stock for keeping the lab “neat and tidy”, and the lab3 girls Johanna, Lili, and Emilia for being always good for my mood.
I would also like to thank my parents Albena and Dimitar, my sister Maria and the rest of my loving family for their moral support and for their faith in me. I am grateful to my boyfriend Michael for encouraging me to follow a scientific career and giving me the feeling that nothing can ever go wrong. Last but not least, I want to express my gratitude to Freya the cocker for reminding me to also enjoy the simple things in life.
8 P
UBLICATIONS ANDC
ONFERENCEA
BSTRACTS PUBLICATIONSZhelyazkova, P., Sharma, C.M., Forstner, K.U., Liere, K., Vogel, J., and Borner, T. (2012). The Primary Transcriptome of Barley Chloroplasts: Numerous Noncoding RNAs and the Dominating Role of the Plastid-Encoded RNA Polymerase. Plant Cell doi:
dx.doi.org/10.1105/tpc.111.089441.
Zhelyazkova, P., Hammani, K., Rojas, M., Voelker, R., Vargas-Suarez, M., Borner, T., and Barkan, A. (2011). Protein-mediated protection as the predominant mechanism for defining processed mRNA termini in land plant chloroplasts. Nucleic Acids Res. doi:
10.1093/nar/gkr1137.
Berger, M., Farcas, A., Geertz, M., Zhelyazkova, P., Brix, K., Travers, A., and Muskhelishvili, G.
(2009). Coordination of genomic structure and transcription by the main bacterial nucleoid-associated protein HU. EMBO Rep. 11, 59-64.
Cabrera, R., Zhelyazkova, P., Galvis, L., and Fernandez-Lahore, M. (2008). Tailoring orthogonal proteomic routines to understand protein separation during ion exchange chromatography.
J. Sep. Sci. 31, 2500-2510.
CONFERENCE PRESENTATIONS
Zhelyazkova, P., Sharma, C.M., Forstner, K.U., Liere, K., Vogel, J., and Borner, T. (2012). Small Genome and Complex Transcriptome: RNA-seq Analysis of Chloroplast Transcription.
Plant and Animal Genome XX, San Diego, CA, USA.
Zhelyazkova, P., Sharma, C.M., Forstner, K.U., Liere, K., Vogel, J., and Borner, T. (2011). The primary transcriptome of chloroplasts revealed by dRNA-seq. Campus Buch Symposium, Berlin, Germany.
Zhelyazkova, P., Sharma, C.M., Liere, K., Vogel, J., and Borner, T. (2010). The primary transcriptome of chloroplasts determined by deep sequencing. 2nd International Symposium on Chloroplast Genomics and Genetic Engineering, Maynooth, Ireland.
CONFERENCE POSTERS
Zhelyazkova, P., Sharma, C.M., Liere, K., Vogel, J., and Borner, T. (2010). The primary transcriptome of chloroplasts revealed by deep sequencing. 12th MDC/FMP/HSR PhD Retreat, Rheinsberg, Germany.
Zhelyazkova, P., Sharma, C.M., Liere, K., Vogel, J., and Borner, T. (2010). The primary transcriptome of chloroplasts. 23rd Symposium on Plant Molecular Biology, Dabringhausen, Germany.
EIDESSTATTLICHE ERKLÄRUNG | 153
9 E
IDESSTATTLICHEE
RKLÄRUNGHiermit versichere ich, die vorliegende Dissertation eigenständig verfasst und keine anderen als die angegebenen Quellen und Hilfsmittel verwendet zu haben. Die dem Verfahren zugrunde liegende Promotionsordnung ist mir bekannt.
Die Dissertation wurde in der jetzigen oder einer ähnlichen Form bei keiner anderen Hochschule eingereicht und hat noch keinen sonstigen Prüfungszwecken gedient.
Berlin, 14 March 2012
………..
(Petya Zhelyazkova)