3. RESULTS
3.4. Molecular characterization of T-DNA insertions in AtET genes
formation (Guo and Gan, 2006). In sum, these TFs could potentially function downstream of AtET2 either directly or indirectly during root development. Further analyses will be required to test this hypothesis.
Table 2: TF genes up- or down-regulation in AtET2::GR seedling treatment
ATG Annotation Induction factor
number 1st filter 2nd filter
At1g28310 zinc finger domain-containing protein 3.62 4.31
At1g69490 NAC-LIKE transcription factor 6.66 4.73
At2g18670 zinc finger protein 3.96 3.51
At4g18170 WRKY18 transcription factor 3.03 3.59
At4g39070 Zinc finger (B-box type) family protein 9.38 3.31
At5g61590 ERF (ethylene response factor) 3.01 6.51
Repression factor
1st filter 2nd filter
At2g44940 AP2 domain-containing protein 9.38 12.10
At2g46510 bHLH18 transcription factor 10.57 6.34
At3g25730 AP2 domain-containing transcription factor 6.60 6.84
At5g37260 a MYB family transcription factor 5.53 12.12
At5g44080 bZIP13 transcription factor family protein 4.36 5.78
3.4. Molecular characterization of T-DNA insertions in AtET genes
further work. Previously, a single line containing a T-DNA insertion in AtET2 gene was selected by pool screening from the collection of the Arabidopsis Knock-out Facility (AKF), University of Wisconsin (Ivanov, 2005). This line was transformed with a derivative of the T-DNA vector pD991 into Wassilewskija2 ecotype (Ws) (Krysan et al., 1999; Sussman et al., 2000) and was designated as et2-1 (Ivanov et al., 2008). This mutant was backcrossed repeatedly into ecotype Col to facilitate direct comparison with other mutants, all in the Col background. Therefore, the line et2-1 was backcrossed at least four times before use for further analyses and renamed to et2-Col.
.
Figure 23. Genomic organization of the AtET2 gene showing the T-DNA insertion in the et2-1 allele.
A. Upper left: Structure of AtET2 gene with T-DNA insertion site. Exons were indicated in grey boxes, and primers for genotyping in small arrows.
B. Upper right: Confirmation of homozygous knock-out line after backcrosses into Col.
XR2 and gene-specific primers were used for line et2-Col (lane 2 and 3), and Col (lane 4 and 5), respectively, and would produce 963 bp of wild type allele and around 700 bp of T-DNA flanking region. The lack of wild type allele product demonstrated that line et2-Col was homozygous for the T-DNA insertion.
SmartLadder DNA (Eurogentec, Belgium) given in bp was used as a marker.
C. Lower: T-DNA RB (right boder) written in red was inserted at position 518 relative to the start codon.
1500 1000 800 600 400
1 2 3 4 5
518
AtET2 2nd exon: TGTCCGGGTCTGTATGAGCT T-DNA RB in et2-1: TATTCGGGCCTAACTTTTGGTGTGTCCGGGTCTGTATGAGCT
Homozygous plants for the insertion in et2-Col were screened and confirmed through PCR analysis using T-DNA right border primer (XR2) in combination with either a forward or a reverse gene-specific primers (GET2-F or GET2-R, respectively). The wild type Col serving as control should generate a PCR product (963 bp) with the gene-specific primers but not with the T-DNA primer XR2. 30 plants were genotyped in order to select an et2-Col homozygous line. As shown in Figure 23B, only the indicated line et2-Col produced a band of approximately 700 bp with mutant primers, suggesting that it is homozygous for T-DNA insertion and can be used for further analysis. The result obtained from sequencing of the right border and the T-DNA flanking region revealed that T-DNA was inserted in the second exon at the position of nucleotide 518 relative to the start codon.
3.4.2. Isolation of insertional mutant lines for AtET1
Arabidopsis lines containing T-DNA insertions in AtET1 gene (At4g26170) were identified and obtained from the SIGnAL T-DNA collection (Salk Institute Genomic Analysis Laboratory). According to the sequence data found in the database (http://signal.salk.edu/cgi-bin/tdnaexpress), the insertions in these lines were predicted in the exon (SALK_000422) or the introns (SALK_026258, 094357, 146916). We selected these four mutant lines for further analysis and renamed them et1-1, et1-2, et1-3 and et1-4, respectively (Figure 24).
Figure 24. Positions of the T-DNA insertion in potential mutant lines for AtET1 gene in the SIGnAL T-DNA collection. Four SALK lines including 000422, 026258, 094357 and 146916 were selected for primarily mutant analyses and designated as line et1-1, et1-2, et1-3 and et1-4, respectively.
About 30 Arabidopsis plants for each mutant line were genotyped in the first generation to verify the insertions and determine whether the line was heterozygous or homozygous. To this end, the genomic DNAs isolated from these plants were used for PCR with T-DNA left border primer (LBa1) and gene-specific primers (F1, GET1-R1, GET1-R2) depending on the position of T-DNA in AtET1 sequence. The sizes of amplified PCR products were estimated by gel electrophoresis and were around 790, 700, 770 and 750 bp for et1-1, et1-2, et1-3, and et1-4, respectively, as seen in the Figure 25 (left picture). The wild type Col was used as control. Homozygous knock-out lines were detected by PCR and were expected to have a band with T-DNA primers and not with the gene-specific primers. The results indicated that only line et1-2 was homozygous for T-DNA insertion in the AtET1 gene whereas the other three lines (et1-1, et1-3 and et1-4) were heterozygous and therefore require the screening of the following generations for homozygosity.
Figure 25. Genotyping of et1 lines containing T-DNA insertions in the AtET1 gene.
In both pictures, PCR products amplified from et1-1, et1-2, et1-3 and et1-4 lines were loaded in lane 1, 2, 3, 4, respectively. Lane 5 and 6 contained products generated from genomic DNA of Col. SmartLadder DNA (Eurogentec, Belgium) given in bp was used as a marker.
Left picture: Left border primer (LBa1) was used in combination with gene-specific primer GET1-F1 for et1-1 and et1-2 or GET1-R1 for et1-3 and et1-4.
Right picture: Two pairs of gene-specific primers (GET1-F1 in association with GET1-R2 or GET1-R1) were used to amplify wild type alleles and would produce products of 681 and 343 bp. The absence of wild type allele in et1-2 (lane 2) demonstrated that this line was homozygous for T-DNA insertions.
M 1 2 3 4 5 6 1000 7
800 600 400 200 M 1 2 3 4 5 6
1500 1000 800 600 400
3.4.3. Analysis of T-DNA integration sites in et1
To precisely identify the integration sites of T-DNA insertions in the AtET1 locus, the flanking sequences of T-DNA were amplified with LBa1 and gene-specific primers and cloned into pCR®II vector (Invitrogen, Carlsbad, CA). In each case, two independent clones for a particular PCR product were selected to exclude PCR or sequencing error and entirely sequenced at Plant Genome Resources Center, IPK, Gatersleben. The sequencing of genomic DNA flanking regions revealed three lines which harbored T-DNA insertions in the first intron for line et1-2, et1-3, and et1-4, respectively, downstream of the start codon of AtET1.
In addition, comparison of the T-DNA flanking sequence to the corresponding AtET1 Col wild type loci showed that the integration of T-DNA into line et1-1 (SALK_000422) induced a deletion of 23 bp of the second exon. The removal of these 23 bp shifts the et1-4 insertion site into the second exon at nucleotide 382 from start codon of AtET1 and generates a good candidate for a knock-out mutant. A more detailed characterization of T-DNA insertions in the AtET1 gene is shown in Figure 26.
3.4.4. Transcription analysis of et1
To determine whether the T-DNA insertions influenced the expression of AtET1 gene, we employed RT-PCR analysis. Since all knock-out lines carried T-DNA insertions close
Figure 26. Scheme to illustrate the T-DNA insertion sites in AtET1.
Introns and exons were shown in lines and grey boxes, respectively. The coordinates of the T-DNA insertions in the coding region were indicated with respect to the transcription start site. The T-DNA inserts were not drawn to scale. Primers for genotyping were indicated in small arrows.
to the 5’ end of the AtET1 gene, the AtET1 transcript gene can be detected with several different gene-specific primers within the coding region and downstream of the point of insertions. The product of actin 2 gene (At3g18780) was used to quantify the amount of templates in the PCR reaction. All three mutant lines displayed reduced transcript level of AtET1 in comparison to Col (Figure 27). Due to pleiotropic phenotypes such as sterility even in heterozygote line et1-4 could not be used for any further analysis. As judged from the transcript level, line et1-1 could be a null mutation and therefore, is currently employed for the creation of a double mutant with the line carrying the T-DNA in AtET2 gene (et2- Col).
3.4.5. Phenotypic analysis of et1
The phenotype of homozygous et1-1 knock-out mutant was inspected and compared to wild type Col under standard growth conditions. Development and growth of this knock-out plant appeared normal, and throughknock-out the rosette stage mutants were indistinguishable from wild type Col plants. Similarly, mutant plants exhibited normal floral sizes, leave shape and numbers as well as branching. Flowering time, silique sizes and seed morphology of mutant and Col plants did not display appreciable differences.
Figure 27. Analysis of transcript levels of et1 mutant lines
Left: Amplification of AtET1 transcript by ET1-RT-F2 and ET1-RT-R2 primers. Lane 1, 2, 3, 4 were loaded with products from et1-1, et1-2, et1-3, and Col. SmartLadder DNA (Eurogentec, Belgium) given in bp was used as a marker (lane M).
Right: Expression of actin 2 gene (At3g18780) was used as loading control for the corresponding lanes in left panel. GeneRulerTM 1kb DNA Ladder Plus (Fermentas, Vilnius, Lithuania) given in bp was used as a marker (lane M).
500 400 300 200 100 75
Lane M 1 2 3 4
25 cycles Lane M 1 2 3 4
35 cycles 1500
1000 800 600 400 200
Remarkably, previous data showed that the null mutation in AtET2 gene (et2-1) strongly increased germination of immature seeds compared to the wild type Ws (Ivanov, 2005). For this reason, immature seeds from green siliques were isolated and placed on MS medium containing basic components. As summarized in Figure 28, the germination rate of immature seeds of the et1-1 line was higher in comparison to the wild type Col. Thus, this result is in agreement with observations reported by Rumen Ivanov (Ivanov, 2005), although germination rate was not as high as in the et2-1 mutant.
3.4.6. Creation of double knock-out mutant
Phenotypic analyses demonstrated that single knock-out mutants in the AtET1 (et1-1 line) and AtET2 (et2-1 line) genes showed similar phenotype in delaying germination of immature seeds. In addition, et2-1 mutant line exhibited significant reduction in lignin content of leaves and stems compared to wild type (Ivanov et al., 2008). Besides these characters single knock-out mutants lack other discernible morphological phenotypes. It is reasonable to speculate that phenotype in a given single mutant might be hidden by overlapping function of AtET1 and/or AtET2 genes (see discussion in pages 99-100 for more detail). Moreover, both these genes also display similar expression patterns during growth and development of plants. To analyze if genetic redundancy could mask essential functions of individual genes, I generated double mutants impaired in both AtET1 and
Figure 28. Germination rates of immature seeds from et1-1 mutant line.
Isolated immature seeds were sown on MS medium supplemented basic vitamins.
Germination rate was calculated for three weeks and compared to wild type Col.
0 10 20 30 40 50 60 70 80
0 4 6 8 10 12 14 16 21
Days after imbibition
Germination (%)
Col et1-1
0 10 20 30 40 50 60 70 80
0 4 6 8 10 12 14 16 21
Days after imbibition
Germination (%)
Col et1-1
et1-1 (SALK_000422) line showed nearly complete loss of AtET1 transcript. Both et1-1 and et2-Col mutants (see 3.4.1 and 3.4.2) were shown to contain T-DNA insertions in the second exon of AtET1 and AtET2 genes, respectively. Thus far, I crossed et1-1 x et2-Col to produce F1 progeny heterozygous for both T-DNA insertions. Current experiments aim to identify either a double homozygous mutant line or a line which is homozygous for one allele and heterozygous for the other in case of gametophytic or zygotic lethality.