3 Material and Methods
3.1.2 Enzymes and antibiotics
enzymes source
restriction endonucleases New England Biolabs
T4-DNA-ligase New England Biolabs
Taq-High-Fidelity-DNA-Polymerase Invitrogen
Klenow-polymerase New England Biolabs
Antarctic Phosphatase New England Biolabs
antibiotics source
ampicillin Roche
penicillin Biochrom AG
streptomycin Biochrom AG
3.1.3 Kits
kits source
QIAprep Spin Miniprep Kit Qiagen
EndoFree Plasmid Maxi Kit Qiagen
DNeasy Blood and Tissue Kit Qiagen
QIAquick Gel Extraction Kit Qiagen
QIAquick PCR Purification Kit Qiagen
Monocyte Isolation Kit II, human Mitenyi Biotech QuikChange Site-Directed Mutagenesis Kit Stratagene
BURSTTEST (PHAGOBURST) ORPEGEN Pharma
Cytofix/Cytoperm Fixation/Permeabilization
Solution Kit BD Biosciences
20
3.1.4 Plasmids
name characterization source
expression plasmids
pVpxPBj Expression plasmid of unmodified Vpx of SIVsmmPBj
Nina Wolfrum, Paul-Ehrlich-Institut pVpxHIV-2 Expression plasmid of unmodified Vpx of HIV-2 this thesis
pVpxMAC Expression plasmid of unmodified Vpx of SIVmac this thesis
pVpxHIV-2-nFLAG Expression plasmid of unmodified Vpx of
SIVsmmPBj carrying a n-terminal FLAG-tag this thesis pHA-VpxPBjsyn Expression plasmid of codonoptimized Vpx of
SIVsmmPBj carrying a n-terminal HA-tag
André Berger, Paul-Ehrlich-Institut pVpxPBjsyn
(9.1) Expression plasmid of codonoptimized Vpx of
SIVsmmPBj this thesis
pVpxHIV-2syn Expression plasmid of codonoptimized Vpx of HIV-2
Andre Berger, Paul-Ehrlich-Institut pcDNA3.1(+)
Commercially available backbone for expression plasmids, contains a MCS downstream a CMV promoter, ampicillin resistance
Invitrogen
pMD.G2 (9.2) VSV-G expression plasmid D. Trono, Tronolab,
Switzerland
two-plasmid vector systems
pPBj-ΔEeGFP
Genome of SIVsmmPBj1.9 containing a 1 kb deletion in the env gene. Expresses eGFP under the control of a CMV promoter.
(Mühlebach et al., 2005)
pPBj-4xKOeGFP
Genome of SIVsmmPBj1.9 containing a 1 kb deletion in the env gene and point mutations in the start-ATGs of vif, vpx, vpr, and nef. Expresses eGFP under the control of a CMV promoter.
Julia Kaiser, Paul-Ehrlich-Institut
pHIV-1-NL4-3
Genome of HIV-1 (NL4-3) containing a 1.2 kb deletion in the env gene. Expresses eGFP under the control of a CMV promoter.
(Mühlebach et al., 2005)
pHIV-2-RodA
Genome of HIV-2 (Rod A) containing deletion in the env gene. The eGFP is inframe within the nef gene and therefore expressed under control of the viral LTR.
(9.4) SIVsmmPBj packaging plasmid Nina Wolfrum
(Wolfrum 2005 pHIV-2d4
(9.5) HIV-2 packaging plasmid Carsten Münk,
Paul-Ehrlich-Institut
21
SIVsmmPBj-derived transfer vectors
pPBj-trans
SIVsmmPBj-derived transfer vector encoding eGFP under control of the CMV promoter,
contains second exons of tat and rev, deficient for CTS-element
(Wolfrum, 2005)
pPBj-trans-SIN Based on pPBj-trans, the second exons of tat and
rev are deleted, SIN-configuration this thesis pPBj-trans-cSIN Based on pPBj-trans-SIN, 1 kb pol-deletion and
reintroduced cPPT/CTS-element this thesis pPBj-SEW-SIN Based on pPBj-trans-SIN encoding eGFP under
control of the SFFV promoter, contains WPRE (Högner, 2007), diploma thesis pPBj-SEW-cSIN
Based on pPBj-trans-cSIN and pPBj-SEW-SIN, encoding eGFP under control of the SFFV promoter, contains WPRE, SIN-configuration
this thesis
pPBj-SR-SEW-cSIN (9.6)
Based on pPBj-SEW-cSIN, SV40/RSV-element
replaces U3 in 5'LTR this thesis
pPBj-MCS (9.7)
SIVsmmPBj-derived transfer vector with MCS
derived by Fusion-PCR this thesis
pPBj-SEW Based on pPBj-MCS. encoding eGFP under
control of the SFFV promoter, contains WPRE this thesis pPBj-g'-SEW Based on pPBj-SEW, integrated stop-codon 10
triplets downstream the gag start-ATG this thesis pPBj-SR-SEW Based on pPBj-SEW, SV40/RSV-element
replaces U3 in 5'LTR this thesis
pHIV-2-SEW Based on pHIV-2-MCS encoding eGFP under
control of the SFFV promoter, contains WPRE this thesis pHIV-2-g'-SEW Based on pHIV-2-SEW, integrated stop-codon 11
triplets downstream the gag start-ATG this thesis
pHIV-2-SR-SEW Based on pHIV-2-SEW, SV40/RSV-element
replaces U3 in 5'LTR this thesis
control of the SFFV promoter, contains WPRE this thesis
22
HIV-1-derived transfer vectors
pHR-CMV-GFP
Genome of HIV-1 containing a deletion in the env gene, encoding eGFP under control of the CMV promoter
HIV-1 transfer-vector encoding gp91phox under control of the CMV promoter, contains WPRE, SIN-configuration control of the SFFV promoter, contains WPRE, SIN-configuration control of the SFFV promoter, contains WPRE, SIN-configuration control of the SFFV promoter, contains WPRE, SIN-configuration, SV40/RSV-element replaces
All oligonucleotides were synthesized from the company Eurofins MWG Operon.
name 5'→ 3' sequence
restriction site
BPK 1 tgagaattctaggtagtaagcgatgtcagatcccag EcoRI
BPK 2 atcctcgagctattatgctagtcctggagggggagg XhoI
BPK 3 tgagaattctagagtgcaacaaaatgacagac EcoRI
BPK 4 atcctcgagctattagaccagacctggagggggag XhoI
BPK 5 ggtggaattcgagccatgagcgaccccagagagagaatc EcoRI
BPK 6 tcactcgagtcattaggccagtccaggagggggag XhoI
BPK 7 tcaagcttcgaattctgcagtcga EcoRI
BPK 8 gtaggtaggctatctgaactctgctttacttgtacagctcgt BPK 9 acgagctgtacaagtaaagcagagttcagatagcctacctac
BPK 10 tgactgaatacagagcgaaatgttttatgtcttctatcactg BPK 11 cagtgatagaagacataaaacatttcgctctgtattcagtca
BPK 12 ggtggcggccgctctagaactagggcgactaggagagat NotI
BPK 13 gcaggttggcgcccgaacag KasI
BPK 14 aactgccattagtactatagtccaaatctgtccaattcattt BPK 15 aaatgaattggacagatttggactatagtactaatggcagtt
BPK 16
aaggcaattggagtaatctctactaatttgtaatctcccaactccaatcgttccacagct
ggtctctgcc MfeI
BPK 17 tgaggcgcctgaactagtgaaggcctgaaataacctctgaaag KasI, SpeI BPK 18 tgccagcctctccgcagagtgagtttattgtatcgagctaggca
BPK 19 tgcctagctcgatacaataaactcactctgcggagaggctggca
BPK 20 tcttccctgacaagacggagttt
23 ttttaaaattctcatcatggagctaaaactgaaagaa BPK 23 gtcaatatgatcaccacagaacaagaaatacaattccaacaatcaaaaaattcaaa
atttaaaaattttcgggtctgattggagttgggagattacaa BPK 24
taataaatcccttccagtccccccttttcttttataaaatgatcaaccggtggatcctgca
gaattctcatttggccatggtacagtagt
BPK 25 gggactggaagggatttattacagtgatagaagacataaaatgacatttcgctctgtat tcagt
BPK 26 ggtggcggccgctctagaac NotI
BPK 27 ttgatatcgaattcctgcag EcoRI
BPK 28 tcagaattctcatcgacggtatcgatcaggcg EcoRI
BPK 29 gcgagaaactccgtcttgtgagggaagaaagcag
BPK 30 ctgctttcttccctcacaagacggagtttctcgc
BPK 31 tgactcgaggtccgtggcctgaaataacctct XhoI
BPK 32 tgccagcctctccgcagagtgagtttattgtatcgagctaggca BPK 33 tgcctagctcgatacaataaactcactctgcggagaggctggca
BPK 34 gctctcactctccttcaagt KasI
BPK 35 tgaaagcttgtcgactgagaggatgtattacagtgagagaa HindIII, SalI BPK 36
gttctgtggtgatcatattgattaatctttctgatggagtcatatcccctattcccccccttctt ttaaaattcatgctcatcataccattggatctaaaactgtaagaa BPK 37 caatatgatcaccacagaacaagagatacaattcctccaagccaaaaattcaaaat
taaaaaattttcgggtctatttcagagtgagtgtgttcgtgctagggttc BPK 38
aaacatcccttccagtcccccccttgtttttattaaatgttcactcgaggtaccggtcaatt
gctagcccctcccagtcaggtgctaagga
BPK 39 ggggactggaagggatgttttacagtgaaagaagacataaaatcttcggtcgctctg
BPK 44 ttctaattcatctgctttttaccctctcaagacggagtttc
BPK 45 ttgctcacatgttctttcct PciI
BPK 46 ttcagaggttatttcaggccctctcagtcgacaagcttat BPK 47 ataagcttgtcgactgagagggcctgaaataacctctgaa
BPK 48 cctagctcgatacaataaactcgctctgcggagaggctgg BPK 49 ccagcctctccgcagagcgagtttattgtatcgagctagg
BPK 50 ctgttcaggcgccaacctgc KasI
BPK 51 tgacaattgtgagggaatgaaagaccccacct MfeI
BPK 52 tcaaccggttcaaattcgacaacaccacggaa AgeI
24