Cell culture and transfection. The human embryonic kidney cell line 293T (293 cells) was grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% calf serum at 37°C, 5% CO2 and subcultured every 2-3 days.
293 cells were transfected by calcium-phosphate co-precipitation using 5 - 8 µg of plasmid DNA for each 10 cm culture dish. Primary human granulocytes were isolated from peripheral blood as described previously and used immediately for infection experiments (Schmitter et al. 2004).
Neisserial strains and growth conditions. Opa-expressing, non-piliated N. gonorrhoeae MS11-B2.1 (strain N303 (Opa50), N304 (Opa53), N305 (Opa51), N306 (Opa59), N307 (Opa55), N308 (Opa56), N309 (Opa52), N310 (Opa60), N311 (Opa54), N312 (Opa58), N313 (Opa57)), non-piliated, non-opaque gonococci MS11-B2.1 (strain N302), non-piliated MS11-F3 (strain N554), VP1 Opa68 -expressing, and wildtype N. gonorrhoeae VP1 isolated from a patient with DGI (van Putten et al. 1990; Makino et al. 1991) were kindly provided by T.F. Meyer (Max-Planck Institut für Infektionsbiologie, Berlin, Germany). Whereas strain MS11 expresses PorBIB, the strain VP1 expresses PorBIA (van Putten et al.
1998). Gonococcal strains 11, 102, 229 and 241 were isolated from blood samples from four different patients with DGI. All those isolates were low-passage clinical strains and had the porin PorBIA isoform, however, they were all of different serological variants. Neisseria were grown on GC agar plates (Difco BRL, Paisley, UK) supplemented with appropriate antibiotics and growth supplement at 37°C, 5% CO2 and subcultured daily. For infection or pulldown assays, over-night grown bacteria were taken from GC agar plates, suspended in PBS, and colony forming units (cfu) were estimated by OD550 readings according to a standard curve.
Opa protein nomenclature. Due to the large number of opa gene alleles, the Opa protein nomenclature is confusing. In this paper, we have utilized and extended the Opa protein nomenclature introduced by Kupsch et al. (Kupsch et al. 1993). In this respect, the 11 cloned opa genes from N. gonorrhoeae strain MS11, which are fixed in the “on” phase by silent mutations in the leader peptide coding sequence and which are either expressed from a plasmid in N. gonorrhoeae or which are heterologously expressed in E. coli, are numbered from Opa50 – Opa60 according to increasing apparent molecular weight of the encoded Opa protein upon SDS-PAGE (Kupsch et al. 1993). In a similar manner, the four previously cloned opa genes from N. gonorrhoeae strain VP1 were numbered from Opa65 – Opa68 (Kupsch et al. 1993). We have cloned seven additional opa genes from Ngo VP1 and named them consecutively Opa69 – Opa75. Furthermore, to indicate the specific binding capacity and the functionality of Opa proteins, we have extended the nomenclature by Hauck and Meyer (Hauck and Meyer 2003), who distinguished between OpaHSPG and OpaCEA. It has become clear, that most OpaCEA proteins exclusively bind to one
or all CEACAMs present on epithelial cells (i.e. CEACAM1, CEA, or CEACAM6). Accordingly, we have termed these Opa proteins OpaCEA-e (where
“e” stands for “epithelial CEACAMs”). In contrast, only a minority of OpaCEA
proteins binds to epithelial CEACAMs as well as the granulocyte restricted CEACAM3. Therefore, we have designated these proteins OpaCEA-a (where the
“a” stands for “all CEACAMs”).
Expression of Opa proteins in Escherichia coli. The MS11 Opa52 -expressing E. coli strain was described previously (Kupsch et al. 1993) and was kindly provided by T.F. Meyer (Max-Planck Institut für Infektionsbiologie, Berlin, Germany). In order to express VP1 Opa proteins, opa genes were amplified by PCR from chromosomal DNA of wild type N. gonorrhoeae VP1 with the primers Opa-XhoI-sense (5’- CCTCTCGAGTCTCTTCTCTTCTCTTCC-3’) and Opa1/2-MC58-HindIII-anti (5’-GGTCAAAGCTTTCAGAAGCGGTAGCG-3’) and cloned in pCR Blunt II-TOPO (Invitrogen). To suppress phase variation, the cloning strategy from Kuespert et al. was followed (Kuespert et al. 2011). Accordingly, opa65, opa67, opa69, opa70, opa71, opa72, opa73, opa74 and opa75 were amplified
using the primers Opa-MC58-mitte-sense
(5’-ATCGCTTCTATTTAGCTCTTTATTGTTCAGTTCCCTACTCTTCAGCTCCGCA GCGCAGGCGGCAACTGA-3’) and Opa1/2-MC58-HindIII-anti. The PCR product served as a template for a second PCR using the primers OpaMC58
(pET28)-NcoI-sense
(5’-GGCGCCCATGGAACCAGCCCCCAAAAAACCTTCTCTCCTGTTCTCATCGC TTCTATTTAGCTCTTTA-3’) and Opa1/2-MC58-HindIII-anti. The products of the second PCR were digested with NcoI and HindIII and cloned into pET-28a (Novagen). The nucleotide sequences of VP1 Opa69 – Opa75 were deposited in GenBank under the accession numbers KC503485 - KC503491. VP1 opa68 was amplified by PCR from DNA of the N. gonorrhoeae strain N554 and cloned into pET-28a. The pET-28a vectors encoding Opa proteins were verified by sequencing and transformed into E. coli BL21 (DE3; Novagen), which was induced for protein expression by IPTG. All E. coli strains were cultured at 37°C in Luria-Bertani (LB) supplemented with appropriate antibiotics.
Recombinant plasmid constructs. Mammalian expression plasmid encoding soluble GFP-tagged amino-terminal domains of CEACAM1, CEACAM3, CEA or CEACAM6 were described previously (Kuespert et al.
2007). Mammalian expression vectors encoding GFP-tagged or mKate-tagged full-length CEACAM1-4L or full length CEACAM3 were described previously (Muenzner et al. 2008; Buntru et al. 2011; Voges et al. 2012). Mammalian expression vector encoding GFP-tagged CD105 was also described previously (Muenzner et al. 2005).
Cell lysis and Western blotting. Cell lysis and Western blotting were performed as described earlier (Hauck et al. 2001) using a monoclonal antibody against GFP (clone JL-8, Clontech) or a monoclonal antibody against Opa proteins (clone 4B2/C11; generous gift of Mark Achtman, University College Cork, Cork, Ireland). Secondary antibodies were from Jackson ImmunoResearch (West Grove, PA).
Determination of CEACAM-binding by different bacteria. Expression of the soluble N-terminal domains of human CEACAMs in 293 cells and binding studies with different pathogens were performed as described previously (Kuespert et al. 2007). Briefly, 2 x 107 bacteria were added to CEACAM-N-domain containing cell culture supernatant in a total volume of 1 ml and incubated for 1 h. After incubation, bacteria were washed twice with PBS and either boiled in SDS sample buffer prior to SDS-PAGE and Western blotting or taken up in PBS/2% FCS (flow buffer) and analyzed by flow cytometry.
Gentamicin protection assay. Gentamicin protection assays were conducted as described (Schmitter et al. 2004). Briefly, 293 cells were transfected with CEACAM-encoding or control plasmids by standard calcium-phosphate precipitation. One day post transfection, 5 x 105 cells were seeded in 24-well plates coated with gelatine. The next day, cells were infected with 100 bacteria/cell (MOI 100) and 1 h later, the medium was replaced with DMEM containing 100 µg/ml gentamicin to kill extracellular bacteria. After 45 min of incubation in gentamicin-containing medium, cells were lysed by the addition of 1% saponin in PBS for 15 min. Suitable dilutions were plated in triplicates on GC agar to determine the number of recovered intracellular bacteria.
Cell adhesion assay. Cell adhesion to extracellular matrix proteins was measured essentially as described previously (Muenzner et al. 2010). Briefly, the wells of 96-well plates were coated with 100 μl PBS containing the indicated concentrations of collagen type 1 from calf skin (ICN Biomedicals, Irvine, CA) or bovine serum albumin (BSA), respectively, for 24 hours at 4°C. After coating,
the wells were blocked with 0.2% BSA in PBS for 1 h at room temperature. 293 cells were transfected with pLPS3’EGFP-CD105 (CD105-GFP) or pcDNA-CEACAM1 and one day after transfection, the cells were serum starved for 16 h. Serum starved cells were infected with the indicated bacteria at a MOI of 30 for 8 h. Following infection, the cells were detached by limited trypsin/EDTA treatment, which was stopped by addition of soybean trypsin inhibitor (0.5 mg/ml in DMEM). Detached cells were kept suspended in suspension medium (DMEM, 0.2% BSA) for 1 h at 37°C, and replated at 4 x 104 cells/well in the protein-coated wells of the 96-well plate. Cells were allowed to adhere for 90 min at 37°C, before non-adherent cells were removed by gentle washing with PBS. Adherent cells were fixed and stained with 0.1% crystal violet in 0.1 M borate, pH 9 for 60 min. After washing and drying, the crystal violet was eluted in 10 mM acetic acid and the staining intensity was measured at 550 nm in a Varioskan Flash microplate reader (Thermo Fisher Scientific, Germany).
Immunofluorescence staining. Primary human granulocytes were resuspended in phagocytosis buffer (PB; 1x PBS, 0.9 mM CaCl2, 0.5 mM MgCl2, 5 mM glucose, 1% heat-inactivated calf serum) seeded in 24-well plates and incubated for 30 min at 37°C. The granulocytes were infected (MOI 40) with the different E. coli strains for 30 min at 37°C. Samples were washed 3 times with PBS, fixed with 4% paraformaldehyde in PBS and washed again 3 times with PBS prior to incubation in blocking buffer (PBS, 10% fetal calf serum) for 20 min. Samples were stained with polyclonal anti-E. coli LPS antibody (AbD Serotec; diluted 1:200 in blocking buffer) for 1 h. After 3 washes and 5 min of incubation in blocking buffer, samples were incubated with Cy2-coupled goat anti-rabbit antibodies (1:200) in blocking buffer for 45 min. Following 3 washes, samples were permeabilized with 0.2 % saponin in PBS for 10 min, washed 3 times and again blocked with blocking solution. Samples were stained with polyclonal anti-E. coli LPS antibody and Cy5-coupled goat anti-rabbit as secondary antibody, resulting in Cy2/Cy5-labeled extracellular and exclusively Cy5-labeled intracellular bacteria. DNA was stained with 4',6-diamidino-2-phenylindole (DAPI) 1:10000 for 10 min. The samples were embedded in mounting medium (Dako, Glostrup, Denmark) and viewed with a TCS SP5 confocal laser scanning microscope (Leica, Wetzlar, Germany). Fluorescence signals of triple-labeled specimens were serially recorded with appropriate
excitation and emission filters to avoid bleed-through. Images were digitally processed with NIH Image J and merged to yield pseudocolored pictures.
Oxidative burst measurements. 2 x 105 granulocytes were suspended in 200 µl chemiluminescence buffer (8 g/l NaCl, 0.2 g/l KCl, 0.62 g/l KH2PO4, 1.14 g/l Na2HPO4, 1 g/l glucose, 50 mg/l BSA, pH 7.2) containing luminol (20 µg/ml).
Granulocytes were transferred to a 96-well plate and infected with 1 x 107 bacteria or left uninfected. PMA (1 µg/ml) was used as a positive control for oxidative burst. Chemiluminescence was determined every 2 min at 37°C with a Varioskan Flash. To determine the total amount of reactive oxygen produced, the response curves were exported to GraphPad Prism and the areas under the curves over 90 minutes were calculated.
5.4 Results
N. gonorrhoeae MS11 Opa proteins bind to soluble domains of human CEACAMs. The present study was initiated with the aim to compare the CEACAM-binding properties of N. gonorrhoeae MS11, which causes local infections, with the disseminating strain VP1. Accordingly, the eleven genetically defined Opa proteins of N. gonorrhoeae MS11 strain were analyzed regarding their CEACAM-binding properties. First, Opa protein expression of all strains was verified by Western blotting with a monoclonal antibody against neisserial Opa proteins (Fig. 5.1A). Furthermore, the soluble domains of the indicated CEACAMs were expressed in 293 cells and the recombinant CEACAM domains were adjusted to the same concentration (Fig. 5.1B).
Fig. 5.1: Opa proteins of N. gonorrhoeae strain MS11 bind to amino-terminal domains of CEACAM1, CEACAM3, CEA and CEACAM6. (A) N. gonorrhoeae MS11 strains lacking Opa protein expression (-) or expressing a single defined Opa protein (Opa50 - Opa60) were lysed and Opa protein expression was verified by Western blotting using a monoclonal anti-Opa protein antibody (clone 4B12/C11). (B) Cell culture supernatants containing the amino-terminal domains of the indicated human CEACAMs fused to GFP were collected and the amount of the GFP-fusion proteins was analyzed by Western blotting with a monoclonal anti-GFP antibody.
(C) The soluble CEACAM-GFP fusion proteins were used in pull-down assays together with N. gonorrhoeae MS11 strains expressing the Opa proteins indicated on the left side of the blots.
Precipitates were probed with a monoclonal anti-GFP antibody to detect CEACAMs co-precipitating with the bacteria.
To test CEACAM binding, recombinant N. gonorrhoeae MS11 strains lacking Opa protein expression or constitutively expressing Opa50–Opa60 were incubated with the GFP-tagged soluble amino-terminal domains of CEACAM1, CEA, CEACAM3 and CEACAM6, washed extensively, and the bacteria-associated receptor domains were detected by Western blotting. Upon incubation with the recombinant proteins, Opa-negative variants of MS11 did not bind to any CEACAM (Fig. 5.1C). Importantly, with the exception of Opa50 -expressing bacteria (which are known to bind to heparansulphate proteoglycans; OpaHSPG), each Opa protein expressing MS11 strain was able to bind at least one of the recombinant CEACAM domains (Fig. 5.1C). The interactions identified with the soluble recombinant proteins were in agreement with previous studies, where the binding of N. gonorrhoeae MS11 Opa proteins (expressed in E. coli or N. gonorrhoeae) to CEACAM-expressing HeLa cell lines was analyzed (Bos et al. 1997; Gray-Owen et al. 1997). From the binding profiles it becomes apparent that CEACAM-recognizing Opa proteins (OpaCEA
proteins) of strain MS11 can be grouped into two categories: a large group of OpaCEA proteins, which exclusively binds to CEACAMs found on epithelial cells.
Opa proteins with such a binding profile, e.g. Opa51, Opa53, Opa54, Opa55, Opa56, Opa59, and Opa60, will be designated OpaCEA-e (where the “e” stands for
“epithelial CEACAMs”). In contrast, a small group of MS11 OpaCEA proteins (comprising Opa52, Opa57, and Opa58) binds to epithelial CEACAMs as well as to the granulocyte-restricted CEACAM3. Therefore, these proteins will be designated OpaCEA-a (where the “a” stands for “all CEACAMs”).
N. gonorrhoeae VP1 encodes eleven distinct Opa proteins. In contrast to the eleven distinct Opa proteins encoded by N. gonorrhoeae MS11 (Bhat et al.
1992), only four Opa proteins have been described and partially characterized so far from the N. gonorrhoeae strain VP1 (Kupsch et al. 1993; van Putten et al.
1997). To identify the complete repertoire of VP1 opa genes, VP1 chromosomal DNA was isolated and a PCR with primers targeting the conserved regions of opa genes was performed. Subsequently, the opa amplicons were ligated into pCR Blunt II-TOPO and single clones from this opa amplicon library were sequenced to identify the respective opa genes. Using this strategy we were able to identify nine different VP1 opa genes. Whereas two of these nine sequences (Opa65 and Opa67) had been described in the study by Kupsch (Kupsch et al. 1993), seven VP1 opa genes appear to be novel sequences not reported previously. Further sequencing of more than 80 clones from the VP1 opa amplicon library did not retrieve the previously described opa66 or opa68 or any additional new opa sequence. For our further study, the cloned opa68 gene was kindly provided by T.F. Meyer (MPI Infektionsbiologie, Berlin, Germany), but the previously reported opa66 clone had been lost in their strain collection.
Therefore, we established a further VP1 opa amplicon library and screened about 100 additional clones with opa66-specific primers, but we were not able to detect the opa66 sequence amongst these cloned VP1 opa sequences. The seven novel opa loci were named consecutively opa69 to opa75 with regard to the four VP1 Opa proteins already described (Opa65, Opa66, Opa67, Opa68), implicating that this strain encodes a total of 11 Opa proteins. The deduced amino acid sequences of all VP1 Opa proteins were compared by multiple sequence alignment (Fig. 5.2).
Fig. 5.2: Amino acid sequence alignment of N. gonorrhoeae VP1 Opa proteins. VP1 Opa protein sequences were aligned by pairwise alignment using Clone manager software. The semivariable (SV) region, the hypervariable region 1 (HV1) and HV2 are indicated. Identical amino acids are shaded. Deleted amino acids are indicated by dashes. The corresponding nucleotide sequences were deposited in GenBank under the accession numbers KC503485 - KC503491.
All Opa proteins showed the known domain architecture with conserved regions, the semivariable (SV) region, and the hypervariable (HV) regions 1 and HV2, which are proposed to be responsible for receptor binding (Fig. 5.2).
Interestingly, the amino acid sequence of Opa65, which we have cloned, differed from the previously reported Opa65 sequence at eight positions, mainly in the leader peptide (amino acid position 3, 19, 21, 28, 35, 37, 38) and at amino acid position 129 harbouring a phenylalanine residue at this position (which seems to be conserved in all VP1 Opa sequences) instead of the previously reported isoleucine residue (Kupsch et al. 1993). Therefore, the mature, membrane-embedded Opa65 protein is almost identical between the two studies.
N. gonorrhoeae VP1 Opa proteins bind to soluble domains of epithelial CEACAMs, but not to soluble domains of granulocyte receptor CEACAM3.
Individual VP1 opa genes were then amplified by an established PCR strategy, which abolishes the pentameric repeats contained within the leader peptide coding sequence and arrests the gene in the correct reading frame (Kupsch et al. 1993; Kuespert et al. 2011). The “on”-phase arrested VP1 opa genes were subcloned into the expression vector pET-28a under the control of the T7 promotor and the plasmids were transformed in E. coli BL21 DE3. Upon IPTG induction, all cloned VP1 Opa proteins were successfully expressed in E. coli (Fig. 5.3A). To analyze the CEACAM-binding profile of the ten different VP1 Opa proteins, we incubated the bacteria with similar amounts of soluble
GFP-SV HV1
HV2
fused CEACAM1, CEA, CEACAM3, and CEACAM6 amino-terminal domains (Fig. 5.3B).
Fig. 5.3: N. gonorrhoeae VP1 Opa proteins interact with amino-terminal domains of CEACAM1 and CEA, but not with CEACAM3. (A) The expression of VP1 Opa proteins in E. coli was verified by Western blotting with a monoclonal anti-Opa antibody. (B) The expression of GFP-tagged soluble CEACAM-domains was determined by Western blotting of culture supernatants with a monoclonal anti-GFP antibody. (C) Supernatants containing GFP-tagged, soluble domains of the indicated CEACAMs were incubated with VP1 Opa protein-expressing E. coli. After washing, bacteria were analyzed by flow cytometry and the bacteria-associated GFP-fluorescence was determined as a measure of the interaction between individual VP1 Opa proteins and human CEACAMs. In each case 10000 events were determined.
After washing, the bacteria-associated GFP-fluorescence was detected by flow cytometry as a measure of the interaction between individual VP1 Opa proteins and human CEACAMs. As a positive control, E. coli expressing the Opa52
protein of N. gonorrhoeae MS11 was employed, which showed clear binding to all four distinct CEACAMs (Fig. 5.3C). The flow cytometry results with the MS11 OpaCEA-a protein (Opa52) expressing E. coli corroborate the findings obtained by Western blotting with Opa52-expressing N. gonorrhoeae (Fig. 5.1C). Importantly, most VP1 Opa proteins expressed in E. coli demonstrated clear binding to the amino-terminal domains of CEACAM1 or CEA. None of these Opa proteins was, however, associated with CEACAM3 in a comparable manner (Fig. 5.3C).
There was a very weak binding to CEACAM3 observed for a single VP1 Opa protein, as E. coli expressing the VP1 Opa70 protein showed a slight shift in GFP fluorescence upon incubation with the soluble CEACAM3 amino-terminal domain (Fig. 5.3C). The results of these binding studies are summarized in Table 1.
Table 1: CEACAM- and HSPG-binding profiles of N. gonorrhoeae strain MS11 and strain VP1 Opa proteins. CEACAM-binding properties of Opa proteins derived from N. gonorrhoeae strain MS11 or strain VP1 as determined in this study using soluble, GFP-tagged amino-terminal CEACAM-domains. +++, strong binding; +, weak binding; -, no binding; n.d., not determined. Opa proteins showing strong CEACAM3-binding are indicated in bold. The HSPG-binding profile of Opa proteins was analyzed in the study by Kupsch et al (Kupsch et al. 1993).
Together, OpaCEA proteins of N. gonorrhoeae strain VP1 selectively bind to epithelial CEACAMs, but none of these OpaCEA proteins is a clear-cut ligand for the granulocyte receptor CEACAM3. These results would imply that the disseminating gonococcal strain encodes OpaCEA-e proteins, but no OpaCEA-a
variants and might not trigger opsonin-independent granulocyte responses.
CEACAM1, but not CEACAM3, mediates uptake of E. coli VP1 Opa65. Previous studies have already demonstrated that CEACAM interaction with
MS11 OpaCEA proteins can lead to bacterial internalization into eukaryotic cells (Gray-Owen et al. 1997; McCaw et al. 2004; Schmitter et al. 2007). To address, if VP1 OpaCEA proteins also can initiate CEACAM-mediated uptake, we employed gentamicin protection assays. To better compare MS11 Opa proteins and VP1 Opa proteins, we employed them in the same heterologous strain background in E. coli. Furthermore, we chose E. coli VP1 Opa65 as a prototypical OpaCEA-e protein of this strain. 293 cells were transfected with GFP, GFP-tagged CEACAM1, or GFP-tagged CEACAM3 and the expression of the proteins was verified by Western blotting (Fig. 5.4A).
Fig. 5.4: CEACAM1, but not CEACAM3, mediates internalization of E. coli VP1 Opa65 into human cells. (A) 293 cells were transfected with constructs encoding the indicated CEACAMs fused to GFP or GFP alone. After 48 h, cells were lysed and CEACAM expression was determined by Western blotting with a monoclonal anti-GFP antibody. (B) Expression of MS11 and VP1 Opa proteins in E. coli was verified by Western blotting with a monoclonal anti-Opa antibody. (C) 293 cells were transfected as in (A) and 2 days later, cells were infected for 1 h with E. coli Opa52 or E. coli Opa65 as indicated (MOI of 100). The number of viable intracellular bacteria was determined by gentamicin protection assays. Bars represent mean values ± SEM of 3 independent experiments done in triplicate.
Fig. 5.4: CEACAM1, but not CEACAM3, mediates internalization of E. coli VP1 Opa65 into human cells. (A) 293 cells were transfected with constructs encoding the indicated CEACAMs fused to GFP or GFP alone. After 48 h, cells were lysed and CEACAM expression was determined by Western blotting with a monoclonal anti-GFP antibody. (B) Expression of MS11 and VP1 Opa proteins in E. coli was verified by Western blotting with a monoclonal anti-Opa antibody. (C) 293 cells were transfected as in (A) and 2 days later, cells were infected for 1 h with E. coli Opa52 or E. coli Opa65 as indicated (MOI of 100). The number of viable intracellular bacteria was determined by gentamicin protection assays. Bars represent mean values ± SEM of 3 independent experiments done in triplicate.