Commercial kits

CytoSelect Phagocytosis Assay kit Cell Biolabs, San Diego, California, USA

Via‐Light Plus kit LONZA, Nottingham, Ireland

TACS TdT kit TREVIGEN, Gaithersburg, USA

2.1.7 Software

Software Company/ Origin

Light Cycler 480 release 1.50. SP4 Roche, Basel, Schweiz

Tool Lab TL100 Sigma‐Aldrich, Saint Louis, Missouri, USA

Image J NIH, Bethesda, Maryland, USA

Apoptosis Olymbus Italia, Segrate, Italy

Nano drop Thermo Fisher Scientific, Waltham, Massachusetts,

29

USA

Phagocytosis Cell Biolabs, San Diego, California, USA

Power point 2010 Microsoft , Redmond, Washington, USA

Endnote X7 Thomson Reuters Scientific, Philadelphia, USA

Graph Pad Prism 6 Graph Pad Software, La Jolla, California, USA

Microsoft Office 2010 Microsoft, Redmond, Washington, USA

Photoshop 8 Microsoft, Redmond, Washington, USA

2.2 Methods

2.2.1 Blood Specimen ‐ Collection and Storage

A total of 20 venous blood samples were collected in different commercially available monovette tubes (Sarstedt, Germany) containing either ethylene‐diamine‐tetra‐acetic‐acid (EDTA), lithium‐heparin (heparin), or sodium citrate, from donors (female: 9, male: 11; mean age ± SD = 30 ± 9 years) who presented at the Department of Clinical Chemistry at Hannover Medical School between August 2013 to August 2014. Blood samples were incubated on a rolling plat form for 30 min at RT, then centrifuged at 1900 × g for 10 min, and after removal of the supernatant, serum and plasma samples were aliquoted and immediately used or stored at− 80 °C until assay.

Medical Ethics in the research study was considered under an informed consent that was given by all blood donors before inclusion. The blood collection was performed by Bernadette Lüns.

30

2.2.2 Cell Culture 2.2.2.1 Cell lines

To analyze the influence of different anticoagulants on MMP‐9 expression, 3 different cell lines were used: THP‐1 cells (which are derived from a patient suffering from acute monocytic leukemia), Jurkat cells (an immortalized line of human T‐lymphocytes), and HT cells (purified B‐

cell lymphoma cells; all from DMSZ, Germany). All cells were cultured in the RPMI 1640 medium containing 300 mg/L L‐glutamine (PAA, Linz, Austria), supplemented with 10% fetal calf serum (FCS, Biochrom, Berlin, Germany), without antibiotics at 37°C in a humidified atmosphere containing 5% CO2. All THP‐1, Jurkat, and HT cells in single, double, and triple co‐cultures were stimulated by HMWH, LMWH, EDTA, and citrate in dose and time dependent experiments. Some of these experiments were performed by Bernadette Lüns.

2.2.2.1.1 Individual cultures

Individual cultures of monocytes (THP‐1), T‐cells (Jurkat), or B‐cells (HT) were incubated with HMWH, LMWH, EDTA, or citrate. 2 x 10⁶ cells / well (2 ml of medium in 6‐well plates) were cultivated (10% FCS) or starved (1% FCS) overnight and then stimulated up to 24h with 3.2 mg EDTA, 10 µl heparin (= 50 IU), or 220 µl citrate in a time dependent experiment.

Following stimulation, RNA was isolated and cDNA was synthesized according to manufacturer’s instructions (see 2.4.1, 2.4.3). Afterwards, the mRNA expression of MMP‐9 was analyzed (see 2.5.2). Supernatant of stimulated cells were stored for further analysis with ELISA (see 2.6.1) for MMP‐9 secretion or with the Proteome Profiler Human XL Cytokine/Chemokine Array for the detection of secreted mediators (see 2.7.1).

31

2.2.2.1.2 Stimulation of individual monocytes cultures with T‐cell‐derived supernatant

Furthermore, 2 x 10⁶monocytes / well (2 ml of medium in 6‐well plates) were stimulated with the supernatant of anticoagulant‐treated T‐ or B‐cells, i.e., THP‐1 were stimulated with the supernatant of HMWH‐ (50 IU), citrate‐ (220 µl), or EDTA‐ (3,2mg/well) treated Jurkat or HT cells (pre‐starvation phase: overnight, anticoagulant treatment duration: 24h). Starved monocytes (1% FCS overnight) were incubated for 0, 2, 4, 6, and 24h with the supernatant of anticoagulant‐stimulated cells and then treated as described previously (see 2.2.2.1.1).

2.2.2.1.3 Stimulation of individual monocyte cultures with the supernatant of T‐cells stimulated with derived human plasma derived from heparin monovettes

Moreover, 2 x 10⁶monocytes / well (2 ml of medium in 6‐well plates) were cultivated (10% FCS) or starved (1% FCS) overnight and then incubated with supernatant from T‐cells stimulated with human plasma derived from heparin containing monovettes (pre‐starvation phase: overnight, treatment with human heparin plasma: 24h). Starved monocytes (1% FCS overnight) were incubated for 0, 2, 4, 6, and 24h with the respective T‐cell supernatant and then treated as described previously (see 2.2.2.1.1).

2.2.2.1.4 Double co‐culture experiments

To assess the influence of the interaction of different cell types on MMP‐9 expression, double co‐culture experiments were performed by which monocytes or T‐cells (THP‐1 and Jurkat), monocyte and B‐cells (THP‐1 and HT cells), or T‐cells and B‐cells (Jurkat and HT cells) were incubated together. 1 x 10⁶ cells / well per cell line (= 2 x 10⁶ cells / well) were cultured in 2 ml medium in 6 well plates. Following starvation (1% FCS overnight), cells were stimulated with the

32

respective anticoagulant as described previously(see 2.2.2.1.1) incubated for 0, 2, 4, 6, and 24h and then treated as described before (see 2.2.2.1.1).

2.2.2.1.5 Triple co‐culture experiments

To further analyse the effects of interactions between different cells types, triple co‐culture experiments were performed, i.e., a mixture of all three cell lines (THP‐1, Jurkat, and HT cells) were performed (see 2.2.2.1.1). 7 x 10⁵ cells / well and per cell line (= 2.1 x 10⁶ cells / well) were starved overnight in 2 ml of medium (1% FCS) in 6‐well plates, then incubated with the corresponding anticoagulants for 0, 2, 4, 6, and 24h, and finally treated as described above (see 2.2.2.1.1).

2.3 Anticoagulants

2.3.1 High molecular weight heparin (HMWH), a highly sulfated glycosaminoglycan known to bind to the hemopexin domain of MMPs, is often found associated with MMPs on the cell surface. Due to its high negative charge density, HMWH prevents clotting and is widely used in blood sampling (117, 118). For individual, double, or triple co‐culture experiments, stimulation with 50 IU HMWH was performed.

2.3.2 Low molecular weight heparin (LMWH), a new class of anticoagulant derived from unfractionated heparin (UFH), has an advantage over HMWH by which it is easily distributed due to its low molecular weight. This has led to its increasing use for a number of thromboembolic indications. For individual or double co‐culture experiments, stimulation with 50 IU Clexane or Fragmin was performed.

33

2.3.3 Ethylene diamine tetra acetic acid (EDTA), a widely used anticoagulant due to its ability to

"sequester" metal ions such as Ca²⁺ and Fe³⁺. After being bound by EDTA, metal ions remain in solution but exhibit diminished reactivity. _In coagulation studies, EDTA has the role to inhibit the clotting process by removing calcium from the blood. Furthermore, it is also known to inhibit a range of metallopeptidases via the chelation of the metal ion required for catalytic activity (119).

For individual, double, or triple co‐culture experiments, stimulation with 3.2mg/ml EDTA was performed.

2.3.4 Citrate, a chelating agent, is used to chelate calcium ions and therefore inhibits coagulation (usually in the form of tri‐sodium citrate). For individual, double, or triple co‐culture experiments, stimulation with 220µl/well citrate was performed.

2.4 RNA isolation and cDNA synthesis 2.4.1 RNA isolation and purification

For RNA isolation and purification, cells were harvested as a cell pellet and an appropriate volume of Buffer RLT was added. Afterwards, 1 volume of 70% ethanol was added to the lysate and mixed well by pipetting. The sample was transferred to an RNeasy Mini spin column placed in a 2 ml collection tube and centrifuged for 15 s at ≥ 8000 x g. After discarding the flow, 700 μl Buffer RW1 were added to the RNeasy spin column and centrifuged. After discarding the flow, two times 500 μl Buffer RPE were added to the RNeasy spin column and centrifuged for 2 min.

Finally, RNA was eluted in 50 μl RNase‐free H²O and concentrations were determined using the Nano‐drop ND‐1000 photometer.

34

2.4.2 RNA Quantification Using Nano‐Drop ND ‐1000

To check the concentration and quality of RNA samples, 1 μl of each sample was analyzed using the Nano Drop ND‐1000 spectrophotometer according to the manufacturer's instructions. At a wavelength of 260 nm, optical density of the sample was determined (reference against dH2O or the respective buffer). To check the purity of the RNA, the ratio of the absorption values at 260 nm and 280 nm was determined. In all cases the value of A260 / A280 ranged from 1.8 to 2, indicating the purity of the isolated RNA.

2.4.3 cDNA synthesis

Total RNA (1 μg) was reverse transcribed using the Superscript™ II Reverse Transcriptase kit (Invitrogen, USA) as described in the manual, in which 2 μl of random primer and 2 μl of nucleotides were incubated for 5 min at 65 °C, then 10 min at 25 °C, 50 min at 42 °C, and 15 min at 70 °C. Finally 60 μl of t‐RNA were added to fill to a total volume of 100 μl. RNA isolation and cDNA synthesis were performed in part by Bernadette Lüns.

2.4.4 Agarose gel electrophoresis

For the separation of nucleic acid according to size, agarose gel electrophoresis was applied. For 1% or 2% agarose gels, 2g or 4g Agarose were dissolved in 200 ml 1 x TAE buffer and heated in a microwave for 4 minutes. The dissolved agarose was poured into the gel chamber and allowed to cool down for 15 minutes. Then samples were mixed with loading buffer containing bromophenol blue and ethidium bromide (ratio buffer to sample: 1:4) and loaded on the gel. 5 μl of 1 kb DNA ladder were used. Electrophoresis was carried out at a voltage of 100 V (30 minutes) and DNA bands were visualized on the transluminator with UV light (302 nm).

35

2.5 Detection of mRNA expression

2.5.1 Gradient polymerase chain reaction

Gradient PCR was applied to identify the optimum temperature of each primer pair. With the gradient PCR, a wide range of temperatures can be covered which facilitates the detection of the optimum annealing temperature for each specific PCR reaction.

The procedure was pipetted as, presented in Table 2.

Tab.2: PCR reaction pipetting procedure

Reagent 50 μl reaction 20 μl reaction Final Concentrations

volume volume

H2O Add to 50 Add to 20

10 x buffer 10 4 1x

10 mM dNTPs 1 0,4 200μM

Forward Primer 2.5 1 0,5 μM

Reverse Primer 2.5 1 0,5 μM

Template DNA 5 2 0,5 μM

(diluted 1:10)

GC‐Buffer 2.5 1 5 %

Fast Start DNA‐ 0,5 0,2 0,02U/μl

Polymerase

Most gradient PCRs were carried out using a mean annealing temperature of 65 °C, thus testing a range of 55 to 75 °C. This allowed the determination of the optimal amplification temperature.

For primer pairs with different calculated annealing temperature, the mean was temperature was adjusted accordingly.

36

2.5.2 Quantitative reverse transcription PCR (qRT‐PCR)

qRT‐PCR was performed using the Light Cycler® 480 system (Roche, Germany) in a 96 well format. The measurement was performed according to manufacturer’s instructions using the Light Cycler® 480 Probes master. The reaction mix contained 50% Light Cycler® 480 Probes Master, 5% DMSO, 25% cDNA, 10 pmol/μl of each primer, and 4 pmol/μl of both hybridization probes in a total volume of 20 μl. GAPDH was measured using the primers 5’‐

tgctgagtatgtcgtggagtc‐3’ and 5’‐ggatgcagggatgatgttct‐3’ as well as the hybridization probes 5’‐

Cy5‐ccatgccatcactgccacccagaagact‐3’ and 5’‐gacaactttggtatcgtggaaggactcatgaccaca‐3’‐FITC.

MMP‐9 was measured using the primers 5’‐tccagtaccgagagaaag‐3’and 5’‐

caggatgtcataggtcacgtag‐3’ as well as the hybridization probes 5’‐BHQ1‐ggagtgagttgaaccag‐3’‐6 FAM.

Furthermore, the measurement of IL‐8 was performed according to manufacturer’s instructions also using the Light Cycler® 480. The reaction mix contained 10 μl SYBR green reaction mix, 25%

cDNA, and 25 pmol/μl of each primer in a total volume of 20 μl. IL‐8 was measured using the primers 5′‐gtgcagttttgccaaggagt‐3′ and 5′‐ttatgaattctcagccctcttcaaaaacttctc‐3′. Some of the qRT‐

PCR experiments were performed by Bernadette Lüns.

2.6 Detection of protein expression 2.6.1 ELISA

The measurement of total secreted MMP‐9 protein all co‐culture experiment was done using the Quantikine Kit (R&D Systems) which is based on the direct sandwich enzyme‐linked immunosorbent assay (ELISA) principle according to the manufacturer’s protocol. Thawed cell

37

culture supernatant was diluted with sample buffer. MMP‐9 standard was diluted with 5 ml calibration solution RD5‐10 (Final concentration: 5 ng / ml), mixed well, and incubated for 15 minutes at RT while shaking. 7.5 μl of sample buffer RD1‐34 were added into each well. 50 ul of standards, controls, and samples were added to the plate (which carries monoclonal MMP‐9‐

specific antibodies), mixed well, and incubated for 2 hours. Then, the respective wells were washed 3 times at RT with washing buffer. Subsequently, 100 μl of a second polyclonal MMP‐9‐

specific HRP‐coupled antibody were added and incubated at RT for 2 hours. After washing 3 times, 100 μl of substrate solution were added and incubated for 30 min at RT in dark. Finally, 100 μl stop solution were added and color development was measured by an ELISA reader (BEB Siemens) at a wavelength of 450 nm. The calculation was performed with the software Revelation‐Version 4.21 (Dynex Technologies Germany). The ELISA experiments were performed by Bernadette Lüns.

2.7 Identification of the Soluble Mediators 2.7.1 Proteome profiler human XL cytokine array

For the detection of cytokine secretion, the Proteome Profiler Human XL cytokine Array was carried out. The Proteome Profiler Human XL cytokine Array kit (based on the sandwich ELISA principle) was performed according to manufacture instructions. In short, an array membrane (consisting of capture antibodies spotted in duplicate on nitrocellulose) was incubated with diluted supernatants from differently stimulated cell types, mixed with a cocktail of biotinylated detection antibodies, and incubated overnight. The next day, the membranes were washed and streptavidin‐HRP and chemi luminescent detection reagent were applied. Cytokine array data

38

were developed on X‐ray films (1‐10 min exposure) and secreted mediators were identified according to the scheme shown in table 3.

Tab. 3: Proteome profiler human XL cytokine array membrane scheme. PC: positive control, A3‐E10: spotted antibodies for the identification of different cytokines/chemokine. E20: negative control (NC).

2.8 Stimulation of monocytes with identified soluble mediators

After the identification of differentially and increasingly expressed T‐cell‐derived soluble mediators, monocytes were stimulated with the identified factors and the MMP‐9 mRNA concentration was measured by qRT‐PCR in order to test whether MMP‐9 induction can be reproduced solely by stimulation with these mediators. Therefore, 2 x 10⁶ THP‐1 cells / well (starved overnight with 1% FCS) were stimulated for 0, 2, 4, 6, and 24h with concentrations of 5ng/ml IL‐16, 5ng/ml sICAM‐1, 5ng/ml IL‐8, 25ng/ml Serpin E‐1, 5ng/ml MIF, 5ng/ml IL‐13 individually or in combination and 25 ng/ml TNF as a control. The concentrations were determined by dose response experiments. Subsequently, RNA isolation, cDNA synthesis, and qRT‐PCR were performed as described before (see 2.4 and 2.5).

39

2.9 Cellular function of activated monocytes

The activating capacity of different anticoagulants was analysed by accessing the major cell functions. Therefore, monocytes were stimulated with the supernatant of HMWH‐stimulated T‐

cells. Afterwards, proliferation, apoptosis, and phagocytosis of the stimulated cells were analysed.

2.9.1 Proliferation

To analyse stimulation‐dependent monocytic proliferation, cell counts and ATP measurements were performed using a Neubauer chamber and the Via‐Light Plus kit, respectively. This kit is based on the measurement of ATP that is present in all metabolically active cells. The bioluminescent method utilizes luciferase to catalyze the formation of light from cell derived ATP and was performed according to manufacturer’s instructions. 2 x 10⁶ monocytic cells / well were stimulated for up to 5 days with HMWH‐stimulated T‐cell‐derived supernatant. Afterwards, cell lysis reagent was added for 10 min. To generate luminescent signals, ATP monitoring reagent plus (AMR plus) was added and the light emission was measured using a luminometer.

2.9.2 Phagocytosis

Phagocytosis, which is an early and crucial event in triggering host defense, was measured using the CytoSelect Phagocytosis Assay. This is a high‐throughput method to measure phagocytosis by which phagocytes (i.e., stimulated monocytes) are incubated with pre‐labeled Zymosan particles for 1 h. Non‐phagocytosed Zymosan particles are blocked, cells are permeabilised and

40

lysed, and finally, Zymosan substrate is added and the amount of phagocytosed Zymosan particles is measured in the respective extracts on a plate reader at 405nm.

2.9.3 Apoptosis

To assess the degree of apoptosis in stimulated cells, terminal deoxy nucleotidyl transferased dUTP nick end labeling (TUNEL) which is an established method for detecting DNA fragments, was used. The TACS TdT kit contains a highly purified form of the TdT enzyme for the enzymatic incorporation of biotinylated nucleotides. Labelling was achieved using Biotin and horseradish peroxidase‐coupled Streptavidine. Determination of TdT labeling was performed by determination of the metabolization of the colorimetric substrates diaminobenzidine (DAB) or TACS Blue Label. Therefore, 2 x 10⁶monocytic THP‐1 cells / wellwere stimulated with HMWH‐

stimulated T‐cell‐derived supernatant. Cells were harvested by centrifugation at 500g for 5 minutes, media was discarded and cells were re‐suspended and fixed in 3.7% buffered formaldehyde (1 ml / 1 × 10⁶ cells). Afterwards, the suspension was centrifuged at 500 g, the fixative was discarded, and the cell pellet was re‐suspended in 80% ethanol (1 ml / 1 × 10⁶ cells).

1 x 10⁵ cells were spotted on a clean glass microscope slide and dried for 20 minutes at 45 C.

Slides were immersed in 70% ethanol for 10 minutes then air dried at room temperature for 2h.

A rehydration step was done in a succession of 100%, 95%, and 70% ethanol. Then, the slide was immersed in 1 x PBS. The in situ labelling procedure was done by transferring the sample in 1 x PBS for 10 minutes at RT after rehydration in ethanol. Proteinase K solution was added and incubated for 15‐30 minutes at 37 °C, then the samples were washed with deionized water for 2 minutes. Afterwards, slides were immersed in quenching solution (5 min at RT), and washed with 1% PBS (1 min RT). Subsequently, slides were immersed in 1 x TdT labelling buffer for 5

41

minutes. 50 µl of labelling reaction was added, mixed, and incubated at 37 °C for 1h.

Subsequently, 1 x TdT stop buffer was added for 5 minutes, and samples were washed 2 x in PBS for 2 minutes. Finally, samples were immersed in TACS‐Blue label solution for 2‐7 minutes, washed several times in deionized water for 2 minutes each, and processed for counterstaining using nuclear fast red according to the manufacture’s protocol.

2.10 Statistical analysis

Statistical analysis was performed using unpaired t‐test with Welch’s correction and Mann–

Whitney U‐test for significance. P values <0.05 (∗), and <0.01 (**), were considered significant.

42

3 Results

3.1 Direct stimulation of different cell types with anticoagulants

To elucidate which cell types within the blood may be responsible for the increased MMP‐9 mRNA and protein expression following blood sampling reported in the literature, especially in heparin‐treated samples, the major blood cell types(monocytes, T‐cells, B‐cells) were analyzed.

Therefore, the cell lines THP‐1 (monocytes), Jurkat (T‐cells), and HT (B‐cells), respectively, have been used. In these experiments starved cells were stimulated up to 24h with EDTA, heparin (i.e.

HMWH), or citrate. Unexpectedly, neither the stimulation with EDTA or citrate nor HMWH had a significant stimulatory effect on the MMP‐9 mRNA expression in monocytes (Fig.3.1), T‐ cells (Fig.3.2), or B‐cells cells (Fig.3.3) at different time points.

These results indicate that direct stimulation of monocytes, T‐cells, or B‐cells with the respective anticoagulants does not induce MMP‐9 expression significantly. This suggests that an indirect mechanism might play an important role for the regulation of MMP‐9 expression in response to the reported anticoagulants.

43

3.2 Significant Induction of MMP‐9 expression by HMWH in a co‐culture including THP‐1, Jurkat, and HT cells

To determine whether the MMP‐9 expression is influenced by an interaction of different cell types, a mixture of monocytes, T‐cells, and B‐cells (i.e., THP‐1, Jurkat, and HT cells) was used.

Following starvation of the cells overnight, the cell mixture was stimulated with the respective anticoagulants and incubated for 0h, 2h, 4h, 6h, and 24h. Finally, the intracellular MMP‐9 mRNA expression as well as the amount of secreted MMP‐9 protein in the supernatant was determined.

The analysis of MMP‐9 mRNA expression in the co‐culture of THP‐1, Jurkat, and HT cells revealed that MMP‐9 expression increased significantly after addition of HMWH (Fig. 3.4 A). In contrast, stimulation with other anticoagulants such as EDTA (Fig. 3.4 B) or citrate (Fig. 3.4 C) had no MMP‐9‐inducing effect in this co‐culture model. Equivalently the stimulation of a mixture of THP‐1, Jurkat, and HT with HMWH‐treated Jurkat supernatant (Fig.3.5 A), but not HMWH‐treated HT supernatant (Fig. 3.5 B), increased the amount of MMP‐9 levels significantly over time, whereas the stimulation of a mixture of THP‐1, Jurkat, and HT with EDTA‐treated Jurkat‐supernatant/‐HT‐supernatant (Fig. 3.5 C, D) or citrate‐treated Jurkat‐supernatant/‐HT‐

supernatant (Fig. 3.5 E, F) did not result in any induction effect on MMP‐9 levels.

These results indicate that MMP‐9 expression in (at least) one of the cell types included in this experiment depends on an interaction with another involved cell type in response to HMWH, e.g., via direct cell‐to‐cell interaction or the stimulation with a soluble mediator. Therefore,

47

3.4 Significant induction of MMP‐9 expression in THP‐1 cells in response to culture supernatant derived from HMWH‐treated Jurkat cells

With respect to the known ability of monocytes/macrophages to produce large amounts of MMP‐9 during tissue invasion (120), it was reasonable to speculate that during the interaction of monocytes and T‐cells, the T‐cells are responsible for the secretion of a soluble monocyte‐

stimulating factor to which the monocytes react with increased MMP‐9 expression.

Therefore, starved monocytes were stimulated in the next step with the supernatant of HMWH‐treated Jurkat cells for 0, 2, 4, 6, and 24h (Fig. 3.9). As a control, THP‐1 cells were also stimulated with the supernatant of HMWH‐treated HT cells (Fig. 3.9) as well as EDTA‐ or citrate‐

treated Jurkat and HT cells (data not shown). Comparable to the results obtained in the experiments in which double co‐cultures were performed, no effect on MMP‐9 mRNA levels could be observed using supernatants from HMWH‐treated HT cells (Fig. 3.9) or EDTA‐ or citrate‐treated Jurkat and HT cells (data not shown). The analysis of MMP‐9 expression in

treated Jurkat and HT cells (data not shown). Comparable to the results obtained in the experiments in which double co‐cultures were performed, no effect on MMP‐9 mRNA levels could be observed using supernatants from HMWH‐treated HT cells (Fig. 3.9) or EDTA‐ or citrate‐treated Jurkat and HT cells (data not shown). The analysis of MMP‐9 expression in

Im Dokument Cellular and molecular characterization of the effects of different anticoagulants on the regulation of matrix metalloproteinase 9 (Seite 46-0)