4. Materials and Methods
4.4 Microbiological methods
cassette was amplified from pUMa1057 with primers XW086/XW087. The neo resistance cassette, the left and right borders of um12021 and EcoRV digested pJET1-Stuffer were assembled by Gibson assembly. For stable integration, the plasmid was cut using SspI and the resulting 4.2 kb fragment was integrated into the U. maydis genome.
pAD2332 (pCas9-sgRNA-um05230):
This plasmid derived from pCas9_sgRNA_0 (Schuster et al., 2016) was used to introduce frame-shift mutations in the locus of um05230 via CRISPR-Cas9 system. The plasmid comprises of NLS-cas9-HA-NLS driven by Potef promoter and the small guide RNA (sgRNA) of um05230 that guides Cas9 to the um05230 locus. A gBlock containing the target sequence of um05230 (GATGAAAGTATCCAGCAGTT) was synthesized from IDT (Coralville, USA). The gBlock was ligated with Acc65I-linearized pCas9_sgRNA_0 vector via Gibson assembly. For stable integration, the circular plasmid was transformed into U. maydis.
pAD2303 (p123-Potef-Cmu1-HA3):
This plasmid derived from p123 was used to overexpress Cmu1-HA3 under the control of Potef
promoter. cmu1 gene was amplified from pAD672 with primers XW034/AD214. The yielding fragment was inserted into p123 using XmaI/AflII. For stable integration, the plasmid was linearized by BsrGI and integrated into the ip locus of AB33.
pAD2368 (p123-Potef-Cmu1Δ117-140-HA3):
This plasmid derived from p123 was used to overexpress Cmu1Δ117-140-HA3 under the control of Potef promoter. cmu1Δ117-140 gene was amplified from pAD2352 with primers XW034/AD214. The yielding fragment was inserted into p123 using XmaI/AflII. For stable integration, the plasmid was linearized by BsrGI and integrated into the ip locus of AB33.
volume) of pre-chilled RF1-solution and incubated for 30 min on ice at 4°C. The suspension was centrifuged at 4°C for 8 min at 3,000 rpm and the supernatant was discarded. E. coli cells were resuspended in 1/20 culture volume (5 mL) of pre-chilled RF2-solution and incubated on ice for 30 min. Finally, competent cells were aliquoted in 50 µL and stored at -80°C for later use.
To transform E. coli, 50 µL aliquots of competent E. coli cells were thawed on ice for 2 min.
Subsequently, up to 1-5 µL DNA solution was added, gently mixed and incubated on ice for 10 min. E. coli cells were then heat shocked at 42°C for 1 min and immediately cooled on ice. For the recovery of the cells, 200 µL dYT medium (without antibiotics) was added and cells were incubated on a heating block (Eppendorf, Wesseling-Berzdorf, Germany) at 1000 rpm for 30 to 60 min (for transformations using Kan) at 30°C or 37°C. The E. coli cells were then plated on YT-agar containing the appropriate selective antibiotics and incubated at 30°C or 37°C overnight.
RF1-solution 100 mM RbCl
50 mM MnCl2∙4H2O 30 mM Potassium acetate*
10 mM CaCl2∙2H2O 15% (w/v) Glycerol
pH was adjusted to 5.8 (glacial acetic acid) and sterile-filtered (Stored at 4°C)
* Use 1 M Potassium acetate solution adjusted to pH=7.5 using glacial acetic acid.
RF2-solution 10 mM MOPS*
10 mM RbCl 75 mM CaCl2∙2H2O 15% (w/v) Glycerol
pH was adjusted to 5.8 (NaOH) and sterile-filtered (Stored at 4°C)
*Use 0.5 M MOPS adjusted to pH=6.8 using NaOH
4.4.2 Protoplast preparation and transformation of U. maydis
Protoplast preparation and transformation of U. maydis strains was performed as described in Schulz et al. (1990). U. maydis cells were incubated overnight in 5 mL YEPSlight medium at28°C with continuous shaking at 200 rpm. Next day, cell cultures were inoculated in fresh YEPSlight to a cell density of OD600 0.1-0.2and grown to a cell density of OD600 0.8-1.0. Cells were harvested by centrifugation at 4 °C for 5 min at 3,500 rpm, washed in 25 mL SCS solution and resuspended in 2 mL SCS containing 3.5 mg/mL Novozyme. Cells were incubated for about 5 min at room temperature to digest the cell wall, which was monitored under the microscope. When 50% of U.
maydis cells became protoplasts, cells were washed three times with 10 mL ice cold SCS and centrifuged at 2,400 rpm for 10 min at 4 °C. This was followed by an additional wash with 20 mL ice cold STC solution and centrifugation step. Finally, protoplast pellets were carefully resuspended in 0.5 mL of ice cold STC, and 60 µL of protoplasts were aliquoted into pre-chilled 1.5 mL microcentrifuge tubes for immediate use, or stored at -80 °C for later use.
For transformation of protoplasts, 1 µL heparin (stock solution 15 mg/mL) and up to 10 µL of DNA (3-5 µg) was added to the protoplast aliquot and incubated for 15 min on ice. Afterwards, 500 µL STC/PEG were added to the protoplasts, mixed gently, and incubated for another 15 min on ice.
The transformation mix was plated on Regenerationagarlight plates. Transformed colonies appeared after 4-6 days and were singled out on PD-agar plates containing the appropriate antibiotic. Single colonies were picked and saved on PD-plates. The Regenerationagarlight plates were prepared by first pouring a bottom phase with 10 mL Regenerationagarlight containing the appropriate concentration of antibiotic (double the concentration indicated in chapter 4.2.3). Later, 10 mL of Regenerationagarlight without antibiotic was poured on top and solidified.
SCS solution Solution 1
0.6 % (w/v) Sodium citrate 2H2O (f. c. 20 mM) 18.2 % (w/v) Sorbitol (Sigma S-1876) (f. c. 1 M) Solution 2
0.4 % (w/v) Citric acid H2O (f. c. 20 mM) 18.2 % (w/v) Sorbitol (Sigma S-1876) (f. c. 1 M) Dissolve each in ddH2O. Add enough Solution 2to Solution 1 to reach pH 5.8 (The ratio between Solution 1 to Solution 2 is approximately 5:1) and autoclave.
STC solution 10 mM Tris-Cl, pH 7.5
100 mM CaCl2
1 M Sorbitol
Dissolve in ddH2Oand sterile filtered.
STC/PEG solution 60.0 % (v/v) STC solution 40.0 % (w/v) PEG3350 Mix and sterile filtered.
4.4.3 Competent cell preparation and transformation of A. tumefaciens
The transformation of A. tumefaciens was conducted by electroporation. A. tumefaciens GV3101
cells were cultivated overnight in 5 mL LB medium supplemented with Rif (50 g/mL) and Gent (25 g/mL) at28°C with continuous shaking at 200 rpm. Next morning, 100 µL overnight culture was harvested and subsequently washed three times with ddH2O. The pellet was resuspended in 100 µL ddH2O, and gently mixed with 1 µL plasmid (from Miniprep).The suspension mix was transferred into a pre-chilled 1 mm electroporation cuvette (PEQLAB,Erlangen, Germany). The cuvette was then placed onto E. coli Pulser (Bio-Rad, Munich, Germany), and the pulser was set to 2.0 kV. After electroporation, 1 mL LB medium without antibiotic was immediately added to the cuvette. The cell suspension was then transferred to a 1.5 mL microcentrifuge tube and recovered at 28°C with continuous shaking. Finally, 15 µL of the cell suspension was plated on LB agar plate containing appropriate antibiotics.
4.4.4 Competent cell preparation and transformation of S. cerevisiae
The transformation of S. cerevisiae was slightly modified from one-step protocol (Chen et al., 1992). S. cerevisiae AH109 cells were cultivated overnight in 5 mL YPD medium at 28°C with continuous shaking at 200 rpm. Next day, fresh YPD medium was inoculated with overnight culture to a cell density of OD600 0.2. After 3-4 h shaking at 28°C, the cell culture was harvested with centrifugation at 4000 rpm for 5 min and washed once with yeast transformation solution (YTS).
The supernatant was removed and the pellet was resuspended in 50 µL of YTS solution. The prepared cell suspension was gently mixed with 1 µg plasmid and incubated at 42°C for 60 min.
Subsequently, 50 µL of YPD medium was added into the suspension mix and gently mixed. Finally, the suspension was spread on the SD plate with appropriate selection pressure incubated for 3-5 days at 28 °C.
Yeast transformation solution (YTS)
40% (w/v) PEG3350 200 mM LiAC 100 mM DTT 15% (w/v) Glycerol
pH was adjusted to 5.8 (glacial acetic acid) and sterile-filtered (Stored at 4°C)
4.4.5 Spotting assay for S. cerevisiae
The yeast two hybrid analysis was performed using the Matchmaker GAL4 Two-Hybrid System 3 (Clontech, Saint-Germain-en-Laye, France) following the manufacturer’s instructions. Yeast cells were grown in 5 mL of SD-Leu-Trp medium at 28°C overnight with continuous shaking at 200
rpm. The cell density of OD600 was adjusted to 0.2 with the same medium in the next morning and the culture was grown to reach the cell density of OD600 1.0. Afterwards, 2 mL of the culture was harvested with centrifugation at 4000 rpm for 5 min and the resulting pellet was washed twice with sterile ddH2O. Lastly, the pellet was resuspended in sterile ddH2O to an OD600 of 1 followed by four serial dilutions (1:10, 1:100, 1:1000 and 1:10000). For each dilution, 5 µL of the suspension was spotted on low stringency plates (SD-Leu-Trp), medium stringency plates (SD-Leu-Trp-His) and high stringency plates (SD-Leu-Trp-Ade-His), respectively. The plates were incubated at 28
˚C for 4-5 days.