6 Material and Methods
6.5 Molecular biological methods
6.5.1 Polymerase chain reaction (PCR)
The polymerase chain reaction (PCR) is a molecular biological method to amplify DNA sequences. The initial solution and PCR protocol depend on the used polymerase. In this work, Q5 High-fidelity DNA
91
polymerase (New England Biolabs) and GoTaq polymerases (Promega) were used. The Taq polymerase was used for colony screening PCR reactions, the Q5 polymerase for the amplification of DNA for plasmid construction. As a template, the genomic DNA of Chromobacterium vaccinii MWU205 was used.
6.5.1.1 Q5 polymerase PCR
The composition of a Q5 polymerase reaction is shown in Table 6.10. The reaction was conducted in a thermocycler using the protocol in Table 6.11.
Table 6.10: Composition of a Q5 polymerase PCR reaction.
Substance Amount
5x Q5 buffer (NEB) 5 µl
5x Q5 GC Enhancer (NEB) 5 µl
dNTPs (10 mM) 0,5 µl
Forward primer (10 µM) 0,625 µl
Reverse primer (10 µM) 0,625 µl
DNA 1 µl, < 1 µg
Q5 High-fidelity DNA polymerase (NEB) 0,125 µl
H2O ad 25 µl
Table 6.11: Protocol of a Q5 polymerase PCR reaction.
Step Temperature Time
1. Initial denaturation 98 °C 30 s
2. Denaturation 98 °C 10 s
3. Annealing Variable 20 s 30 Cycles
4. Polymerisation 72 °C 20-30 s per kb
5. Final polymerization 72 °C 120 s
6.5.1.2 Taq polymerase colony PCR
The composition of a typical Taq polymerase PCR reaction is shown in Table 6.12; the protocol is shown in Table 6.13. To prove specific recombinant DNA, the PCR protocol for the Taq polymerase can be used for a colony screening PCR.
Therefore, several different colonies were picked from an agar plate with a pipette tip. One part of the colony was transferred onto a designated area of another agar plate. The rest of each colony was
92
suspended in 10 µl sterile water. This suspension was then used as template DNA for the Taq PCR. For positive control, genomic DNA of C. vaccinii was used and sterile water as a negative control.
Table 6.12: Initial composition of a Taq polymerase PCR reaction.
Substance Amount
GoTaq Green buffer (5x) 4 µl
MgCl2 (25 mM) 1 µl
DMSO 1 µl
dNTPs (10 mM) 0,33 µl
Forward primer (10 µM) 0,33 µl
Reverse primer (10 µM) 0,33 µl
GoTaq polymerase 0,1 µl
DNA 1 µl, < 1 µg
H2O 20 µl
Table 6.13: Protocol of a Taq polymerase PCR reaction.
Step Temperature Time
1. Cell lysis 95 °C 300 s
2. Denaturation 95 °C 45 s
3. Annealing Variable 45 s 30 Cycles
4. Polymerisation 72 °C 30 s per kb
5. Final polymerisation 72 °C 300 s 6.5.1.3 Primer design
Primers were designed with CloneManager 9.2 software and purchased from Eurofins MWG Operon (Ebersberg, Germany). For primer design, an annealing sequence of around 18 base pairs was searched in the region of interest. For constructs with N-terminal His tags, a stop codon was added outside the annealing sequence. Then, a restriction site outside the protein-coding sequence was added for in-frame cloning, so later on the amplified domain/gene could be ligated into an expression vector. The reading frame of the protein sequence has to be taken into account. Outside of the restriction site, three to six base pairs overhang were added to ensure correct restriction. Primers were diluted in sterile water to a final concentration of 100 pmol/µl and stored at -20 °C.
93 6.5.1.4 Used oligonucleotides (Primer)
In Table 6.14 all primers used for cloning of enzymes and enzymatic domains from frs are listed. In Table 6.15 the primers used for the construction of C. vaccinii MWU205 deletion mutants are listed.
Table 6.14: Primers used for cloning. Restriction sites are bold and stop codons underlined. All overhangs are given in lowercase, while target specific sequences are given in uppercase.
Primer name Sequence (5’→3’)
Cv_frsA_His6-N_for_BamHI gat ggatcc ATGAAAAACAGTGAATCGC
Cv_frsA_His6-N_rev_HindIII tat aagctt TTATTGCTTGACAGCGGTGAC Cv-frsA-T_His6-N_rev_HindIII tat aagctt tcaGCTGTCGCCGCCTTCGGC Cv-frsA-T_His6-N_for_BamHI gat ggatcc GGCTCGCATTATCAG Cv-frsA-A_His6-N_for_BamHI tat ggatcc CCGTCGCAGCCGGTGTCC Cv-frsA-A_His6-N_rev_HindIII gtc aagctt ttaCCGCTGATAATGCGAGCC Cv-frsA-TE_His6-N_for_BamHI tat ggatcc GCCGAAGGCGGCGACAGC
Cv_frsB_for_NdeI gcg catATGAGCAATCCCTTTGATGAT
Cv_frsB_rev_PacI_pCDF gcg ttaattaa ttaTTTATCATCGCACTCCAT
Cv_frsD_His6-N_for_HindIII cac aagctt tgATGGAAATATGGCTGGCG
Cv_frsD_His6-N_rev_XhoI tat ctcgag TCAACTCCTGACAGCGTG
Cv_frsH_His6-N_for_BamHI gat ggatcc ATGACCGTATCCGATAAC Cv_frsH-His6-N_rev_XhoI gata ctcgag tTACAGCAGCATGGTTTG Cv_frsG-TE_His6-C_for _NheI tat gctagc ATGGACGGCGAGATCGATGAC Cv_frsG-TE_His6-N_rev _HindIII tat aagctt TCAAGAATTACGGCGGGTGGACTG
Table 6.15: Primers used for the construction of C. vaccinii MWU205 deletion mutants. Restriction sites are bold, Gibson homology arms are underlined. All overhangs are given in lowercase, while target specific sequences are given in uppercase. All primers designed by Dr. René Richarz.
Primer name Sequence (5’→3’) Description
BamHI-FRT_for tga ggatcc
AGCTTCAAAAGCGCTCTGA
Sequential cloning of FRT into pUC19
SalI-FRT_rev tgt gtcgac GGGGATCTTGAAGTTCCT Sequential cloning of FRT into pUC19
94 SphI-frsA-up_for agt gcatgc
GGAAAGTACGTCTGGTCTTG
Sequential cloning of the frsA-up region into pUC19::FRT
SalI-frsA-up_rev tct gtcgac
TACATCCAGCTGTGCTGAAG
Sequential cloning of the frsA-up region into pUC19::FRT
BamHI-frsA-dn_for
ttc ggatcc
ATTGGTCCTGTTCTCGAGTC
Sequential cloning of the frsA-dn region into pUC19::frsA-up-FRT SacI-frsA-dn_rev tga gagctc
AGTCCCGCATATGATCGATG
Sequential cloning of the frsA-dn region into pUC19::frsA-up-FRT FRT_for CGAATTAGCTTCAAAAGCGCTCTGA One step cloning of FRT into
pEX18Tc
FRT_rev CGAATTGGGGATCTTGAAGTTCCT One step cloning of FRT into pEX18Tc
Gib-vioA-up_for gcatgcctgcaggtcgactctagaggatcc TGACCCTTGGAACAGGATG
One step cloning of vioA-up into pEX18Tc
FRT-vioA-up_rev aggaacttcaagatccccaattcg CTGCTGCATGTCGAAAATG
One step cloning of vioA-up into pEX18Tc
FRT-vioA-dn_for tcagagcgcttttgaagctaattcg CGTCCATGTGCACAAGTAC
One step cloning of vioA-dn into pEX18Tc
Gib-vioA-dn_rev tacgaattcgagctcggtacccggg GCTCGCCATTGATCGAAAC
One step cloning of vioA-dn into pEX18Tc
PCR-frsA-KO_for
GTAATGTCAAAGGCTTGG Mutant verification of C. vaccinii ΔfrsA by PCR / Sequencing
PCR-frsA-KO_rev
ATTGAATTGCTGACACCG Mutant verification of C. vaccinii ΔfrsA by PCR / Sequencing
PCR-vioA-KO_for
AGCTCTACCTGTGGCAG Mutant verification of C. vaccinii ΔvioA by PCR / Sequencing
PCR-vioA-KO_rev
TCCCAGGAGAAATGGTTG Mutant verification of C. vaccinii ΔvioA by PCR / Sequencing
6.5.1.5 Purification of PCR products
The PCR products were purified before further use. The “FastGene Gel/PCR Extraction Kit” (NIPPON Genetics Co.) was used according to the manufacturer’s instructions. For the elution step, autoclaved DI water was used instead of the provided elution buffer.
95 6.5.1.6 Concentration determination of DNA
The concentration of the purified DNA, PCR fragments, gDNA or plasmids was quantified using photometric absorption measurements at 260 nm with an Eppendorf μCuvette in an Eppendorf BioPhotometer.