2.3.1 Tissue Preparation and Neuron Sorting
The removal of hippocampal CA3 regions was performed under a stereomicroscope (Motic) as described previously (Sultan FA, 2013). The dissected CA3 tissues were snap frozen in liquid nitrogen immediately for later RNA isolation or
Methods
The isolated tissues were homogenized with a mechanical homogenizer in 500 µl of low sucrose buffer (Table 2.4). For crosslinking, 13.5 µl of 37% formaldehyde were added, and samples were rotated 12rpm for 5 min at RT. Crosslinking was quenched by adding 51.4µl 1.25M glycine, and then the samples were kept on a rotator for 5 min before centrifuged at 2000 rcf for 3 min. The supernatant was discarded, and the cell pellet was resuspended in 1 ml low sucrose buffer and homogenize again. Then the samples were carefully pipetted onto 6 ml high sucrose buffer (Table 2.4), followed by centrifugation at 3200 rcf for 10 min at 4ºC. In each tube, the supernatant was removed, and the nuclei pellet was resuspended in 600µl PBS.
-- Nuclei Staining:
0.6µl of NeuN-AF488 primary antibody (Millipore MAB 377X) was added to the resuspended solution containing nuclei. After 20 min incubation at 4ºC on a rotator, the samples were centrifuged at 2000 rcf for 3 min. Then the pellets were washed twice with 1 ml PBST (Table 2.4).
-- Collection of sorted nuclei:
Nuclei were sorted with a BD FACSAria™ III cell sorter (BD Biosciences, USA) into falcon tubes pre-coated with PBTB (Table 2.4), then centrifuged at 3200 rcf for 15 min at 4ºC. The supernatant was discarded, and the pellet was resuspended in leftover buffer and transferred to a new 1.5 ml low-binding Eppendorf to be centrifuged again at 10000 rcf for 2 min. The nuclei pellets were snap frozen in liquid nitrogen and ready for genomic DNA isolation.
Table 2.4. Buffers for FACS
Low sucrose buffer 0.32M sucrose, 5mM CaCl2, 5mM Mg(Ac)2, 0.1mM EDTA, 10mM HEPES (pH 8.0), 1mM DTT, 0.1% Triton X-100 High sucrose buffer 1M sucrose, 3mM Mg(Ac)2, 10mM HEPES (pH 8.0), 1mM
DTT
PBTB (pH 7.5) 5% BSA, 0.2% Tween-20 in 1×PBS, prepared freshly and filtered
PBST (pH 7.5) 0.2% Tween-20 in 1×PBS
Methods
59
2.3.2 RNA Isolation and qPCR
- RNA isolation:
The dissected hippocampal CA3 tissue was homogenized in 400µl TRI Reagent (Invitrogen, Cat No: 15596-026), and incubated at RT for 5min. Then 80µl chloroform was added. After thorough shake by hand, the samples were incubated at RT for 5min, and centrifuged at 12000 rcf for 15min at 4ºC. The upper aqueous phase was carefully collected to mix with 200μl Isopropanol and 1.5μl Glycoblue (Ambion, 15 mg/mL, AM9515, L/N 1405030) and incubated at -20 ºC for 30min, before centrifugation at 12000 rcf for 15min at 4ºC.
The supernatant was discarded, and 5 μl 10X Incubation Buffer (Ambion), 1 μl DNase I (Ambion, AM2222, 2000U, 2U/μl), 0.5 μl RNase OUT (Invitrogen, P/N 100000840, 5000U, 40U/μl) and 43.5 μl RNase-free water were added to the pellet, and the samples were incubated on thermomixer at 550 rpm for 20min at 37 ºC. After adding 150 μl RNase-free water and 200 μl Phenol/Chloroform/Isoamylalcohol, the samples were vortexed and centrifuged at 13000 rpm at RT for 2 min.
The upper phase containing the RNA was carefully collected to mix with 20 μl 3M Na-acetate pH 4.8, 200 μl isopropanol, and 1 μl Glycoblue, before incubation for 30 min at -20 ºC. Afterwards, the samples were centrifuged at 13000 rcf at 4 ºC for 30min, and the pellets were washed and twice with 75% ethanol. The pellets were dried at RT and dissolved in 50µl of RNase-free water, snap-frozen at -80 ºC, and ready for RNA-sequencing.
Methods
60 -- cDNA Synthesis:
cDNA synthesis was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science, Germany). A mixture of 13µl in volume was made with 1 µg of RNA from the sample, 2 µl random hexamer primers (600 pM/µl), and PCR-grade H2O, and incubated at 65 ºC for 10min to denature the RNA. Then the following were added to each sample: 4 µl Transcriptor Reverse Transcriptase Reaction Buffer, 0.5µl Protector RNase Inhibitor (40U/µl), 2µl Deoxynucleotide Mix (10mM), and 0.5µl Transcriptor Reverse Transcriptase (20U/µl). The samples were subsequently incubated at 25 ºC for 10min, at 55 ºC for 30min, at 85 ºC for 5min. The synthesized cDNA was kept on ice or stored at 4 ºC.
-- qRT-PCR (qPCR)
qPCR was performed to check the accuracy of CA3 dissection and the efficiency of ChIP in Light Cycler 480 (Roche Applied Science, Manheim, Germany) and its reaction kit (Roche, Germany). qPCRs were done in duplicate for each sample, and a mixture was pooled from each cDNA sample and diluted serially to the following standard dilutions: 1:1, 1:2, 1:4, 1:8, 1:16, to generate a standard curve for determining cDNA concentration of the samples. PCR-grade H2O was used as a negative control, and the 1:16 cDNA mixture dilution was used as a positive control. In the dissection accuracy check, Tdo2 was used as a marker for DG, Lphn2 for CA3, and Lyd for CA1 region. In the ChIP efficiency check, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter was used as the reference gene, and InterG was used as a negative control for the intergenic area. Primers used are listed in Table 2.5.
Table 2.5.
Primer Forward sequence Reverse sequence
GAPDH promoter TTCACACCGACCTTCAC GGCCACGCTAATCTCAT
InterG AAAACTTCAACTACAGCAAC GAGACGATCGTACTAAGTG
Tdo2 TCCAGGGAGCACTGATGATA CTGGAAAGGGACCTGGAATC
Lphn2 GCCGAGTGAGAAGGATTCG CCCTGCATGTCTTCTCTCGT
Lyd AGTGTGTCCATCGCCTGTG CGTCACTAGCCCTGCATTCT
The qRT-PCR mix contained the following to make a total volume of 15 µl in each sample:
Methods
The reaction conditions are described as follows:
95 ºC -- 5min
Chromatin immunoprecipitation (ChIP) was performed to determine the H3K4Me3 level at promoter areas of variant genes. The frozen nuclei pellets of CA3 PCs were resuspended in 200 µl of RIPA buffer (Table 2.6), and incubated on a rotator for 10min at 4ºC. The samples were sonicated for 35 cycles in Bioruptor Plus (30s concentration and shearing efficiency. 20µl of EB and 0.1µg/µl RNase A were added to the 5µl chromatin sample and incubated on a thermocycler at 450 rpm at 37 ºC for 30min. Then 1 µl of Proteinase K (20mg/ml) and 20µl of Wiemann Buffer 2X (Table 2.6) were added, and incubated on thermocycler at 13000 rpm at 65 ºC for 2 hours.
Afterwards, 3 µl of LPA and 46µl of SureClean (Bioline, UK) were added, and incubated for 10min at RT, before centrifugation at 20000 rcf for 20min at RT. The supernatant was discarded, and the pellet was washed with 80% ethanol once, before being dried and resuspended in 20µl of EB. Now the DNA was ready for bioanalysis
Methods
62
for concentration check and NanoDrop (Thermo Scientific, USA) for fragment size distribution check.
Table 2.6. Buffers for ChIP
RIPA buffer 140mM NaCl, 1mM EDTA, 0.1% Na-Deoxycholate, 1% Triton X-100, 10mM Tris (pH 8.0), 1% SDS
Wash Buffer 100mM Tris (pH 8.0), 1% NP-40, 1% Na-Deoxycholate, 20mM EDTA, 500 mM LiCl
- Immunoprecipitation:
1.8ml of IP Buffer without SDS were added to the samples in order to dilute the SDS to 0.1%. H3K4Me3 antibody (1µg/500ng of chromatin, Abcam, #ab8580) were added and incubated on a rotator at 4ºC overnight. 15µl of blocked protein A coated magnetic beads were added and incubated on a rotator at 4ºC for 1.5 h. The samples were then put on a magnetic rack, and the supernatant was discarded. The beads were washed twice with 1ml of IP Buffer, then three times with 1ml wash buffer, and 1ml of IP Buffer once again.
- DNA Isolation:
20µl of EB and 0.1µg/µl RNase A were added to the beads and the inputs, and incubated on a thermocycler at 450 rpm at 37ºC for 30min. Then 1 µl of Proteinase K (20mg/ml) and 20µl of Wiemann Buffer 2X (Table 2.6) were added, and incubated on thermocycler overnight at 800 rpm at 65 ºC. The supernatant was collected on a magnetic rack, and 3 µl of LPA and 60µl of SureClean (Bioline, UK) were added, and incubated for 10min at RT, before centrifugation at 20000 rcf for 20min at RT. The supernatant was discarded and the pellet was washed twice with 80% ethanol, before being dried and resuspended in 30µl of EB. ChIP efficiency was confirmed with qRT-PCR as described in chapter 2.3.2. After concentration check and library preparation, ChIP-seq was performed.
Methods
63