Construct design and Western Blot analysis

In a first attempt to investigate the function of G-quadruplexes in bacterial ORFs in vivo we designed plasmid constructs (see Table 13.8 in the appendices, constructs 76-91) containing variants of the Salmonella kdpD and kefC genes (listed in Table 3.3) and expressed them in E. coli cells (cloning procedures are described in Chapter 7.14).

Table 3.3: Quadruplex sequences and mutants used in different constructs.

Quadruplex sequences and designed mutants cloned with the respective gene into plasmid constructs and investigated via Western blotting. The quadruplex sequence (or mutant) is shown in the second column.

Underlined Gs and Cs might participate in quadruplex formation. The column “Origin” describes the organism and the gene in which the quadruplex occurs in nature. The structure potentially adopted by the sequence is listed.

Name Quadruplex sequence (5'-3') within ORF Origin Potential

structure kdpD GGCGTGGGGCTGGGGCTGGCG Salmonella enterica subsp. enterica

serovar Typhimurium str. LT2 kdpD G4 with C in tetrad or G3 with bulges

kdpD M1 GGCGTTGGCCTCGGCCTCGCC Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 kdpD mutated

no quadruplex or G2 with C in tetrad

kdpD E. coli GGGGTAGGGCTTGGACTGGCA Escherichia coli MG1655 kdpD G2 kdpD M2 GGGGTGGGGCTGGGGCTGGCG Salmonella enterica subsp. enterica

serovar Typhimurium str. LT2 kdpD mutated

G4

kdpD Gal GGCGTGGGGCTGGGGCTGGAAATGGG

GCTGGGGCTGGCG Salmonella enterica subsp. Enterica serovar Gallinarium/pullorum str.

RKS5078 kdpD

G4

kdpD Gal M1 GGCGTAGGACTAGGACTGGAAATGGGA

CTAGGACTGGCG Salmonella enterica subsp. Enterica serovar Gallinarium/pullorum str.

RKS5078 kdpD mutated

G2

kefC GCGCTGGGGCTGGGGCTGGGGCTGGG

GCGTTATGAA Salmonella enterica subsp. Enterica serovar Gallinarium/pullorum str.

RKS5078 kefC

G4CT

kefC M1 GCGCTAGGACTAGGACTAGGACTAGGA

CGTTATGAA Salmonella enterica subsp. Enterica serovar Gallinarium/pullorum str.

RKS5078 kefC mutated

G2

EutE GCCGGGCTGGGGCTGGGCGGGGAA Escherichia coli MG1655 eutE G3 EutE M1 GCCGGACTAGGACTAGGCGGAGAA Escherichia coli MG1655 eutE mutated G2

According to studies performed in eukaryotic cells (see Chapter 1.2.1) we expected G-quadruplexes occurring within bacterial genes to induce ribosomal halt or frameshifting which would result in reduced gene expression or the production of a truncated protein. In our analysis whole sequences of quadruplex-carrying genes were cloned into the pBAD-18 plasmid under control of the arabinose-inducible araBAD promoter (for kdpD constructs

51

sequences of the kdpD/E operon were inserted into the vector). The protein of interest was 5’

His tagged with a penta-His-linker, which enabled the detection on a Western blot by immunostaining with an anti-His-Antibody. To better assign the effect to G-quadruplex formation we designed different mutants, where the G-quadruplex sequence was mutated in a way that should allow no quadruplex formation or the formation of a less stable G-quadruplex (see Table 3.3; kdpD M1, kdpD Gal M1, kefC M1). However, we made sure that the amino acid sequence of the protein remained similar. Furthermore we created a construct containing the G-quadruplex within the eutE gene of E. coli MG1655 (see Table 3.1 No. 23) as this quadruplex was reported to produce a truncated protein product in a synchronized in vitro translation assay and to reduce fluorescence levels in a reporter system in mammalian cells (159). To ensure that there are no promoter-specific interactions, we additionally cloned the kdpD constructs under the control of the natural Salmonella promoter (kdpD (S)). For Western Blot analysis, bacteria were inoculated (1:500) from an outgrown culture in either LB or M9 medium supplemented with 1 mM arabinose. Cells were grown to exponential (OD600 = 0.3-0.6) or stationary phase (overnight) before proteins were isolated via sonification and separated with a denaturing SDS PAGE prior to blotting (see Chapters 7.11.4.1 and 7.17). In a first trial, we wanted to find out if there were differences between the expression levels and products of constructs under control of the different promoters:

araBAD and the natural Salmonella promoter. To confirm adequate blotting, we applied the KlenTaq protein (size: 62.8 kDa) as a control. For both kinds of constructs we observed the expression of the correct protein (kdpD with His-Tag: 100.34 kDa) – however, higher expression levels were reached under control of the pBAD promoter (see Figure 3.13 A).

Thus, all subsequent experiments were carried out with constructs under control of the araBAD promoter. Next, we investigated whether the correct products are achieved from the kdpD Gal, kefC and eutE constructs (see Figure 3.13 B). Although we observed a protein with the correct length for the kdpD Gal construct, no obvious change in protein expression level or protein size was observed in comparison to its mutant (which should form a less stable G-quadruplex structure). In addition, the KefC protein (68.23 kDa) was not expressed in our constructs according to the blot, the product of the eutE construct only yielded a faint band on the blot, and no truncated protein was visible. Next, we investigated the expression of the different kdpD mutants in both exponential and stationary phase as well as in LB (see Figure 3.13 C&D) and M9 (see Figure 3.13 E&F) media.

52

Figure 3.13: Western Blot analysis of kdpD constructs.

A Comparison of kdpD expression of constructs under control of the araBAD (kdpD) and Salmonella (kdpD (S)) promoters.

pBAD refers to the empty vector without kdpD gene and KlenTaq refers to the KlenTaq protein used as transfer control.

53

B Protein expression of kdpD Gal, kefC and eutE constructs. C, D Protein levels of different kdpD constructs from cells grown in LB medium to C stationary phase and D exponential phase. The lower blot shows rpoB expression levels of the corresponding products. E, F Protein levels of kdpD constructs from cells grown in M9 medium to E stationary phase and F exponential phase.

The lower blot shows rpoB expression levels of the corresponding products. G, H, I Blot evaluation by comparing the intensity of the kdpD detection to the intensity of the corresponding rpoB detection. J, K Protein expression of different kdpD constructs in comparison to the expression of a truncated protein, produced by introduction of a stop codon in front of the potential G-quadruplex sequence within the kdpD gene (kdpD short). The lower blot shows rpoB expression levels of the corresponding products. For all blots, pBAD dedicates expression level of the empty plasmid.

To quantify the band intensity and prove equal loading, we immuno-stained the blot after a stripping procedure (see Chapter 7.18) with an anti-RpoB-antibody (rpoB encodes for the β subunit of the RNA polymerase and is a stably expressed housekeeping gene). However, results were inconclusive. When bacteria were grown in LB medium, the KdpD protein was only expressed, if the culture was incubated overnight and the proteins were isolated from stationary phase cells (see Figure 3.13 C). An evaluation of the band intensity (see Figure 3.13 G), revealing KdpD expression relative to the RpoB expression showed highest expression level for the construct bearing the natural kdpD gene. Interestingly, expression levels for all KdpD mutants bearing less stable G-quadruplexes (kdpD M1, kdpD E. coli) were lower compared to the natural gene. However, even the expression levels of the mutant – which should form a more stable G-quadruplex (kdpD M2) – and for those of the kdpD Gal construct were lower compared to the natural gene. When grown in M9 media cells with all kdpD constructs showed protein expression in stationary as well as exponential phase (see Figure 3.13 E&F). Whereas in stationary phase all constructs had almost equal expression levels of KdpD, in exponential phase the constructs with the most stable G-quadruplexes showed the highest protein expression (kdpD, kdpD M2, kdpD Gal) when evaluated relative to RpoB expression (see Figure 3.13 H&I). Enhanced protein expression might also result from G-quadruplex formation: The formed G-quadruplex might induce translational halt which could facilitate complex protein folding and thereby contribute to the formation of a stable protein. On the blot we observed very thick bands for the kdpD and the kdpD Gal constructs (see Figure 3.13 F), which raised the question whether these bands include a second, lower band that is not properly separated and could result from a truncated protein. Thus, we designed a control construct bearing a stop codon 4 nt in front of the G-quadruplex sequence in the kdpD gene (kdpD short). Figure 3.13 J and K show two biological replicates analyzed on two blots. The band of the truncated protein can be clearly distinguished from the kdpD bands, and therefore the production of a truncated protein could be excluded. However, a comparison of the two blots (see Figure 3.13 J&K) showed that expression levels differ a lot between different experiments. Thus, the results are ambiguous and no conclusions could be drawn. Further experiments should be performed in order to determine the ability of these potential G-quadruplexes to interfere with translation.

54