Ditylenchus destructor and D. dipsaci populations used in this study (Table 1) were originally extracted from different host plants, sampled in Germany, Russia and Ukraine (JKI collection).
19 Table 1: Origin of Ditylenchus destructor and D. dipsaci populations used in this study and their host
Population Species Country and location of origin Host plant
A D. destructor Germany sugar beet
B D. destructor Russia Potato
C D. destructor Ukraine Potato
Pop 91 D. dipsaci Frankenbach, Germany sugar beet
pop 80 D. dipsaci Schellerten,, Germany sugar beet
Pop 79 D. dipsaci Korschenbroich, Germany Celery
Pop 60 D. dipsaci Renningen, Germany Maize
Pop 31 D. dipsaci Netherlands Onion
2.1. Nematode culture on carrot disks
These populations were maintained on a modified carrot disks culture method adopted from Speijer & De Waele (1997). Nematodes were sterilized using a streptomycin sulphate (AppliChem®, Darmstadt, Germany) solution at 0.06 mg/10 ml of sterile water for six hours.
Thereafter, nematodes were rinsed three times using sterile water. Approximately 100 µl of water containing about 20 mixed development stages of nematodes were transferred to sterile carrot discs using a sterile pipette. The Petri dishes were sealed with Parafilm® and placed in an incubator (Heraeus®-model BK 5060 EL, Burladingen, Germany) set at 20±1°C for approximately eight weeks.
2.2. Collection of nematodes for morphometrics identification
After eight weeks, some nematodes had egressed onto the surface of the Petri dishes. These nematodes were collected by rinsing the petri-dishes with water using the wash bottle, into a collection bottle. The carrot discs were cut into small pieces using a scalpel blade and transferred to a Baermann funnel overnight to extract nematodes. The nematode suspension was tapped off into the glass bottle the after 12 hours. Nematodes were then used directly for morphometric identification.
2.3. Preparation of nematodes for morphometrics identification
A tipped pipette was prepared prior to nematodes identification for picking individual nematodes in a suspension. The sucking tipped pipette was prepared by burning the tips of two Pasteur pipettes pressed against each other. Then the pipettes were pulled apart after melting started,
20 resulting into a tiny syringe-like opening, which was used to suck the nematodes from the suspension by capillary action.
In order to perform morphometrics, fifteen individual males and female nematodes per population were handpicked using the tipped pipette and placed onto a glass slide (Menzel GmbH, Braunschweig, Germany), to make temporary slide mounts. Two drops of clean water was added into the glass slide, which was placed onto a hot plate set at 50oC for 3 to 5 seconds. A cover slide was then placed onto the water droplet and sample placed under a camera equipped ZEISS Axioskop50® microscope (Carl Zeiss Microscopy GmbH, Göttingen, Germany).
Ditylenchus destructor and D. dipsaci nematodes remained straight when killed by heat, a typical character of Ditylenchus spp.
Morphometric data and light microscopic images were obtained from digital images on a computer screen with the aid of AxioVision® software version 4.8.2 (Carl Zeiss MicroImaging GmbH, Jena, Germany). Morphometrics measurements in micrometers (µm) (unless otherwise stated) were collected under different magnification depending on the feature of interest. Where necessary, references were made to the original description of D. destructor and D. dipsaci (Hooper, 1972; 1973).
2.4. Morphometric measurements
The morphometric data used to characterize the populations were: total nematode length (L), stylet length, stylet knobs diameter and height, body with at the vulva/anus, W = diameter of the body, OES= oesophagous length, PUS = post uterine sack, VBW= body width at vulva, VA=
distance from vulva to anus. Nematode body ratios (a, b and c) were also estimated in our population following the De Manian formula as summarized by Siddiqi(2000). The ratios were calculated as follows:
Nematodes images and measurements were recorded before data analyses were performed as shown for some examples in Fig. 1
21
Fig. 1: Photo micrographs of Ditylenchus destructor and D. dipsaci (a) D. destructor in suspension; (b) body length of female D.
destructor; (c) body length of male D. destructor (d) anterior body of female D. destructor in lateral view; (e) stylet view of female D. dipsaci; (f) spicule of D. destructor male and part of tail; (g) anterior body of female D. dipsaci in lateral view (h) Ovary germinal apex zone of D. dipsaci; (i) D. dipsaci vulva and tail, (j) vulva of D. destructor and egg inside the body; (k) Tail of D. destructor
22 2.5. Morphometric data analysis
Principal Component Analysis (PCA) was used in SAS statistical software version 9.3 (SAS Institute, Cary, NC, USA). A correlation structure estimate among the female and male morphometrical values of D. destructor and D. dipsaci were analyzed by means of component of variance using the Principal Component Analysis procedure referred to as PRINCOMP in SAS.
The males and females characters used in the analysis are as described in morphometric measurements as stated in section (2.4).
Discriminant Function Analysis (DFA) was performed using the CANDISC procedure in SAS in order to find a set of variables that best discriminate the different populations within one species and also differences between the two species (D. destructor and D. dipsaci) based on the pooled within variance-covariance matrix, and to test the hypothesis whether or not the species are significantly different from each other based on morphometric values.
2.6. Molecular analysis 2.6.1. DNA extraction
Total genomic DNA was obtained from 20 hand-picked nematodes from each population as described in Table 1. DNA was isolated using DNeasy Tissue Kit (Qiagen, Hilden, Germany).
DNA was stored at -4°C until further use. Primer set JB3-forward
(TTTTTTGGGCATCCTGAGGTTTAT) and JB5 –reverse
(AGCACCTAAACTTAAAACATAATGAAAATG) were used to amplify the mitochondrial DNA (mtDNA) Cytochrome Oxidase subunit I (COI) gene.
2.6.2. Polymerase chain reaction (PCR)
All the Polymerase chain reactions were carried out using an Eppendorf Thermal cycler (Mastercycler® 5333, Eppendorf AG, Hamburg, Germany). Reactions were performed in 50 μl reaction volumes, containing 5 μl 10x PCR buffer, 3 μl 25 mM MgCl2, 3μl 10 mM each primer, 3μl of 2mM dNTP’s (dATP, dCTP, dGTP, and dTTP), 0.8 μl Taq DNA polymerase 1 U/μl (Fermentas Life Science GmbH, St. Leon-Rot, Germany), 27.2 μl distilled water and 5 μl template DNA. The thermal cycler was programmed for 1 cycle of 5 min at 94°C; and 35 cycles of 94°C for 1 min, respective annealing temperature for each primer for 1 min and 72°C for 2
23 min; followed by a final elongation step of 7 min at 72°C and a holding step for 4°C. PCR mixture without DNA template was always included as a negative control.
2.6.3. Gel electrophoresis
Five microlitres of the amplified PCR product were mixed with 1 µl of 6x loading buffer (Fermentas life science GmbH, St. Leon-Rot, Germany) and loaded onto a 1.0% agarose strength gel in 1x TBE buffer. Five microlitres of DNA ladder 100 bp plus (Fermentas Life Science) was loaded on the first and the last wells next to the samples. Gel electrophoresis was performed at 5 V/cm for 1 hr, stained for 15 minutes with 0.1 ug/ml ethidium bromide, and visualized under UV-light using a computer aided NTAS® gel imager machine (Intas Science Imaging Instrument GmbH, Göttingen, Germany), using the GDS Version 3.32 software.
2.6.4. Cloning and sequencing
PCR products from the COII were cloned using the vector pGEM®-T Easy and Escherichia coli JM109 high efficiency competent cells (Promega, Madison, WI, USA) which were used for transformation of the ligation product. The resultant plasmid DNA obtained from the E. coli culture was purified following the PureYield™ Plasmid Miniprep System (Promega GmbH, Mannheim, Germany) purification kit product guidelines. Samples were sequenced in both directions so as to obtain overlapping sequences for both DNA strands at Macrogen Europe (Amsterdam, The Netherlands). Relevant sequences to D. destructor and D. dipsaci in reference to the current study were obtained from the National Centre for Biotechnology Information (NCBI) gene database (http://blast.ncbi.nlm.nih.gov) and used for comparison purposes with sequences obtained from our populations. The accession numbers and of the sequences sourced from the gene bank and used for phylogenetic analysis are given in Fig. 7.
2.6.5. Phylogenetic analysis
Phylogenetic analyses of sequences obtained in our study and those retrieved from the NCBI-gene bank were conducted using MEGA version 6 software (Tamura et al., 2013). Our sequences pre-assembly processing was carried out in PreGAP4 software (Staden®, Germany) before passing the assemblies to GAP 4 software for comprehensive assembly of the contigs. All sequences were blasted in the NCBI database for similarity search and the relevant sequences from the database obtained for alignment. Additional sequences were sourced from the NCBI,
24 which were to serve as outlier groups in phylogenetic analysis (Table 3). Multiple sequence alignments were constructed using ClustalW 1.4 (Thompson et al., 1994) with our sequences using BioEdit Sequence Alignment Editor (BioEdit V7.2.7, Thomas Hall, USA) (Hall, 1999).
Phylogenetic analysis was based on consensus tree built on the basis of multiple alignments using maximum likelihood (ML) and Maximum Parsimony (MP) as implemented in the software package MEGA6. Kimura 2 parameter model was used to manage missing data and gaps in the contigs (Kimura, 1980). Bootstrap (bs) method was used to determine statistical consistency of each branch using 1000 bootstrapped data set in both ML and MP analysis as obtained in MEGA 6 (Tamura et al., 2013).