Analysis of undifferentiated and differentiated cell lines

Image capture and visual examination of cultures in brightfield and fluorescence microscopy was performed on a Leica DMIL LED microscope using the ICC50 HD or DFC 450C camera.

2.2.7.2 Analysis of nonsense-mediated decay in BOS-iPSC

Undifferentiated iCas9 hESC (=Control hESC) and BOS-iPSC were treated with 100 µg/ml cycloheximide (Sigma-Aldrich, cat. #C7698) for 6 h, and then subjected to RNA isolation, reverse transcription, qPCR and RT-PCR as described in section 2.2.10, using primers listed in Table M8:

Table M8. Primers used for RT-PCR nonsense-mediated decay experiments (5’-3’).

Target forward primer reverse primer

Caspase-2 gttacctgcacaccgagtcacg gcgtggttctttccatcttgttggtca B2M (β-Globulin) ctcacgtcatccagcagaga tctttttcagtgggggtgaa ASXL1-Exon 1 ggacaaacagaagaagaagaagga tgcctctatgacctgcagaa ASXL1-Exon 12-A tcgcagacattaaagcccgt agctctggacatggcagttc ASXL1-Exon 12-B agttgggaccaagcacaaac aagtgacccaccagttccag

2.2.7.3 Sequencing of ASXL1 transcripts in BOS-iPSC

To determine whether mutant alleles were transcribed to stable mRNA in undifferentiated BOS-iPSC #1-0 and #2-0, these lines were subjected to RNA isolation, reverse transcription and RT-PCR as described in chapter 2.2.10. Following primers were used to amplify target regions from cDNA (5’-3’):

For: TCGCAGACATTAAAGCCCGT Rev: CAGAGGCTGTATCCGTGGA

PCR products were isolated using the QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s specifications and subjected to Sanger sequencing (using primer GAGCACCCCTGGAAAGTGTA) and analyzed on the presence of patient-specific mutations (see chapter 2.2.8.4).

2.2.7.4 Analysis of HOX gene induction

H9 hESC, control hiPSC and BOS-iPSC were kept in mTeSR1 in 6-well plates, and retinoic acid (Sigma-Aldrich, cat. #R2625) in DMSO was added to the cultures to final concentrations of 0.5, 1, 2.5 and 5 µM, using DMSO-treated cultures as negative control.

Cells were imaged and harvested after 24 h and subjected to RNA isolation and qPCR (see section 2.2.10) using primers stated in Table M9 below.

Table M9. Primers used for HOX gene detection (5’-3’).

Target forward primer reverse primer

HOXA1 cccaaaacagggaaagttggagag cgcgcgtcaggtacttgttgaag HOXA2 cctcagccacaaagaatccctg ctccacccttcggggtctg HOXA3 cagctcatgaaacggtctgcg cgcacactctgacaggggtttg HOXA4 catgtcagcgccgttaaccc cgccgggtcaggtatcgattg HOXA5 ctgcacataagtcatgacaacataggc ctgcgggtcaggtaacggttg HOXB1 caagacagcgaaggtgtcagag ggcccggctcaggtacttg HOXB2 ctgcagatggcctgggactg ccttctccagttccagcagc HOXB4 gagcacggtaaaccccaattacg gccgtgtcaggtagcggttg HOXB5 cacatcagccatgatatgaccgg gtgggcgatctcgatgcg

2.2.7.5 Cell density assays

Control hiPSC, control hESC or BOS-iPSC were dissociated using Accutase as described before, counted using a Neubauer Chamber and seeded at different densities as single cells in fresh medium containing 10 µM ROCKi. After 24 h, 48 h or 96 h, cells were subjected to expression analysis as described in the next section.

2.2.7.6 Transcript and protein analysis in control and mutant cell lines

Expression of pluripotency factors, germ layer markers, NC markers or ASXL genes was detected via transcriptional and/or protein expression analysis in undifferentiated lines and NC cultures derived thereof. For stable overexpression lines, induction of constructs via 1 µg/ml DOX treatment was usually performed for 24 h prior to sample collection and analysis, unless stated otherwise.

For transcriptional analyses, cell cultures were subjected to RNA isolation and qPCR/RT-PCR/microarray/RNA-seq, as described in section 2.2.10, primers and probes are listed in Table M10. For Western Blot, adherent cells were washed once with PBS, harvested in PBS using a cell scraper (Santa Cruz) to lift off colonies, and collected via centrifugation at 500xg for 5 min at 4 °C. Neurospheres in NC differentiation cultures were collected directly via centrifugation, and washed once in PBS. Cell pellets were stored at -80 °C and then subjected to protein extraction and Western Blot as described in chapter 2.2.13; antibodies used for detection are listed in Table M5. For immunocytochemistry, cells were plated as single cells, using Accutase, onto µ-Slide 8 Well chambers (Ibidi). After 2-4 days, cultures were fixed and stained as described in section 2.2.12, using antibodies listed in Table M5.

2.2.7.7 Analysis of neurosphere attachment

Assessment of NC differentiation via quantification of neurospheres was performed at day 7 or at day 8 of the protocol via brightfield microscopy. Neurospheres were classified into three categories: attached neurospheres that showed delamination of prospective NC cells (=delaminating neurospheres), attached neurospheres without outgrowth, and floating neurospheres. If feasible, neurospheres of all three categories were counted per cell line, and the number of delaminating neurospheres in percent of the total number of neurospheres derived from the respective cell line was determined.

Otherwise, the number of delaminating neurospheres derived from BOS-iPSC or ASXL1^PSC/PSC hESC was directly compared to the number of delaminating neurospheres in control hiPSC or control hESC-derived NC cultures, respectively. Furthermore, total number of neurospheres derived from ASXL1^PSC/PSC and control hESC were determined.

2.2.7.8 Flow cytometry analysis of MSC cultures

Flow cytometry analysis of MSC cultures was performed by V. Rishko (Helmholtz Center Munich) using the MSC phenotyping kit (Miltenyj Biotec, #130-095-198) according to the manufacturer’s specifications on a FACS ARIA III (BD Biosciences), with subsequent analysis using the FlowJo X 10.0.7r2 software. For controls, MSC cultures were incubated with isotype control cocktail from the kit.

Table M10. Primers and probes used for analysis of cell lines on pluripotency markers, germ layer and NC specifiers, and ASXL genes (5’-3’). * detection of full-length ASXL1 in BOS-iPSC

Name application forward primer reverse primer

ASXL1-Taqman qPCR TaqMan Gene Expression Assay ID: Hs00392415_m1, LT ASXL1-FL RT-PCR* aaggacaaacagaagaagaagaag ttatctcaccacaaggcacaatac

ASXL1 qPCR gccacaggtcaaatgaagc ggtccgagagttgatcagg

ASXL2 qPCR ctaaagcaggcgctaaagc gctttgacagtctttagtgag

ASXL2-Taqman qPCR TaqMan Gene Expression Assay ID: Hs00827052_m1, LT ASXL3 qPCR catacgtttgcttccttacct acttcccatctgcctatcc

ASXL3-Taqman qPCR TaqMan Gene Expression Assay ID: Hs00296943_m1, LT CER1 qPCR caggacagtgcccttcagcca acagtgagagcaggaggtatgg E-CAD qPCR gcctcctgaaaagagagtggaag tggcagtgtctctccaaatccg

FOXA2 qPCR gggagcggtgaagatgga tcatgttgctcacggaggagta

GAPDH qPCR TaqMan Gene Expression Assay ID: Hs02758991_g1, LT GAPDH qPCR tgcaccaccaactgcttagc ggcatggactgtggtcatgag GBX2 qPCR gcggaggacggcaaaggcttc gtcgtcttccacctttgactcg GDF3 qPCR gtctcccgagacttatgctacg agtagaggagcttctgcaggca HNK1 qPCR gaaagcagcctccttcgagaac cctcattcaccagcactggctt

MESP1 qPCR ctgcctgaggagcccaagt gcagtctgccaaggaacca

N-CAD qPCR cccacaccctggagacattg gccgctttaaggccctca

NANOG qPCR TaqMan Gene Expression Assay ID:Hs04260366_g1, LT Nestin qPCR gtctcaggacagtgctgagccttc tcccctgaggaccaggagtctc OCT4 qPCR TaqMan Gene Expression Assay ID:Hs00999632_g1, LT

p75 qPCR cctcatccctgtctattgctcc gttggctccttgcttgttctgc

PAX3 qPCR ggctttcaaccatctcattcccg gttgaggtctgtgaacggtgct PAX6 qPCR gcggagttatgatacctacacc gaaatgagtcctgttgaagtgg SNAI2 qPCR atctgcggcaaggcgttttcca gagccctcagatttgacctgtc SOX10 qPCR atgaacgccttcatggtgtggg cgcttgtcactttcgttcagcag

SOX17 qPCR ggcgcagcagaatccaga ccacgacttgcccagcat

SOX2 qPCR TaqMan Gene Expression Assay ID:Hs01053049_s1, LT SOX9 qPCR aggaagctcgcggaccagtac ggtggtccttcttgtgctgcac

T qPCR caacctcactgacggtgaaaaa acaaattctggtgtgccaaagtt

TFAP2A qPCR gacctctcgatccactccttac gagacggcattgctgttggact ZIC1 qPCR gatgtgcgacaagtcctacacg tggaggattcgtagccagagct

2.2.7.9 Oilred O/Alizarin Red staining of adipocytes and osteoblasts

For detection of calcium-containing osteoblast cells derived from MSCs, Alizarin Red staining was perfomed as follows: Cells were washed twice in 2 ml of PBS and then fixed for 30 min at RT in 10 % Formalin (neutral buffered, Sigma-Aldrich cat. #HT501128), followed by two washing steps in 2 ml de-ionized water each. Cells were stained with 1 ml of a filtrated Alizarin red staining solution [20mg/mL Alizarin red S (Carl Roth, cat.

#0348.1) in de-ionized water] for 45 min at RT, washed four times with 1 ml de-ionized water and imaged in 1 ml PBS.

For evaluation of adipogenic differentiation of MSCs, Oil Red O staining was performed as follows: Cells were washed twice in 2 ml PBS and fixed for 30 min in 10 % Formalin as before. Subsequently, cells were washed twice with 2 ml of tap water and fixed for 5 min with 1 ml of 60 % 2-propanol at RT, which was then replaced by 1 ml of a filtrated

Oil Red O working solution [1.8 mg/ml Oil Red O (Sigma-Aldrich cat. #O0625) in de-ionized water, diluted from a stock solution in 2-propanol]. After 10 min incubation at RT, cells were washed twice with 2 ml of PBS, and afterwards stained with 1 ml of filtrated Mayer’s Hematoxylin solution (Sigma, cat. #MHS1) for 5 min at RT. Cells were then washed twice with 2 ml of tap water and imaged in 1 ml PBS.