Molecular biological methods

7.2.2.1 Genotyping of mice

0.5 cm long tail tips were taken from P21 young mice. They were digested overnight (o/n) in 400 μl Extraction buffer with 20 μl Proteinase K at 55°C under steady agitation. To extract the DNA 75 µl KAc and 400 µl chloroform were applied and mixed by inversion. To separate

the DNA containing aqueous phase from the chloroform, the sample was centrifuged at 700 x g for 10 min. 200 µl from the supernatant was removed, mixed with 400 µl EtOH for DNA precipitation, followed by a centrifugation step (at 700 x g for 10 min) to pelletise the DNA. The supernatant was carefully and completely removed and after the pellet had been air dried, the DNA was dissolved in 10 mM Tris buffer.

Polymerase chain reaction was used to amplify specific DNA segments (Mullis et al., 1986;

Saiki et al., 1988). 1 μl of DNA samples were used per 20 μl PCR reaction. Primers were selected manually using the DNASTAR Lasergene 9 core suite.

For separation of PCR products gels containing 1.5% [w/v] agarose in 1x TAE buffer were used. For DNA visualization 1 μg/ml ethidiumbromide was added to the gel prior to polymerization. 20 μl of PCR samples were loaded and separated at 150V for 45 min in 1x TAE buffer. GeneRuler 100 bp DNA ladder or GeneRuler 1 kp DNA ladder (both Thermo Scientific, St. Leon-Rot, Germany) was used as a marker. For documentation pictures were acquired with the Intas UV system.

7.2.2.2 PCR on genomic DNA

30 μg of total cerebellar and brain purified genomic DNA was used in a PCR reaction to detect the recombined Cox10 allele with 0.1 µM of following primers TGAGTAGAATGGCTTCCGGAAGGG and AGCAGCAAAGAGGGCTCACTTCTTGC generating a template of 465 bp.

7.2.2.3 Quantitative PCRs on genomic DNA

Sciatic nerves (epineurium was removed), optic nerves and brains were collected from P21 animals and DNA was isolated as usual. Quantitative PCR was performed using 10 ng of sciatic nerve DNA in a 12.5 µl assay using PowerSYBR Green PCR Master Mix (Applied Biosystems) on an Applied Biosystems 7500 Fast real time PCR system in triplicates. A standard curve was generated using DNA from Cox10^flox/flox, Cox10^flox/wt, and Cox10^wt/wt animals. The values were standardized to an independent genomic marker to correct for small differences in the amount of DNA. Primers CGGGGATCAATTCGAGCTCGCC and CACTGACGCAGCGCCAGCATCTT amplify a 167 bp band specific for the Cox10^flox allele.

For genomic input control we used an intron-exon stretch of Neuregulin 1 type III were used.

The percentage of recombination was calculated assuming that every Cre-expressing cell recombines both Cox10^flox alleles. The values were shown as histograms using Adobe Illustrator CS3 and p-values were calculated using the Student’s t-test of Microsoft Excel 2003. The levels of significance were set as * p < 0.05; ** p < 0.01; *** p < 0.001. Analysis was performed by Dr. Ursula Fünfschilling.

7.2.2.4 RNA isolation (‘RNeasy mini prep’)

RNA isolation from frozen (-80°C) half brain as well as separated cortex, optic nerve and cerebellum was performed using “Qiagen’s RNeasy Mini Prep” kit. The kit is based on a selective binding of RNAs bigger than 200 bases to a silica-gel based membrane under high-salt conditions, which excludes binding of 5S, 5.8S and tRNAs. RNA isolation and purification was carried out following the manufacturer’s instructions. Briefly, apart from optic nerves of adult rats that were homogenized in Trizol (Invitrogen, Karlsruhe, Germany) with the Precellys for 3 x 10 sec at 5500 rpm followed by addition of half volume of chloroform, inversion for mixture and an incubation step of 3 min. All other tissue were homogenized in RLT buffer (containing 1% (v/v) ß-Mercaptoethanol). Here, for half brains and cerebella the KINEMATICA AG POLYTRON PT 3000 (1 min at 14.000 rpm) and for the cortices and optic nerves of developing states the Precellys (2 x 10 sec at 5500 rpm) were used. The subsequent steps were for all tissues equally performed. After 15 min certification at 16000 x g (Heraeus Biofuge Pico table centrifuge, 13000 rpm) the upper aqueous phase was transferred to a new 2 ml Eppendorf tube. One volume of ethanol was added to the samples, mixed and applied to RNeasy columns. After 1 min centrifugation at 16000 x g the columns were washed one time with the RW1 buffer and two times with the RPE buffer. The RNA was eluted from the column by adding 20-40μl of RNase-free ddH₂O.

7.2.2.5 RNA measurement with Agilent

The quality and the amount of RNA were measured using the Agilent RNA 6000 Nano KIT and the Agilent 2100 Bioanalyzer following the company’s instructions. Only RNA samples with a RNA integrity number above 8.5 were further used. The RNA concentration for all samples was adjusted to 100 ng/ μl.

7.2.2.6 cDNA synthesis

cDNA synthesis is based on the characteristic feature of eukaryotic messenger RNAs to harbor defined polyadenylated tail on the 3′ end. First-strand cDNA was mainly synthesized for quantitative RT-PCR. Total RNA is mixed with a random nonamer and oligo-dT primers.

The amplification reaction is carried out by Superscript III reverse transcriptase (Kotewicz et al., 1985; Gerard et al., 1986) at 55ºC providing high specificity and yields of cDNA (from 100bp to >12kb). For the cDNA synthesis, 6 pmol of random primers, 0.03 pmol of oligo dT nucleotides were incubated with 400 ng - 1 μg total RNA for 10 min at 70°C and then cooled on ice for 2 min. 2 μl of 5X First-Strand Buffer, 1 μl of 0.1 M DTT, 1 μl of 10 mM dNTP and 1μl of SuperScript™ III RT (200 units/ μl) were added to the tubes. The reaction mixture was incubated in the thermocycler with the following settings: 25°C for 10 min, then 50°C for 45 min, 55°C for 45 min. The cDNA was then used as a template for amplification in PCR.

7.2.2.7 Quantitative real time PCR for mRNA expression

The quantification of amplified gene fragments relied on the usage of the fluorescent dye SYBR Green, which intercalates specifically in double stranded DNA. All reactions were carried out in quadruples. Data evaluation was performed with the 7500 Fast System SDS software Version 1.3 (Applied Biosystems) and Excel 2003. As endogenous gene controls Rpl13a and Rplp0 were used for normalization. Values were further calculated to the P8 time-point of every brain region. The values were shown as histograms using Adobe Illustrator CS3 and p-values were calculated using the Student’s t-test of Microsoft Excel 2003. The levels of significance were set as * p < 0.05; ** p < 0.01; *** p < 0.001.