Gene expression analysis

2.7.1. RNA isolation

Deep-frozen liver and eWAT were ground in liquid nitrogen. RNA was isolated from tissue powder by phenolic extraction and purification with a commercial minicolumn system (SV Total RNA Isolation System, Promega, USA). For liver mRNA isolation, 30 mg frozen and powdered tissue were added to 800 µl phenol containing TRIsure (Bioline, UK). To isolate mRNA from eWAT, 100 µg (frozen and powdered) tissue and 1000 µl TRIsure were used. In both cases the mixture was directly homogenized with a dispersing instrument (Ultra-Turrax D-1, Miccra GmbH, Germany) for 20 sec and incubated for 5 min (RT). For lipid-rich samples, an additional centrifugation step is recommended (5 min, 2500 g, 4 °C). The bottom phase under the fat layer of eWAT samples and the homogenate of liver samples are transferred to 200 µl chloroform, respectively. After intensely shaking, short incubation (2 min, RT) and centrifugation (15 min, 12000 g, 4 °C), the samples separated into three phases. The upper, clear phase was added to 500 µl EtOH (75 % in DEPC treated H2O) and mixed well. Samples were transferred to spin columns of the RNA isolation kit and processed referring to the manufacturer’s protocol. After attaching RNA to the columns, degradation of genomic DNA by DNase and washing with EtOH containing buffer, RNA was eluted in 50 µl nuclease-free water.

RNA concentration was measured spectrophotometrically at 260 nm in duplicates with a plate reader (Infinite^® 200 PRO NanoQuant, Tecan Group Ltd, Switzerland).

2.7.2. RNA integrity

Integrity of RNA was determined by visualizing ribosomal RNA (rRNA) on an agarose-gel. 2 µg of RNA were mixed with nuclease-free water to a final volume of 10 µl. After adding 2 µl 6x loading buffer (Carl Roth, Germany) the mixture was incubated for 10 min at 65 °C and then cooled on ice. The gel contained 1 % agarose (Carl Roth, Germany) in 1x TAE buffer and a dye RNA stain (Roti^®-Safe, 5 µl/100 ml). Samples were loaded on the gel, the electrophoresis chamber was filled with 1x TAE running buffer and the system was connected to 110 V. The electrophoretic separation revealed two clear bands (18s rRNA and 28s rRNA) which can be visualized under UV-light due to interaction with the dye.

Buffer composition:

TAE buffer (50x stock): 2 M TrisBase, 0.3 M acetic acid, 50 µM EDTA

6x loading dye: 10 mM Tris-HCl (pH 7.6), 60 mM EDTA, 0.2 % OrangeG, 60 % glycerol 2.7.3. RNA sequencing and data processing

RNA of epididymal white adipose tissue was isolated and integrity was assured. Transcriptome next generation sequencing (RNA-Seq) was performed on the Illumina HiSeq 2000 platform (Illumina, San Diego, CA, USA). TruSeq RNA Sample Prep kit v2 was used to generate RNA-Seq libraries. Up to 7 libraries were pooled per lane and sequenced 50 nt single-sided (plus barcode) using TruSeq SBS kit v3-HS, resulting in a depth of at least 20 million reads per sample.

Reads were mapped to the mouse genome (Genomatix Mining station; Genomatix, Munich, Germany) using the library version NCBI build 37 and ElDorado Version 08-2011 (seed mapping type ‘deep’, 92 % minimum alignment quality). Only unique hits were included in differential expression analysis. Two groups were compared using Genomatix software DESeq 1.10.1 and edgeR 3.0.4 algorithms were applied. The ‘treated group’ versus ‘control group’ was upregulated when fold change of log2 was > 1 (fold change of > 2.72). Downregulation was indicated at fold change log2 < -1 (fold change of < 0.37). Threshold of p-value was set to 0.05 with the use of a multiple testing correction. For further analysis of transcription data, different criteria were defined for the number of total reads per sample, total reads per group, p-value between groups, fold change between groups and coefficient of variation within one group.

2.7.4. cDNA synthesis

RNA was transcribed to complementary deoxyribonucleic acid (cDNA) by viral enzyme reverse transcriptase, using the commercial QuantiTect^® Reverse Transcription kit (Qiagen, Germany).

500 ng template RNA were used for reaction, synthesis steps were performed according to the

manufacturer’s protocol with adapted volumes to an end-volume of 10 µl. Briefly, genomic DNA was eliminated by a reaction mix that was added to the template RNA and incubated for 2 min at 42 °C. Then a combination of reverse transcriptase, oligonucleotides and random hexamer primer mix was transferred to RNA sample resulting in cDNA transcription during two incubation steps (15 min at 42 °C, 3 min at 95 °C).

2.7.5. Quantitative polymerase chain reaction

Measurement of expression of genes of interest was performed by quantitative real-time PCR (qPCR). This method extends the traditional PCR by quantifying target genes using a sensitive optical detection technology. Thereby, SybrGreen intercalates into dsDNA, leading to a photometrically detectable fluorescent signal. With ongoing amplification of DNA templates during every cycle, the fluorometric signal increases until it exceeds background fluorescence (=

cycle threshold, Ct-value). The Ct-value gives information about the relative amount of target template in the cDNA when compared to a standard curve. A standard curve was generated for all cDNA samples pooled and diluted 2ⁿ in 8 steps. To correct for inter-individual differences, the expression of the gene of interest was normalized to the abundance of two housekeeping genes.

Reaction mixture preparation with total volume of 12.5 µl and temperature program are given in table 2. Primer sequences were chosen to generate specific PCR products with up to 250 bp and were validated by in silico PCR (http://genome.ucsc.edu/) (table 3). Quantitative PCR was carried out in a 384-well format and analyzed in in the LightCycler^® 480 Instrument II (Roche, Switzerland). Samples for the generation of the standard were measured in duplicates, cDNA samples in triplicates. At the end of the program a melting curve was generated to assure the quality of amplified PCR products and to identify non-specific reaction products.

Table 2: Quantitative PCR reaction mixture and temperature program.

Component Volume per reaction Step Temperature Time

cDNA (1:20 diltution) 1.00 µl Denaturation 95 °C 420 sec

Forward primer (5 nM) 1.25 µl Cycle (45x) 97 °C 10 sec

Reverse primer (5 nM) 1.25 µl 53 °C 15 sec

SensiMix (2x)* 6.75 µl 72 °C 20 sec

Nuclease-free H2O 2.25 µl Melting curve 60-95 °C continous

* SensiMix SYBR No-ROX (Bioline, UK) containing SybrGreen

Table 3: Primer for qPCR. All primers were produced by Eurofins MWG Operon, Germany: Fbp (fructose-bisphosphate aldolase B), G6p (glucose-6-phosphatase), housekeeping genes Hprt (hypoxanthine-guanine phosphoribosyl transferase) and Hmbs (hydroxymethylbilane synthase), Insr (insulin receptor), Pck1 (phosphoenolpyruvate carboxykinase 1), Slc2a2 (glucose transporter 2), Slc2a4 (glucose transporter 4), Socs3 (suppressor of cytokine signaling 3).

Target mRNA Primer forward Primer reverse

Fbp TCCCTATTGTTGAGCCAGAG GCCAGGACCTTCTCAGAAAC

G6p CGACTCGCTATCTCCAAGTGA GTTGAACCAGTCTCCGACCA

Hmbs ACTCTGCTTCGCTGCATTG AGTTGCCCATCTTTCATCACTG

Hprt TCAGTCAACGGGGGACATAAA GGGGCTGTACTGCTTAACCAG

Insr ATCAGAGTGAGTATGACGACTCGG TCCTGACTTGTGGGCACAATGGTA

Pck1 GTGCCTGTGGGAAGACTAAC TTGATAGCCCTTAAGTTGCC

Slc2a2 TCAGAAGACAAGATCACCGGA GCTGGTGTGACTGTAAGTGGG

Slc2a4 GTAACTTCATTGTCGGCATGG AGCTGAGATCTGGTCAAACG

Socs3 GGGTGGCAAAGAAAAGGAG GTTGAGCGTCAAGACCCAGT