Generation of MoDCs
Peripheral blood mononuclear cells were separated from peripheral blood of healthy donors by density gradient centrifugation on Ficoll Paque Plus (Amersham Biosciences, Uppsala Sweden), subsequently monocytes were positively selected using anti-CD14 conjugated microbeads (Miltenyi Biotec, Bergisch-Gladbach, Germany). Monocytes were cultured at 1x106/ml in AIM-V (Gibco, Paisley, UK) supplemented with 50 ng/ml GM-CSF (Leukomax®, Novartis, Basel, Switzerland) and IL-4 (supernatant of an IL-4 producing J558 cell line). After 5-6 days, immature MoDCs were harvested, plated at 1x106 in fresh AIM-V, and maturation was induced by addition of 0.5 μg/ml trimeric sCD40L (PromoCell, Heidelberg, Germany) or 20 μg/ml poly I:C (Sigma, St Louis, MO). Where indicated, 1 μg/ml PGE2 (Minprostin® E2, Pharmacia, Uppsala, Sweden) was added. Usually, maturation was allowed to occur during two days. Where indicated, maturation was terminated at earlier time points to analyze mRNA content.
Transfection
Mature MoDCs were transfected using Amaxa nucleofector technology according to the manufacturer’s instructions. Briefly, 2x106 mature MoDCs were resuspended in 100 μl nucleofector solution provided with the Human Dendritic Cell Nucleofector Kit (Amaxa Biosystems, Cologne, Germany) and mixed with 30 μg plasmid DNA. For MoDCs the nucleofector program U-002 was used. After transfection procedure, MoDCs were cultured in RPMI 1640 medium (Lonza, Verviers, Belgium) supplemented with 10% FCS (Linaris, Wertheim-Bettingen, Germany).
CEM cells were maintained in RPMI 1640 (Lonza, Verviers, Belgium) containing 10% FCS (Linaris, Wertheim-Bettingen, Germany), Penicilin/Streptomycin (100 IU/ml, Lonza) and 100 μM non-essential amino acid mix (Lonza). For transfection, 2x106 CEM cells were resuspended in 100 μl Amaxa Nucleofector Solution V, mixed with 30 μg plasmid DNA and processed according to the manufacturer’s protocol. Nucleofector program X-001 was used for CEM cells.
Transfection efficiency was analyzed by flow cytometry one day after transfection. Dead cells were stained with ToPro3 (Molecular Probes, Eugene OR) or SytoxBlue (Molecular Probes),
Quantitative real-time PCR
Total RNA was isolated from human and mouse cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol, including an additional digest with DNase I (Qiagen). cDNA was synthesized from 1 μg total RNA according to the manufacturer’s instructions using random hexamer primer with the TaqMan® Reverse Transcription Reagents (Applied Biosystems). RGS9-1 and RGS9-2 were quantified by real-time PCR using TGCTCATGAAGAAGGATTCTTATGC and CCTGCGGTCCAGCTTGCT; or 5’-CCTGTCTTTGCCAGGCTCTCA and 5’-TCCTCCGAGTCCATCAAGCA, respectively.
RGS9-1 and RGS9-2 mRNA expression was normalized to two housekeeping genes β-2 microglobulin (β2M) and ubiquitin C (UBC) using 5’-GCTATCCAGCGTACTCCAAAGATTC and 5’-CAACTTCAATGTCGGATGGATGA for β2M and 5’-ATTTGGGTCGCGGTTCTTG and 5’-TGCCTTGACATTCTCGATGGT for UBC, respectively. Reactions were performed with SYBR Green PCR Master Mix (Applied Biosystems) containing 200 nM forward as well as reverse primers according to the manufacturer’s instructions using the Taqman 7700 (Applied Biosystems).
Cloning of RGS9 constructs
A vector containing RGS9L (pcDNA3.1(+)RGS9L) was purchased from Missouri S&T cDNA Resource Center. RGS9L was excised from pcDNA(+)RGS9L using NheI and XhoI restriction sites and inserted into pIRES2-EGFP (Clontech).
ERK activation
For analysis of chemokine-induced ERK activation, 1x106 MoDC were stimulated for two minutes with either 1 μg/ml CCL19 (Promocell) or 1 μg/ml CXCL12 (Promocell) in 50 μl AIM-V medium at 37°C. Cells were lysed on ice in lysate buffer (1% NP-40, 50 mM Tris, 0.25%
sodiumdesoxycholate, 150 mM NaCl, 1 mM NaF, 1 mM EGTA, 1 mM Na3VO4) and protease inhibitor (Roche) for 15 min and subsequently centrifuged for 10 min at 14000 x g. The supernatant was analyzed by Western blotting using a specific anti-human phospho-ERK1/2 antibody (Santa Cruz). Total expression of ERK2 was monitored by re-probing blots with an anti-human ERK2 antibody (Cell Signaling).
Migration assays
Chemotaxis of MoDCs and CEM cells was determined using TranswellTM plates (Corning Costar, NY) with a membrane pore sizes of 5 μm. Therefore, 1x105 cells were placed in the upper well and allowed to migrate to the lower well containing medium supplemented with chemokine for 3 h at 37°C/5%CO2. MoDCs migrated in response to 250 ng/ml CCL21 and 250 ng/ml CXCL12. For CEM cells 1 μg/ml CCL21 or 10 ng/ml CXCL12 was used. The 68
number of cells that migrated through the membrane was counted by flow cytometry using the BD LSRII (BD Biosciences). Specific migration was calculated as percentage of migrated cells from total input cells after subtraction of spontaneous migration towards medium alone.
In experiments with cells expressing a GFP-tagged construct, analyses of migration was constricted to GFP-expressing cells; additionally dead cells were excluded from analysis by positive staining with ToPro3 or SytoxBlue.
Migratory properties of DCs in vivo were determined by skin painting assay. Therefore, 25 μl FITC (1:1 in dibuthylphtalate:acetone) were applied to the shaved abdomen of female, age-matched C57Bl/6 or RGS9-/- mice. After one day, inguinal lymph nodes were taken and disrupted on sterile wire meshes. DCs in cell suspensions of lymph nodes were stained with PE-conjugated anti-mouse CD11c antibody (BD). FITC+CD11c+ cells were quantified relative to all CD11c+ cells, whereas dead cells were excluded by staining with ToPro3.
Analysis of RGS9 deletion in RGS9
-/-RGS9-deficient mice were kindly provided by Prof. J. Schwarz (University Leipzig). DNA was extracted from tail biopsies of C57Bl/6 and RGS9-/- mice using the DNeasy Tissue Kit (Qiagen) according to the manufacturer’s instructions. Disruption of the rgs9 gene was determined by PCR using 5’-TCGCCGCTCCCGATTCGCAGCGCA as forward primer binding inside the MC1neopA cassette and 5’-GAGAAAAGGATCCAGGAACCTGTAG as reverse primer binding outside the 1.3-kb short arm (Chen 2000).
To determine expression of RGS9 in mouse brain, T cells and DCs, mRNA was extracted from respective tissue or cells and transcribed into cDNA. RGS9 was amplified using TaqMan PCR master Mix (Applied Biosystems) according to the manufacturer’s instructions with
5’-®
CCCAAGAATCTCATCCTCAAGC and 5’-TGGCAGTCCAGCGCGTA as primers.
Antigen-specific immune response in vivo
Wild type C57Bl/6 or RGS9-/- mice were injected subcutaneously with 5 mg of poly(lactic-co-glycolic acid) (PGLA) microspheres containing ovalbumin and CpG, which were kindly provided by Dr. E. Schlosser (University of Konstanz). Mice were sacrificed after six days, and spleen cell suspensions were re-stimulated with 10-6M ovalbumin peptide (SIINFEKL) for five hours in the presence of 10 μg/ml Brefeldin A. CD8+ T cells were stained with APC-Cy7-conjugated anti-mouse CD8 antibody (BD Biosciences) and intracellular IFN-γ was stained using a FITC-labeled anti-IFN-γ antibody (kindly provided by Dr. E. Schlosser). IFN-γ production by CD8+ cells was analyzed by flow cytometry using the BD LSRII.
Acknowledgments
We thank Prof. Johannes Schwarz (University Leipzig, Germany) for kindly providing RGS9-deficient mice, Dr. Michael Basler for help and support with mice, Dr. Eva Schlosser for preparation of PLGA microspheres, providing the anti-IFN-γ antibody and technical support, as well as Dr. Eva-Maria Boneberg for scientific advice and vital technical support.
70