Another approach to examine the activity of Arabidopsis AAEs was performed by a complementation experiment. The strain of Synechocystis sp. PCC 6803 devoid of AAS activity was complemented with either of both Arabidopsis genes and tested by feeding with radiolabeled fatty acids for reestablishment of the wild type phenotype. The Arabidopsis genes were introduced into the genome of the Synechocystis sp. PCC 6803 aas knockout mutant via homologous recombination. A schematic representation of the process is shown in figure 15. The constructs for complementation were composed of the promoter sequence from the kanamycin resistance gene, the entire ORF of AAE15 or the sequence of AAE16 devoid of the plastidial targeting signal, the terminator sequence of aas from Synechocystis sp. PCC 6803, and the selection marker. The whole assembly was flanked by fragments of the kanamycin cassette as borders for the retransformation. Arrows on the scheme indicate primer pairs which were used for PCR analysis of the obtained clones.
After transformation the cells were maintained on selective media for several weeks and then genomic DNA from several clones were tested by PCR reaction for the presence of
the Arabidopsis gene. The presence of the complementation cassette in the transformed strain was confirmed by PCR employing isolated genomic DNA as template (figure 15 B).
In the first reaction (PCR I) primers specific to AAE of Arabidopsis were used (primer 1 and primer 2). In the second reaction (PCR II) primers specific to Synechocystis sp. PCC 6803 sequences, flanking the region of recombination, were used (primer 3 and primer 4).
The second reaction proved also the absence of native aas of Synechocystis sp. PCC 6803.
To exclude the possibility that PCR products were resulting from unspecific primer hybridization to the sequence of genomic DNA in a host strain, for each primer pair the control reaction utilizing genomic DNA of Synechocystis sp. PCC 6803 as template was performed.
Primers sequences and PCR results predicted for various templates DNA are presented below.
PCR I
Primers specific for AAE15
Primer 1 CATCGATTCAGATGATACAGCT (AtFAA1sf771)
Primer 2 ACATGCGGCCGCACTGTAGAGTTGATCAATCTC (AtFAA1NotrHis) Primers specific for AAE16
Primer 1 GCCATCATGGCATGCTTATG (AtFAA2sf933)
Primer 2 CCTCGAGTGCGGCCGCCTACTTGTAGAGTCTTTCTA (FAA2StopNotr)
Template Product Synechocystis sp. PCC6803 wild type No
Synechocystis sp. PCC6803 aas knockout
No AAE 15 complementation 1362 bps AAE 16 complementation 1253 bps
PCR II
Primer 3 CATTGACCTGAAACTAATCATCC (SYN6) Primer 4 CACAGCCGGGGCACACCGACAATG (SYN2)
Template Product Synechocystis sp. PCC6803 wild type 420 bps
Synechocystis sp. PCC6803 aas knockout
1490 bps AAE 15 complementation 4965 bps AAE 16 complementation 4820 bps
Kan cassette
Figure 15. Complementation of Synechocystis sp. PCC 6803 aas knockout with AAEs from Arabidopsis. (A) General scheme of homologous recombination. Kan1, Kan2 – border regions of kanamycin resistance cassette; p – promoter sequence of kanamycin resistance gene; AAE – gene introduced (either AAE15 or AAE16); t – terminator sequence of aas from Synechocystis sp. PCC 6803; Camp – chloramphenicol resistance cassette. (B) Complementation of Synechocystis sp. PCC 6803 aas knockout with AAE from Arabidopsis was confirmed by PCR analysis (AAE15 - left image and AAE16 - right image). Genomic DNA of the Synechocystis sp. PCC 6803 wild type (lanes 1 and 4) or aas mutant complemented with Arabidopsis AAE (lanes 2, 3, 5 and 6; DNA of two independent clones was tested) was used as a template for the PCR with primers 1 and 2 (lanes 1, 2 and 3) or primers 3 and 4 (lines 4, 5 and 6).The sizes of the obtain products are given to the right in bps.
Based on PCR results, clones, in which all copies of knockout cassette were replaced by the complementation cassette, were selected for feeding experiment. Cultures of strains complemented with either of both Arabidopsis AAE genes were grown in media supplemented with labeled fatty acids. Cultures of Synechocystis sp. PCC 6803 wild type
and of the aas knockout mutant, which had already been tested in this kind of experiment (3.2), served as a positive and a negative control. Six fatty acids different with respect to the length of carbon chain and the level of desaturation were utilized as substrates. Figure 16 presents TLC separation of total lipid extracts prepared from the cells fed with labeled fatty acids. The results clearly showed that complementation with either of both AAEs from Arabidopsis restored the wild phenotype of Synechocystis sp. PCC 6803. The label appeared in different lipid classes indicating that exogenous added fatty acids were activated and further metabolized in cells. Special attention should be paid to the ratio of the intensity of spots representing the accumulated free fatty acids to the intensity of the spots representing lipids. This factor allowed the comparison of the substrate specificity of the native Synechocystis sp. PCC 6803 AAS and the expressed proteins of Arabidopsis as well as substrate specificity of an individual enzyme towards different fatty acids. The lower this ratio is the more fatty acids were incorporated into lipids. The relative values of fatty acid and lipid band intensities are summarized in table 2. For the calculations MGDG was taken as representative for all lipid classes. MGDG is a major constituent of cyanobacterial membranes and was represented by an easily distinguishable spot on TLC plates.
It is worth being noted that the fatty acids substrate specificity of AAE15 for medium chain length determined by in vitro activity assays was confirmed by the feeding experiment presented here. MGDG bands of relative high intensity were detected when the cultures were fed with either C 12:0 or C 14:0. In contrast, there was no MGDG band visible when C 18:0 was used as a substrate for feeding, and only weak bands visible when other long chain fatty acids were employed. These results are also in perfect accordance to results of the in vitro measurements.
A separate remark should be made about Arabidopsis AAE16. Whereas the enzyme was not active in in-vitro activity assays, it showed acyl-ACP synthetase activity with a broad range of substrates in the complementation experiment. All fatty acids tested were activated and incorporated into lipids in Synechocystis sp. PCC 6803 aas knockout strain complemented with AAE16.
12:0 wt ko AAE15 AAE16
Figure 16. Autoradiography of total lipid extracts isolated from Synechocystis sp. PCC 6803 aas knockout mutant complemented by Arabidopsis AAEs after feeding with radio labeled fatty acids. Cells of Synechocystis sp. PCC 6803 wild type (wt), aas knockout (ko) and knockout complemented with either of AAE gene from Arabidopsis (AAE15, AAE16) were grown in presence of [1-14C] labeled fatty acid (12:0 - lauric, 14:0 - myristic, 16:0 – palmitic, 18:0 – stearic, 18:1 – oleic, 18:3 – linolenic). Lipid extracts of harvested cells were separated by TLC. FFA-free fatty acids, MGDG - monogalactosyl diacylglycerol.
Table 2. Distribution of imported fatty acids between the pools of free- and lipid-bound fatty acids. Amounts of 14C labeled fatty acids in intracellular free fatty acids (FFA) pool and incorporated to monogalactosyl diacylglycerol (MGDG) are expressed as intensities of spots detected on TLC plates. For each strain the ratio of FFA to MGDG was calculated. WT - Synechocystis sp. PCC 6803 wild type; ko - Synechocystis sp. PCC 6803 aas knockout mutant; AAE15, AAE16 - Synechocystis sp. PCC 6803 aas knockout mutant complemented by either of both genes.
C 12:0 C 14:0 C 16:0
intensity FFA/MGDG intensity FFA/MGDG intensity FFA/MGDG
WT
intensity FFA/MGDG intensity FFA/MGDG intensity FFA/MGDG
WT