Ontogenetic development of the GABA B receptor in mouse brain

To examine whether GABABR shows any age dependant molecular changes, brains from NMRI mice (P0-2 and adult) were analyzed by molecular biological methods.

Information about the molecular structure of the GABAB receptor was untill recentlly only available from human and rat. To identify the mouse GABAB2 receptor cDNA sequences we performed a BLAST search of the GenBank expressed sequence tag (EST) database using the amino acid sequence of the rat GABABR2 as the query.

GABABR2 was our subunit of interest, thus this subunit contains all the molecular determinants for G protein coupling. A mouse GABAB2 receptor cDNA was detected (GenBank Accession No. NP_001074610) and in addition a second mouse EST from a new born mouse with a Accession No. XM_143750, predicted as GABABR2

Figure 3.2. Double-labelling of GABABR1a and GABABR2 subunits. HEK293 cells stably transfected with GABAB R1a (A, red; Cy5) and GABAB R2 (B, green; Cy3). (C) Overlay of panels A and B shows that GABAB R1a and R2 are not co-localized.

of the two detected GABABR2 sequences the NP_001074610 and the predicted XM_143750.4 shows that the latter one has 35 additional amino acids at the end of the fifth transmembrane region in the intracellular part of the receptor. As our main interest was age related differences at the protein levels of GABABR2 in the G protein coupling regions (heptahelical domains, intracellular loops and intracellular C-terminal domain) this was a promising difference, which had to be further investigated.

To analyze the eventually altered expression of GABABR2 between P0 and adult animals, total RNA was isolated from brainstems and the resulting GABABR2 cDNA was analyzed by sequencing. In detail, RNA from brainstems was isolated with trizol reagent and analyzed by spectrophotometry and reverse transcriptase-PCR (RT-PCR).

For the reverse transcription of the mRNA to a complementary DNA (cDNA) we used Omnoscript (Qiagen, Hilden) with 10 μg of mRNA as template and the resulting first-strand cDNA was then amplified by PCR. Three primer pairs were designed to amplify three DNA fragments, which screen the receptor GABAB2 G-protein coupling regions. The first primer pair TTCGGAAGATCTCGCTTCCACTGT-3’ and

5’-Figure 3.3. Diagram of polymerase chain reaction (PCR) products and relative primer positions on GABABR2 cDNA. The upper part illustrates the GABABR2 protein structure; boxes represent the 7 TMD; the line joining them illustrates the NH2-, COOH-terminal domains and the inter- and extracellular loops. The mid part is an enlargement of the region of interest (7 TMD and COOH-terminal domain) and the last part shows the PCR primer design regions.

Primer 1: TTCGGAAGATCTCGCTTCCACTGT Primer 4: AACAACCGAACAACATGAGGAGCC Primer 2: TGCTGATCGATCTGTGCATCCTGA Primer 5: CGCCAAGGAGAAGTCATTGCCATT Primer 3: TCCTTGGCGTCTGCAAACAAAGAG Primer 6: CCATGGGAGAGGTTAAAGTGCACAA

AACAACCGAACAACATGAGGAGCC-3’, amplifies the GABAB2 cDNA from the first transmembrane region untill part of the fifth transmembrane region, yielding a fragment of 597 bp after 30 cycles (see figure 3.3). Analog, the second primer pair 5’-TGCTGATCGATCTGTGCATCCTGA-3’ and 5’-CGCCAAGGAGAAGTCAT-TGCCATT-3’ amplifies the forth transmembrane region till half of the C-terminal region, yielding a fragment of 1251 bp and the third primer pair 5’-TCCTTGGCGTC-TGCAAACAAAGAG-3’ and 5’-CCATGGGAGAGGTTAAAGTGCACAA-3’

yields a fragment of 631 bp which encodes the second half of the C-terminal region till the end of it (see figure 3.3). After amplification the products (6 μl) were analyzed on a 1.5 % agarose gel (see figure 3.6). PCR products from adult GABABR2 with the desired size were identified, as shown in figure 3.6. The three bands with the expected size of 597, 1251 and 631 bp are present in the last three bags of the gel.

In case of the existence of a 35-extra amino acid fragment in the GABABR2 at the fifth transmembrane region of new born mice, the second PCR product should have a size of 1356 bp, but as shown in figure 3.6., the three PCR fragments from new born have the same size as the adult mouse (597, 1251 and 631 bp). Thus, the predicted GABABR2 protein with the accession No. XM_143750 is not expressed at any of the investigated ages and there is no difference in the expression of the GABAB2 receptors between adult and young mice.

In addition, the isolated three cDNA GABA R2 fragments from both ages were Figure 3.6. Agarose gel

showing PCR amplified products obtained using the primer pairs 1-4, 2-5, and 3-6 from newborn and adult mouse brainstem GABABR2 cDNA.

Line 2 to 4 are PCR products from newborn cDNA (597, 1251, and 631 bp respectively);

line 5 to 7 are PCR products from adult cDNA (597, 1251, and 631 bp respectively), along with marker DNA (line 1).

other substitute, which can have influence on the expression and eventually the function of GABAB2 receptors.

For this reason we isolated and sequenced the six PCR fragments. Sequence analysis revealed differences between adult and newborn mouse genome of GABAB2 receptor at the positions 5658 and 5790. The electropherograms (see figure 3.4 and 3.5) show at those positions the two mixed signals in the cDNA of the newborn mice.

At the position 5658, which is part of the seventh transmembrane region, the cDNA of the younger mice shows a double peak of adenin and guanin. In contrast to the adult cDNA, shows a single G-peak. The same switch takes place at the position 5790.

Figure 3.4. Electropherograms showing part of the transmembrane helices 7 sequence in adult and newborn mice. A G to A/G substitution at nucleotide position 5658 is marked with an arrow. The marked codon GTG in adult encodes a valine (V). The mixed A/G signal at the same position in the P0 mouse does not modify the amino acid. Both triplets GTG and GTA encode valine.

Figure 3.5. Electropherograms showing part of the C-terminal domain sequence in adult and newborn mice. A G to A/G substitution at nucleotide position 5790 is marked with an arrow. The marked codon GCG in adult encodes alanin (A). The mixed A/G signal at the same position in the P0 mouse does not modify the amino acid. Both triplets GCG and GCA encode alanin.

In both cases the G/A switch to G leads to silent mutations. Both codon GTG and GAA (position 5658) encode the amino acid valine and at the position 5790, GCG and GCA encode the amino acid alanin.

Therefore, it can be concluded that there is no change in the expression of GABAB

receptor 2 in the developing mouse brainsteam.

3.3 Changes in the GABAB receptor signaling in the developing mouse