Materials and Methods

Cultivation of Borrelia and DNA purification

The strains B. burgdorferi s.s. (N40), B. afzelii (VS461) and B. garinii (PSTH) were grown at 33°C in BSK-H medium (Sigma-Aldrich, Deisendorf, Germany) to a cell density of >108 cells per ml as described (81). All Borrelia strains were kindly provided by T. Kamradt (Berlin, Germany). Only strains subcultured less than 10 times were used, since experiments with low and high passaged Borrelia have shown, that outer surface protein expression varies and infectivity decreases after 11 to 15 passages of in vitro cultivation (266, 319). The infectivity of the N40 strain was confirmed in mouse experiments (C3H/HeN) by the induction of joint swelling after 40 days. Bacteria were harvested by centrifugation (10000xg, 20 min) and washed twice in 0.9% clinical saline (Berlin-Chemie AG, Berlin, Germany). Total chromosomal and plasmid DNA was purified with the QiaAmp tissue kit (Qiagen, Hilden, Germany), according to the

manufacturer's recommendations. The DNA was eluted with 100 µl Tris/EDTA buffer, pH 8.0. The concentration of DNA was determined spectrophotometrically using a GeneQuant II RNA/DNA Calculator (Amersham Biosciences, Freiburg, Germany).

Construction of phage surface display libraries

An independent phage surface display library for each of the three Borrelia strains known to be pathogenic for humans (B. burgdorferi s.s., B. afzelii, B. garinii) was constructed by helper phage superinfection according to the protocol previously published (11). Briefly, 2 µg of Borrelia DNA were partially digested with MboI (Fermentas, St. Leon-Rot, Germany) and restricted fragments > 500 bp were isolated after separation on preparative electrophoresis gels (1%-agarose). The genomic DNA fragments were ligated into a BglII (Fermentas) restricted pJuFo vector (66, 68) at a molar ratio of 1:3. The precipitated ligation mixture was used for electroporation (Gene Pulser(tm), BioRad Laboratories, Hercules, CA, USA) of E. coli strain XL1-Blue (Stratagene, La Jolla, CA, USA). The primary size of the libraries was calculated from the absolute number of independent ampicillin resistant colonies obtained.

Selection of sera for the biopanning

Sera from six patients with clinical manifestations of LB were selected by an experienced general practitioner (D. Hassler). As shown in table 1, all patients suffered from Lyme arthritis. Additional symptoms were myocarditis (patient 1), acrodermatitis chronica atrophicans (patient 4), neuropathy (patient 5) and palpitations (patient 6). All the sera showed positive antibody titers in ELISA and specific bands against Borrelia extract in Western blot (Labor Dr. Selig, Karlsruhe, Germany).

Lyme arthritis (knee),

Table 1: Sera used for the panning pool.

Clinical data of the six LB patients, whose sera were used for the panning pool.

Selection of recombinant phage interacting with patients sera

Polystyrene microtiter wells (Greiner, Nürtingen, Germany) were coated with HRP-linked murine anti-human IgG monoclonal antibodies (Zymed Laboratories Inc., San Francisco, CA, USA). Free binding sites were blocked with Tris-buffered saline (TBS, 2.6 mM KCl, 137 mM NaCl, 25 mM Tris/HCl, pH 7.4) containing 3% skimmed milk powder (Migros, Zürich, Switzerland). Thereafter, 80 µl TBS and 20 µl of the panning pool sera were added to each well and incubated at 4°C overnight. After washing, 1.8x10¹¹ – 1.6x10¹² cfu of each of the phage libraries was added to separate wells and incubated for two hours at 37°C. In a parallel setting, a mixture of equal amounts of each of the Borrelia libraries (mixed library) was enriched. The subsequent washing steps, purification and reinfection procedure for further cycles of affinity selection were performed as described (66). Briefly, unspecific phage were eliminated by 10 (cycle

one to three) or 20 (cycle four and five) consecutive washing steps and adherent phage were eluted by a pH-shift (100 mM glycine/HCl, pH 2.2). Eluted phage were titrated and used to reinfect E. coli for a further cycle of affinity enrichment. The enrichment of the phage was monitored by titration of the number of cfu after each cycle of selection and growth (except round 1).

Sequencing of enriched clones

After five cycles of selection, E. coli XL1-Blue were infected with the eluted phage as described above. The phagemid DNA of randomly picked clones was prepared (standard alkaline lysis) to test the diversity and insert size of the enriched phage by restriction enzyme analysis with PstI (Fermentas). Further, to identify the respective Borrelia proteins encoded, the inserts differing in their size were sequenced using the Thermo Sequence Fluorescent Labelled Primer Cycle Kit (Amersham Pharmacia Bioscience) and an ALFexpressTM machine (Amersham Pharmacia Bioscience). The 5´end of the primer (5´ GGAGTTCATCCTGGCGGC 3´) (MWG, Munich, Germany) was labelled with Cy5. Sequence analysis and all further protein analyses were performed with the OMIGA software package (Accelrys, Cambridge, UK) and the BLAST Search in the National Center for Biotechnology Information (GeneBank) databases.

Production of recombinant proteins

All the newly identified proteins were produced, however, only flgL and ctc resulted in high enough yields for testing. Hence, these two proteins as well as the well known antigen OspC, were produced as N-terminal His6-tagged fusion proteins as described (26) in E. coli Bl21 codon plus cells (Stratagene). The open reading frames were amplified by PCR using the following cycling conditions: 94°C for 60 s, 56°C for 45 s and 72°C for 80 s over 30 cycles, followed by a terminal extension cycle at 72°C for 10 min with the primers listed in table 2. The amplification products were purified over

NucleoSpin columns (Machery-Nagel, Düren, Germany), digested with BamHI and KpnI (Fermentas), ligated to BamHI/KpnI-restricted pQE30 vector (Qiagen) and used for transformation of E. coli Bl21 codon plus cells by electroporation. The gene products from expressing clones were purified under denaturing conditions by Ni²⁺ -chelate affinity chromatography (Qiagen). The fully denaturated proteins were refolded in vitro by stepwise dialysis against TBS / 1 mM EDTA, pH 7.4 (Pectra/Por(r) MWCO 3.500, Spectrum Lab. Houston, TX, USA). Protein concentration was measured using the BioRad protein assay (BioRad, München, Germany) with bovine serum albumin as standard (Fermentas). Purity and molecular mass of the proteins were analyzed by polyacrylamide gradient gels (4-12%, Invitrogen, Groningen, Netherlands) and Coomassie blue staining, using standard protocols.

5´GGGGTACCCTATTTTATAAAAT

Table 2: Primers used for the amplification of the respective genes.

The forward primers contain a BamHI restriction site with a 3´ nucleotide overhang at the 5´end, the backward primer contains a KpnI restriction site with a 3´ nucleotide overhang at the 5´end.

The restriction sites are underlined.

Testing of the antigenicity and specificity of the identified proteins by ELISA

Selective binding of patient antibodies to the newly identified recombinant proteins was analyzed by a direct solid-phase ELISA. Recombinant Borrelia proteins in TBS (10 µg/ml) were coated over night at 4°C to Maxisorp polystyrene microtiter plates (Greiner). After washing, free binding sites were blocked at 37°C for 1 hour with TBS

containing 3% skimmed milk powder (Migros). The plates were incubated at 37°C for 2 hours with well characterized human patient and control sera (22 patients and 13 seronegative donors) diluted 1:200 in TBS containing 3% Tween (Sigma-Aldrich). The sera were taken from patients with clinical symptoms and positive serodiagnosis (ELISA and immunoblot), different from those used in the panning pool. Three patients suffered from Acrodermatitis chronica atrophicans (ACA), six showed neurological disorders and 13 suffered from arthritis. All controls were negative in serodiagnosis.

Alkaline phosphatase-conjugated polyclonal mouse anti-human IgG-antibody (Dako Catomation, Hamburg, Germany) was used as secondary antibody. Plates were washed 5 times between each step with TBST (0.5% Tween20, pH 8.0). The absorbance was measured at 405 nm using a reference wavelength of 690 nm.

Statistic

Statistical analysis was performed using the GraphPad InStat program 3.0 (GraphPad Software, San Diego, USA). Differences between two groups were assessed by unpaired t test, after confirming Gaussian distribution. In the figure ** and *** represent p values <0.01 and <0.001, respectively.