Flow cytometric analyses - Materials and methods

Characterisation of stem cell marker expression in spheroid cells derived from the canine prostate adenocarcinoma cell line

4.5 Materials and methods

5.5.4 Flow cytometric analyses

The efficiency test for all analysed genes was assured by applying serial dilutions for 1: 2 and 1: 10, and all assays efficiency were resulted between 0.91 and 1.10.

Most of selected stem cell markers in this article have been already characterised in adherent CT1258 cell line in previous study. Therefore, the adherent CT1258 cell line was selected as calibrator and was set as “1” to make sure a comparable ΔΔCT analysis in all target genes referenced to the expression level.

Table 1 Primer pairs used in quantitative real-time PCR

5.5.4 Flow cytometric analyses

For flow cytometric analysis, the spheroid CT1258 cells were centrifuged at 850 rpm for 5 min and subsequently the pellet was dissociated by treatment with accutase (Life Technologies GmbH, Frankfurt, Germany) for 5 min in order to obtain single cells for flow cytometric analyses. We used adherent CT1258 cells being cultivated under regular conditions [76] as a reference for later comparison with spheroid CT1258 cells. After a washing step with phosphate-buffered saline (PBS) (Biochrom AG, Berlin, Germany), the adherent CT1258 cells were also treated with accutase as described above.

Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Amplicon (bp) CD34 ACCAGAGCTATTCCCGCAAG TTTCTCCTGTAGGGCTCCAA 120 CD133 CTTTCTCATGGTCGGAGTTGG TGGAATAGTTTCCTGTTCTGGTAAG 135 C-KIT AGAAACGTGAAGCGCGAGTA ACACAACTGGTACAGCTCGATGG 129 CD44 AATGCTTCAGCTCCACCTG CGGTTAACGATGGTTATGGTAATT 92 OCT4 CGAGGAGTCCCAAGACATCA AACACCTTCCCAAAGAGAACC 138 NANOG CTATAGAGGAGAGCACAGTGAAG GTTCGGATCTACTTTAGAGTGAGG 141 KLF4 CCACATTAATGAGGCAGCCA CTCCCGCCAGCGGTTATT 146 SOX2 GGAAACTTTTGTCGGAGACG CGGGGCCGGTATTTATAATC 103 C-MYC TCGGACTCTCTGCTCTCCTC TTCTTCCTCCGAGTCGCT 108 MELK CCAAGGGTAACAAGGACTAC CTCCAAACATCTGCCTCTGA 112 DDX5 AACTTCCCTGCAAATGTAATGGA AGTCTGTGCTACTCCAACCAT 123 Beta-actin

(ß-act) TCGCTGACAGGATGCAGAAG GTGGACAGTGAGGCCAGGAT 127

Manuscript II

All different CT1258 cell suspensions were adjusted for total number 10⁵ cells in 100 µl using a cellometer Auto T4 (Nexcelom Bioscience, Lawrence, USA). The adherent as well as the spheroid CT1258 cells were incubated for 30 min at 4°C with either monoclonal anti-CD44-FITC (eBioscience, Frankfurt, Germany), or with anti-CD133-PE (eBioscience) (Table 2) antibodies. The samples were analysed via flow cytometry as described previously [43].

Table 2 Antibodies used for flow cytometric analyses

Competing Interests

The authors declare that they have no competing interests

Authors’ contributions

MM and WL performed all the experiments and partially draft of the manuscript. SW and AN participated in drafting and finalization of the manuscript. IN is the head of research group, participated in study designing and edited and approved the final manuscript. HME principal study designing, coordinated and supervised all work packages, and participated in drafting the finalization of the manuscript.

Monoclonal

Antibody Specificity Clone Marker identified

Monoclonal Isotype Anti-Canine CD44 FITC

eBioscience Dog YKIX337.8 CD44 Rat IgG2aκ FITC

BD Bioscience PE anti-mouse CD133

eBioscience

Mouse/ Dog 13A4 CD133 Rat IgG1κ PE eBioscience

Manuscript II

Acknowledgements

We are grateful to the German Academic Exchange Service (DAAD) and their personal for the financial supports and kind guidance of M. Moulay. We also would like to acknowledge the financial supports of CSC (Chinese scholarship council) to Wen Liu. We thank Florenza Ripoli (Small Animal Clinic, University of Veterinary Medicine Hannover, Germany) for assisting in edition of the manuscript.

4.6 References:

1.! American! Cancer! Society:! Cancer' Facts' &' Figures' 2013.!Atlanta:' American' Cancer'Society'2013.!

2.! Waters!DJ,!Sakr!WA,!Hayden!DW,!Lang!CM,!McKinney!L,!Murphy!GP,!Radinsky!R,!

Ramoner! R,! Richardson! RC,! Tindall! DJ:!Workgroup' 4:' Spontaneous' prostate' carcinoma'in'dogs'and'nonhuman'primates.!The'Prostate'1998,!36(1):64Q67.!

3.! Waters! DJ,! Patronek! GJ,! Bostwick! DG,! Glickman! LT:!Comparing' the' age' at' prostate'cancer'diagnosis'in'humans'and'dogs.!Journal'of'the'National'Cancer' Institute'1996,!88(22):1686Q1687.!

4.! Macewen!EG:!Spontaneous'Tumors'in'Dogs'and'Cats'A'Models'for'the'Study'of' Cancer'Biology'and'Treatment.!Cancer'Metast'Rev'1990,!9(2):125Q136.!

5.! Cornell! KK,! Bostwick! DG,! Cooley! DM,! Hall! G,! Harvey! HJ,! Hendrick! MJ,! Pauli! BU,!

Render! JA,! Stoica! G,! Sweet! DC' et' al:! Clinical' and' pathologic' aspects' of' spontaneous' canine' prostate' carcinoma:' a' retrospective' analysis' of' 76' cases.!The'Prostate'2000,!45(2):173Q183.!

6.! Rosol!TJ,!TannehillQGregg!SH,!LeRoy!BE,!Mandl!S,!Contag!CH:!Animal'models'of' bone'metastasis.!Cancer'2003,!97(3!Suppl):748Q757.!

7.! Lawrence!JA,!Saba!CF:!Tumors' of' the' Male' Reproductive' System.!Withrow'&' MacEwen’s'Small'Animal'Clinical'Oncology'2013,!5:557Q571.!

8.! Axiak!SM,!Bigio!A:!Canine'prostatic'carcinoma.!Compend'Contin'Educ'Vet'2012,!

34(10):E1Q5.!

9.! Fan! TM,! deLorimier! LP:!Tumors' of' the' Male' Reproductive' System.!in' Small' Animal' Clinical' OncologyWB' edited' by' Withrow' and' Vaul' DM' Saunders' Elsevier' 2007,!4:637Q649.!

10.! LeRoy! BE,! Northrup! N:!Prostate' cancer' in' dogs:' Comparative' and' clinical' aspects.!Vet'J'2009,!180(2):149Q162.!

11.! Bell! FW,! Klausner! JS,! Hayden! DW,! Feeney! DA,! Johnston! SD:! Clinical' and' pathologic' features' of' prostatic' adenocarcinoma' in' sexually' intact' and' castrated' dogs:' 31' cases' (1970A1987).!Journal' of' the' American' Veterinary' Medical'Association'1991,!199(11):1623Q1630.!

12.! Rowell!JL,!McCarthy!DO,!Alvarez!CE:!Dog'models'of'naturally'occurring'cancer.!

Trends'Mol'Med'2011,!17(7):380Q388.!

13.! Argyle!DJ:!Prostate'cancer'in'dogs'and'men:'A'unique'opportunity'to'study' the'disease.!Vet'J'2009,!180(2):137Q138.!

Manuscript II

14.! Navone! NM,! Logothetis! CJ,! von! Eschenbach! AC,! Troncoso! P:!Model' systems' of' prostate'cancer:'Uses'and'limitations.!Cancer'Metast'Rev'1998,!17(4):361Q371.!

15.! Russell!PJ,!Voeks!DJ:!Animal' models' of' prostate' cancer.!Methods'in'molecular' medicine'2003,!81:89Q112.!

16.! Seachrist!L:!Man's'best'friend'may'be'companion'in'cancer'research.!Journal' of'the'National'Cancer'Institute'1993,!85(18):1455Q1456.!

17.! Waters! DJ,! Hayden! DW,! Bell! FW,! Klausner! JS,! Qian! J,! Bostwick! DG:!Prostatic' intraepithelial' neoplasia' in' dogs' with' spontaneous' prostate' cancer.!The' Prostate'1997,!30(2):92Q97.!!

18.! Waters!DJ,!Sakr!WA,!Hayden!DW,!Lang!CM,!McKinney!L,!Murphy!GP,!Radinsky!R,!

Ramoner! R,! Richardson! RC,! Tindall! DJ:!Workgroup' 4:' spontaneous' prostate' carcinoma'in'dogs'and'nonhuman'primates.!The'Prostate'1998,!36(1):64Q67.!

19.! Khanna! C,! LindbladQToh! K,! Vail! D,! London! C,! Bergman! P,! Barber! L,! Breen! M,!

Kitchell!B,!McNeil!E,!Modiano!JF'et'al:!The'dog'as'a'cancer'model.!Nat'Biotechnol' 2006,!24(9):1065Q1066.!

20.! Lawson! DA,! Witte! ON:! Stem' cells' in' prostate' cancer' initiation' and' progression.!J'Clin'Invest'2007,!117(8):2044Q2050.!

21.! Diehn!M,!Clarke!MF:!Cancer' stem' cells' and' radiotherapy:' new' insights' into' tumor' radioresistance.! Journal' of' the' National' Cancer' Institute' 2006,!

98(24):1755Q1757.!

22.! Sakariassen! P,! Immervoll! H,! Chekenya! M:!Cancer' Stem' Cells' as' Mediators' of' Treatment'Resistance'in'Brain'Tumors:'Status'and'Controversies.!Neoplasia' 2007,!9(11):882Q892.!

23.! Blacking! TM,! Wilson! H,! Argyle! DJ:!is' ' cancer' a' stem' cell' disease?' theory,' evidence'and'implication.!Veterinary'and'Comparative'Oncology,'2007!5,'2,'76–

89.!

24.! Argyle! DJ,! Khanna! C:!Tumor' Biology' and' Metastasis.!Withrow' &' MacEwen’s' Small'Animal'Clinical'Oncology'2013,!5'30Q50.!

25.! Yamamoto!H!MJ,!Dasgupta!P,!Chandra!A,!Popert!R,!Freeman!A,!Ahmed!A.:!CD49f' is' an' efficient' marker' of' monolayerA' and' spheroid' colonyAforming' cells' of' the'benign'and'malignant'human'prostate.!PLoS'One'2012,!7((10):e46979):1Q 11.!

26.! Gu! MJ,! Jang! BI:!Clinicopathologic' Significance' of' Sox2,' CD44' and' CD44v6' Expression'in'Intrahepatic'Cholangiocarcinoma.!Pathology'oncology'research':' POR'2014.!

27.! Zhou! Bin! ZG,! Ge! Yan,! Zhou! Huan,! Lv! Desheng,! and! Zhang! Xueguang:!

Overexpression' of' B7AH3' in' CD133D' colorectal' cancer' cells' is' associated' with'cancer'progression'and'survival'in'human'patients.!Elsevier'2014:1Q8.!

Smissen! WJ,! Smid! M,! Timmermans! AM,! Martens! JW,! Gratama! JW' et' al:!CD49fA based'selection'of'circulating'tumor'cells'(CTCs)'improves'detection'across' breast'cancer'subtypes.!Cancer'letters'2012,!319(1):49Q55.!!

Manuscript II

31.! Leong!KG,!Wang!BE,!Johnson!L,!Gao!WQ:!Generation'of'a'prostate'from'a'single' adult'stem'cell.!Nature'2008,!456(7223):804Q808.!

32.! Magri! L,! Gacias! M,! Wu! M,! Swiss! VA,! Janssen! WG,! Casaccia! P:!cAMycAdependent' transcriptional' regulation' of' cell' cycle' and' nucleosomal' histones' during' oligodendrocyte'differentiation.!Neuroscience'2014.!

33.! Wang! Z,! Oron! E,! Nelson! B,! Razis! S,! Ivanova! N:!Distinct' lineage' specification' roles'for'NANOG,'OCT4,'and'SOX2'in'human'embryonic'stem'cells.!Cell'stem' cell'2012,!10(4):440Q454.!

34.! Jeter!CR,!Liu!B,!Liu!X,!Chen!X,!Liu!C,!CalhounQDavis!T,!Repass!J,!Zaehres!H,!Shen!JJ,!

Tang! DG:!NANOG' promotes' cancer' stem' cell' characteristics' and' prostate' cancer' resistance' to' androgen' deprivation.!Oncogene'2011,!30(36):3833Q 3845.!

35.! Geissler!V,!Altmeyer!S,!Stein!B,!UhlmannQSchiffler!H,!Stahl!H:!The' RNA' helicase' Ddx5/p68' binds' to' hUpf3' and' enhances' NMD' of' Ddx17/p72' and' Smg5' mRNA.!Nucleic'Acids'Res'2013,!41(16):7875Q7888.!

36.! !Ying! S,! Walden! A:! Function' of' KLF4' in' Stem' Cell' Biology' Chapter' 15:' Pluripotent' Stem' Cells' book' edited' by' Deepa' Bhartiya' and' Nibedita' Lenka,' ISBN' 978R953R51R1192R4,'Published:'August'28,'2013'under'CC'BY'30'license'2013.! of' tumorigenic' prostate' cancer' stem' cells.! Cancer' research' 2005,!

65(23):10946Q10951.!

41.! Yu!SC,!Bian!XW:!Enrichment'of'cancer'stem'cells'based'on'heterogeneity'of' invasiveness.!Stem'cell'reviews'2009,!5(1):66Q71.!

42.! Wang!S,!Huang!S,!Zhao!X,!Zhang!Q,!Wu!M,!Sun!F,!Han!G,!Wu!D:!Enrichment' of' prostate'cancer'stem'cells'from'primary'prostate'cancer'cultures'of'biopsy' samples.! International' journal' of' clinical' and' experimental' pathology' 2014,!

7(1):184Q193.!

43.! Moulay!M,!Liu!W,!Willenbrock!S,!Sterenczak!KA,!Carlson!R,!Ngezahayo!A,!Murua!

Escobar!H,!Nolte!I:!Evaluation'of'Stem'Cell'Marker'Gene'Expression'in'Canine' Prostate' CarcinomaA' and' Prostate' CystAderived' Cell' Lines.!Anticancer' Res' 2013,!33(12):5421Q5431.!

44.! Tang!DG,!Patrawala!L,!Calhoun!T,!Bhatia!B,!Choy!G,!SchneiderQBroussard!R,!Jeter!

C:!Prostate' cancer' stem/progenitor' cells:' identification,' characterization,' and'implications.!Molecular'carcinogenesis'2007,!46(1):1Q14.!

45.! Wang! L,! Huang! X,! Zheng! XM,! Wang! XH,! Li! SW,! Zhang! L,! Yang! ZH,! Xia! ZP:!

Enrichment' of' Prostate' Cancer' StemALike' Cells' from' Human' Prostate' Cancer' Cell' Lines' by' Culture' in' SerumAFree' Medium' and' Chemoradiotherapy.!International'Journal'of'Biological'Sciences'2013,!9(5):472Q 479.!

Manuscript II

46.! Fan!X,!Liu!S,!Su!F,!Pan!Q,!Lin!T:!Effective'enrichment'of'prostate'cancer'stem' cells' from' spheres' in' a' suspension' culture' system.!Urologic'oncology'2012,!

30(3):314Q318.!

47.! Blacking!TM,!Waterfall!M,!Samuel!K,!Argyle!DJ:!Flow'cytometric'techniques'for' detection' of' candidate' cancer' stem' cell' subpopulations' in' canine' tumour' models.!Veterinary'and'comparative'oncology'2012,!10(4):252Q273.!

48.! Miki!J,!Furusato!B,!Li!H,!Gu!Y,!Takahashi!H,!Egawa!S,!Sesterhenn!IA,!McLeod!DG,!

Srivastava!S,!Rhim!JS:!Identification'of'putative'stem'cell'markers,'CD133'and' CXCR4,' in' hTERTAimmortalized' primary' nonmalignant' and' malignant' tumorAderived' human' prostate' epithelial' cell' lines' and' in' prostate' cancer' specimens.!Cancer'research'2007,!67(7):3153Q3161.!

Karczmar! GS,! Stadler! WM:! DiffusionAWeighted' and' Dynamic' ContrastA Enhanced' MRI' of' Prostate' Cancer:' Correlation' of' Quantitative' MR' Parameters' With' Gleason' Score' and' Tumor' Angiogenesis.!American'Journal' of'Roentgenology'2011,!197(6):1382Q1390.!

51.! Kuranda!K,!Berthon!C,!Lepretre!F,!Polakowska!R,!Jouy!N,!Quesnel!B:!Expression' of' CD34' in' hematopoietic' cancer' cell' lines' reflects' tightly' regulated' stem/progenitorAlike'state.!J'Cell'Biochem'2011,!112(5):1277Q1285.!

52.! Gangemi!RMR,!Griffero!F,!Marubbi!D,!Perera!M,!Capra!MC,!Malatesta!P,!Ravetti!GL,!

Zona! GL,! Daga! A,! Corte! G:!SOX2' Silencing' in' Glioblastoma' TumorAInitiating' Cells' Causes' Stop' of' Proliferation' and' Loss' of' Tumorigenicity.!Stem' cells' 2009,!27(1):40Q48.!

53.! Liu!G,!Yuan!X,!Zeng!Z,!Tunici!P,!Ng!H,!Abdulkadir!IR,!Lu!L,!Irvin!D,!Black!KL,!Yu!JS:!

Analysis' of' gene' expression' and' chemoresistance' of' CD133+' cancer' stem' cells'in'glioblastoma.!Molecular'cancer'2006,!5:67.!

54.! Nakano! I,! Paucar! AA,! Bajpai! R,! Dougherty! JD,! Zewail! A,! Kelly! TK,! Kim! KJ,! Ou! J,!

Groszer!M,!Imura!T'et'al:!Maternal'embryonic'leucine'zipper'kinase'(MELK)' regulates' multipotent' neural' progenitor' proliferation.! J' Cell' Biol' 2005,!

170(3):413Q427.!

55.! Hebbard!LW,!Maurer!J,!Miller!A,!Lesperance!J,!Hassell!J,!Oshima!RG,!Terskikh!AV:!

Maternal'Embryonic'Leucine'Zipper'Kinase'Is'Upregulated'and'Required'in' Mammary'TumorAInitiating'Cells'In'vivo.!Cancer'research'2010,!70(21):8863Q 8873.!

56.! Nakano! I,! MastermanQSmith! M,! Saigusa! K,! Paucar! AA,! Horvath! S,! Shoemaker! L,!

Watanabe! M,! Negro! A,! Bajpai! R,! Howes! A' et' al:!Maternal' embryonic' leucine' zipper' kinase' is' a' key' regulator' of' the' proliferation' of' malignant' brain' tumors,' including' brain' tumor' stem' cells.!Journal' of' Neuroscience' Research' 2008,!86(1):48Q60.!

57.! Visvader!JE,!Lindeman!GJ:!Cancer' stem' cells' in' solid' tumours:' accumulating' evidence'and'unresolved'questions.!Nat'Rev'Cancer'2008,!8(10):755Q768.!

58.! Richardson!GD,!Robson!CN,!Lang!SH,!Neal!DE,!Maitland!NJ,!Collins!AT:!CD133,'a' novel'marker'for'human'prostatic'epithelial'stem'cells.!Journal'of'cell'science' 2004,!117(Pt!16):3539Q3545.!

Manuscript II

59.! Wiesner! C,! Nabha! SM,! Dos! Santos! EB,! Yamamoto! H,! Meng! H,! Melchior! SW,!

Bittinger!F,!Thuroff!JW,!Vessella!RL,!Cher!ML'et'al:!CAkit'and'its'ligand'stem'cell' factor:'potential'contribution'to'prostate'cancer'bone'metastasis.!Neoplasia' 2008,!10(9):996Q1003.!

60.! Sroka!I.C,!Pond!GD,!Nagle!R.B,!Porreca!F,!!King!T,!Pestano!G,!!Futscher!B.W,!Gard!

J.M,!Riley!J,!Sathyanarayana!U.G!and!Cress!A.E:!Human' Cell' Surface' Receptors' as' Molecular' Imaging' Candidates' for' Metastatic' Prostate' Cancer.!The'Open' Prostate'Cancer'Journal,'2009,!2:59Q66.!

61.! Gangemi! RM,! Griffero! F,! Marubbi! D,! Perera! M,! Capra! MC,! Malatesta! P,!

Ravetti!GL,!Zona!GL,!Daga!A,!Corte!G:!SOX2' silencing' in' glioblastoma' tumorA initiating'cells'causes'stop'of'proliferation'and'loss'of'tumorigenicity.!Stem' cells'2009,!27(1):40Q48.!

62.! Clark!EL,!Coulson!A,!Dalgliesh!C,!Rajan!P,!Nicol!SM,!Fleming!S,!Heer!R,!Gaughan!L,!

Leung!HY,!Elliott!DJ'et'al:!The'RNA'helicase'p68'is'a'novel'androgen'receptor' coactivator' involved' in' splicing' and' is' overexpressed' in' prostate' cancer.!

Cancer'research'2008,!68(19):7938Q7946.!

63.! Le!Page!Y,!Chartrain!I,!Badouel!C,!Tassan!JP:!A' functional' analysis' of' MELK' in' cell'division'reveals'a'transition'in'the'mode'of'cytokinesis'during'Xenopus' development.!Journal'of'cell'science'2011,!124(Pt!6):958Q968.!

64.! Rowland! BD,! Bernards! R,! Peeper! DS:! The' KLF4' tumour' suppressor' is' a' transcriptional'repressor'of'p53'that'acts'as'a'contextAdependent'oncogene.!

Nat'Cell'Biol'2005,!7(11):1074Q1082.!

65.! Jia! X,! Li! X,! Xu! Y,! Zhang! S,! Mou! W,! Liu! Y,! Liu! Y,! Lv! D,! Liu! CH,! Tan! X'et'al:!SOX2' promotes' tumorigenesis' and' increases' the' antiAapoptotic' property' of' human'prostate'cancer'cell.!J'Mol'Cell'Biol'2011,!3(4):230Q238.!

66.! Yu! KR,! Yang! SR,! Jung! JW,! Kim! H,! Ko! K,! Han! DW,! Park! SB,! Choi! SW,! Kang! SK,!

Scholer! H' et' al:! CD49f' Enhances' Multipotency' and' Maintains' Stemness' Through'the'Direct'Regulation'of'OCT4'and'SOX2.!Stem'cells'2012,!30(5):876Q 887.!

67.! Dang!CV:!MYC'on'the'path'to'cancer.!Cell'2012,!149(1):22Q35.!

68.! Wang! J,! Kobayashi! T,! Floc'h! N,! Kinkade! CW,! Aytes! A,! Dankort! D,! Lefebvre! C,!

Mitrofanova!A,!Cardiff!RD,!McMahon!M'et'al:!BARaf'activation'cooperates'with' PTEN' loss' to' drive' cAMyc' expression' in' advanced' prostate' cancer.!Cancer' research'2012,!72(18):4765Q4776.!

69.! Li!Z,!Van!Calcar!S,!Qu!C,!Cavenee!WK,!Zhang!MQ,!Ren!B:!A'global'transcriptional' regulatory' role' for' cAMyc' in' Burkitt's' lymphoma' cells.!Proceedings' of' the' National'Academy'of'Sciences'of'the'United'States'of'America'2003,!100(14):8164Q 8169.!

70.! Wang! JQ,! Kobayashi! T,! Floc'h! N,! Kinkade! CW,! Aytes! A,! Dankort! D,! Lefebvre! C,!

Mitrofanova!A,!Cardiff!RD,!McMahon!M'et'al:!BARaf'Activation'Cooperates'with' PTEN' Loss' to' Drive' cAMyc' Expression' in' Advanced' Prostate' Cancer.!Cancer' research'2012,!72(18):4765Q4776.!

71.! Ju!X,!Ertel!A,!Casimiro!MC,!Yu!Z,!Meng!H,!McCue!PA,!Walters!R,!Fortina!P,!Lisanti!

MP,!Pestell!RG:!Novel'oncogeneAinduced'metastatic'prostate'cancer'cell'lines' define'human'prostate'cancer'progression'signatures.!Cancer'research'2013,!

73(2):978Q989.!

Manuscript II

72.! Emadi! Baygi! M,! Soheili! ZS,! Essmann! F,! Deezagi! A,! Engers! R,! Goering! W,! Schulz!

WA:!Slug/SNAI2'regulates'cell'proliferation'and'invasiveness'of'metastatic' prostate' cancer' cell' lines.!Tumour' biology' :' the' journal' of' the' International' Society'for'Oncodevelopmental'Biology'and'Medicine'2010,!31(4):297Q307.!

73.! Emadi!Baygi!M,!Soheili!ZS,!Schmitz!I,!Sameie!S,!Schulz!WA:!Snail' regulates' cell' survival' and' inhibits' cellular' senescence' in' human' metastatic' prostate' cancer'cell'lines.!Cell'biology'and'toxicology'2010,!26(6):553Q567.!

74.! Cheng!I,!Plummer!SJ,!NeslundQDudas!C,!Klein!EA,!Casey!G,!Rybicki!BA,!Witte!JS:!

Prostate' cancer' susceptibility' variants' confer' increased' risk' of' disease' progression.!Cancer'epidemiology,'biomarkers'&'prevention':'a'publication'of'the' American'Association'for'Cancer'Research,'cosponsored'by'the'American'Society'of' Preventive'Oncology'2010,!19(9):2124Q2132.!

75.! Golbert!DC,!CorreaQdeQSantana!E,!RibeiroQAlves!M,!de!Vasconcelos!AT,!Savino!W:!

ITGA6' gene' silencing' by' RNA' interference' modulates' the' expression' of' a' large' number' of' cell' migrationArelated' genes' in' human' thymic' epithelial' cells.!BMC'Genomics'2013,!14'Suppl'6:S3.!

76.! Winkler! S,! Murua! Escobar! H,! Eberle! N,! ReimannQBerg! N,! Nolte! I,! Bullerdiek! J:!

Establishment'of'a'cell'line'derived'from'a'canine'prostate'carcinoma'with' a'highly'rearranged'karyotype.!J'Hered'2005,!96(7):782Q785.!

General discussion

5. General discussion

The therapeutic challenges of castration-resistant, advanced prostate cancer in man have attracted attention to new concepts in cancer biology and treatment. There are mainly two strategies that have come into focus: one is the idea to identify cancer stem cells as the tumor fraction which is responsible for self-renewal and metastasis, and the second is drug therapy tailored to the individual properties of these cells (Clarke et al. 2006). The existence of cancer stem cells in a variety of different cancers, and also in prostate cancer has been proven for human tumors (Clarke et al. 2006, Liu et al. 2011, Visvader et al. 2012), whereas for canine specimens definitive proof is still lacking.

As pointed out by the “Human Cancers Consortium Prostate Pathology Committee” (Ittmann et al. 2013), despite the obvious differences in clinical presentation and course of the disease, it is of high interest to more precisely define the dog as a naturally occurring prostate carcinoma model, especially in terms of its similarity with the treatment-resistant metastatic, androgen-deprivation resistant tumor in man (Leroy and Northrup 2009).

Also, translating knowledge gained from model studies on canine patients helping humans can potentially benefit pet dogs themselves (Paoloni and Khanna 2008, Khanna et al. 2009).

Studies on cell lines established from canine cancers are considerably rare (Winkler et al.

2006, Blacking et al. 2012, Moulay et al. 2013), and those reporting the identification of cancer stem cells are even more sparse. Nemoto et al. (2011) successfully demonstrated the existence of cells fulfilling the criteria postulated for tumor-initiating cells in a cell line derived from a lung adenocarcinoma of a 10-year old dog.

As more and more studies are being published, it seems that results are sometimes confusing, and even contradictory results on the features of the putative cancer stem cells are reported (Clarke e al. 2006). There are some explanations for this: not only are the features of stem cells different between tumor entities, but they may also vary within the same tumor type, and even in an individual tumor sample (Lapidot et al. 1994, Turhan et al. 1995, Vermeulen et al.

2008).

Also, Stewart et al. (2011) showed substantial differences between the immunophenotype of tumor-initiating cells from the original tumor specimen compared to their corresponding xenografts.

General discussion

This has led to the conviction that speaking of CSC, it is highly important to sufficiently characterize the cell fraction or fractions that are intended for anticancer drug therapy (Gupta et al. 2009), as not only the genetic make-up of a cell, but also the interactions in terms of macro- and microenvironment will finally decide on the individual fate of this cell (Vermeulen et al. 2008).

In the present study therefore, in order to precisely describe the cells analyzed, a bunch of traits was investigated. For the human prostate-derived cell lines HPET and LAPC9, CD34, CD44 and CD133 have been shown to be regularly expressed, as well as the molecular markers C-KIT, ITGA6, OCT4, DDX5, MELK, NANOG, KLF4, and SOX-2, and thus this profile was analyzed.

Several authors have emphasized the need for combining identification of stem cells through detection of surface epitopes with functional studies, such as describing genetic patterns and functional properties (Vermeulen et al. 2008, Visvader and Lindeman 2012).

The altogether five cell lines derived from canine prostate tissues were cultivated from a prostate adenocarcinoma specimen (CT1258), two derivatives of this parental line either transfected with an expression vector encoding for EGFP or EGFP-HMGA2, as well as the cell line DT08/40 from a transitional cell carcinoma of the prostate and cell line DT08/46 from a prostate cyst.

It is likely that expression of surface markers as well as the molecular profile should be different among these cell lines, and this indeed showed to be the case.

CD34, which – besides being a marker of hematopoietic progenitor cells – is widely expressed by endothelial cells (reviewed by Stuart 2013, http://

www.pathologyoutlines.com/topic/cdmarkerscd34.html), was undetectable in the prostate carcinoma cell line CT1258, in the CT08/46 cell line established from a prostate cyst, and at a low expression levels in the other three cell lines examined. Trojan et al. (2004) in their immunohistochemical study of human benign and cancerous prostate specimens demonstrated a high correlation between microvessel density and CD34 expression in malignant, but not in benign prostate tissues.

Weak positivity for CD34 in the analyzed cell lines may thus be a hint to stromal lineage of at least part of the analyzed cells, might be indicative of lineage heterogeneity among the cultured cells (Lawson et al. 2006) and has also been described by Prajapiti et al. (2014) in

General discussion

16.5 % of the cells isolated for cultivation from benign prostate hyperplasia. CD34 however was not specifically described in identified prostate stem cells.

CD44 by comparison was detected by various authors reporting the isolation of stem cells from either murine or human prostate specimens representing benign as well as malignant tissues (Leong et al. 2008, Prajapati et al. 2014). It is however also expressed by normal prostatic epithelium (Liu et al. 1997, Miki and Rhim 2008) and strong indication of basal epithelial cells (Liu et al. 1997). Consequently, there is good reason to believe that the cell lines investigated in the present study were derived from basal epithelial cells from the canine prostate, which has also been postulated by Lai (2009).

In immunodetection of the CD133/prominin antigen, it is crucial to accurately define which epitope is targeted, since different clones recognizing various epitopes have been described (Florek et al. 2005, Irollo and Pirozzi 2013). This phenomenon has been attributed to

“possibly differentially folded CD133 as a consequence of differential glycolysation which in turn may mask specific epitopes” (Kemper et al. 2010). However, the antibody used in the present study, which is in fact directed against the glycosylated epitope AC133, has been confirmed in several studies as a reliable marker of stemness, especially when interpreted on the background of other features, such as ability to form spheroids and expression of typical

Im Dokument Expression of stem cell marker genes in canine prostate cancer cell lines as basis for the development of molecular therapeutic tools (Seite 39-65)