Generation of Vti1b deficient mice

4.1.1 Isolation of genomic DNA for Vti1b, characterisation of Vti1b chromosomal region and construction of a targeting vector

Figure 8: Schema of Vti1b genomic sequence, targeting vector and the screening strategy for detection of positive ES clones. A) mVti1b genomic sequence; B) targeting construct;

C) strategy for detection of positive ES cell clones using DNA hybridisation techniques

An EST (express sequence tag) clone (Genebank accession number AA105524) was purchased from american type culture collection (ATCC). The clone “235” contained the whole coding sequence of mVti1b, 70bp 5`untranslated region and 200bp 3`untranslated region as cDNA in a pCMV-SPORT2 vector. The insert was cut out by SalI+NotI

digestion and used as DNA probe for screening of a λ-phage mouse genomic DNA library of the strain Sv129 Ola as described under 3.2.7.2, 3.2.7.3 and 3.2.7.4. One phage clone was detected (“phage A”), its DNA amplified and the 15 kb mouse DNA insert was cut out of the phage vector using NotI. This chromosomal DNA fragment was subcloned into the

pSK⁺ Bluescript vector and mapped. A simplified map of the mVti1b chromosomal region is shown in fig.8

The obtained mVti1b chromosomal DNA fragment contains 4 exones, starting from the exon encoding amino acids “59-122” and ending with the exon encoding the C-terminal amino acid residues 202-232 and the 3`untranslated region. The exon “123-180” encodes part of the SNARE motif that is crucial for Vti1b function. Disruption of the exon “123-180” by the Neo-cassette would prevent synthesis of Vti1b protein even in the unlikely case that the resulting mRNA is stable. The subcloned 7 kb-long SpeI DNA fragment containing the exon 123-180 was used for making a targeting construct. A SalI-endonuclease recognition site was introduced into the exon “123-180” by site-directed mutagenesis and a targeting vector constructed by inserting the Neo-cassette into this side.

The construct has 3,5kb DNA for homological recombination on each side of the exon interrupted by the Neo-cassette. Sequences on both sides of the SpeI fragment were known from phage mapping and used for design of DNA probes. The plasmid pVA12 was obtained by SpeI shrinking of the plasmid pVA4 containing the complete 15kb of the phage DNA insert. pVA12 contains the first part of the phage with exon 59-122 til the first SpeI site.

The 5` external probe “EcoRI-derived probe” consists of a 400bp fragment obtained by restriction digestion of the pVA12 DNA with EcoRI. pVA7 contained exon “202-232”

inside of a 3,2kb BglII DNA fragment from phage A . Using oligonucleotides

CCATGAATTGTCACTGTCC as forward and CAAGCTATTAATGTTATACATG as reverse primers and pVA7 as template the 3`external probe “XbaI PCR probe” was obtained by PCR and has 490bp in length. The targeting vector was transferred into

embryonic stem cells (E-14) via electroporation. Selection of transformants was done using Gentamycin 418®.

4.1.2 Obtaining of Vti1b null mutants

Isolated DNA of each transformed ES-cell clone was digested with EcoRI and loaded onto 0,7% agarose gels and southern-blots were obtained. Using DNA hybridisation techniques all clones were checked for homologous recombination with the “EcoRI-derived probe”.

The probe recognises a 4kb wild-type EcoRI fragment and a 4,8kb mutant one because of the presence of an EcoRI site inside of the Neo-cassette. DNA of clones turned out to be positive (8) in that screening was checked for homologous recombination again using XbaI

digestion. “XbaI PCR probe” detects an 8kb wild-type XbaI fragment and a 7kb recombinated one because of the presence of a XbaI site at the beginning of the coding region for the Neo-cassette.

7 clones were double positive out of 96 clones analysed (see fig. 9). These clones had homologous recombination in the Vti1b locus. Clones 114 and 177 were used for blastocyst microinjection.

EcoRI digestion XbaI digestion

Figure 9: Analysis of ES mutant cells Clones 114 and 177 have one wild type and one mutant copy of Vti1b

Two male mice with 50-60% of chimerism were obtained after injection of clone 114.

These chimeras were used for crossing with C57BL females to obtain F1 generation with mice heterozygote for the mutant Vti1b locus. To check for their genotype, a PCR strategy was developed (fig. 10).

Figure 10: PCR strategy for determination of wild type and Vti1b mutant genotypes

Primers Seq5 and Seq50 (nucleotide sequences are CTCTTCTATGATTTCTGTACC and GAGGGATCCAATACCTTCTC respectively), amplifying a 520bp fragment of the wild type genomic region including exon 123-180 and a 1620 bp fragment of the mutated Vti1b region were used for routine PCR analysis (fig.11). In addition, a 375bp fragment derived from the neo-gene was amplified using primers AK30 and AK31 (nucleotide sequences are CGGATCAAGCGTATGCAGCCG and CAAGATGGATTGCACGCAGG respectively).

Figure 11: Vti1b mRNA and protein is missing in vti1b -/- cells

A) PCR analysis of genomic DNA using seq5 and seq50 oligos; B) nothern-blot analysis of Vti1b mRNA using probe “235”; C) western-blot analysis of MEF protein extracts using Vti1b antibodies

After crossing of heterozygous F1 mice, homozygous mVti1b deficient mice were obtained.

Vti1b deficiency was inherited with almost mendelian distribution. 24,8% wild type mice, 55,3% heterozygote and 19,9 % homozygote Vti1b deficient mice (expected would be 25%) were detected among 226 mice from 24 litters. An interruption of exon “123-180”

with the Neo-cassette resulted in total loss of Vti1b mRNA (fig 11). Moreover, a total loss of Vti1b protein was seen in deficient fibroblasts by western-blot with anti-Vti1b

antibodies. Reduced levels of Vti1b protein was observed in heterozygous mice because of a gen-dosis effect (fig 11).