CHAPTER 2: MATERIALS AND METHODS
2.4 Generation of transgenic parasite strains
2.4.1 Cloning of plasmids and preparation for transfection
2.4.1.1 General procedure
Gene fragments of interest were amplified using specific PCR primers that added relevant restriction sites. They were purified either via an agarose gel or a column and then restricted and purified again. Subsequently, they were ligated into restricted expression plasmids and transformed into E. coli bacteria. In some cases, ligation of the restricted insert into the expression vector proved difficult for reasons that were not entirely clear but likely related to the restriction sites and process. The insert was then initially ligated into the pGEM-T easy vector for analysis and subsequently restricted for ligation into the expression plasmid. Plasmid DNA was extracted from E. coli single colony cultures by a silicone-based method and resulting DNA was tested for the correct integration of the transgene by restriction analysis. The plasmid DNA of two to three clones that tested positive was then isolated from a second batch of culture using an extraction kit and sequenced. A clone with the correct DNA sequence was selected and linearized for transfection into P. berghei blood stage schizonts.
2.4.1.2 Polymerase chain reaction (PCR)
Gene fragments were amplified using either MidRange polymerase or Phusion™ High Fidelity DNA polymerase.
All primers were designed to have a melting temperature of 50 to 65°C and ordered from Operon Biotechnologies GmbH (Cologne, Germany). They were stored as stock solutions of 100 pmol/μl in DNAse-free, distilled water (aqua ad iniectabilia Delta Select) at -20°C. For use, the stock solutions were diluted 1:10. Individual primer sequences can be found in sections 2.4.1.13 and 2.4.2.2.
Table 2.6: PCR reaction mix for MidRange and Phusion polymerases
component MidRange Phusion
DNA template 50-200 ng 50-200 ng
Reaction buffer (5x) 10 μl 10 μl
dNTPs (10 mM each) 1 μl 1 μl
sense primer (10 pmol/μl) 2.5 μl 2.5 μl
anti-sense primer (10 pmol/μl) 2.5 μl 2.5 μl
polymerase 1 μl (5 U) 1 μl (2 U)
MgCl2 (50 mM) 1.5 μl
---dH2O ad 50 μl ad 50 μl
Table 2.7: PCR programs for MidRange and Phusion polymerases
step MidRangeMidRangeMidRange PhusionPhusionPhusion
Temperature Time Cycles Temperature Time Cycles
DNA denaturation 94°C 3 min 1x 98°C 2 min 1x
DNA denaturation 94°C 1 min
30x
98°C 0.5 min
annealing 55°C 1 min 30x
30x 55°C 1 min
30x
elongation 68°C 2.5 min
30x
72°C 2 min
30x
final elongation 68°C 10 min 1x 72°C 10 min 1x
storage 4°C indefinitely 1x 4°C indefinitely 1x
2.4.1.3 Restriction of DNA
Plasmids and PCR products were restricted with the appropriate enzymes for 1 hour at 37°C in a thermocycler. Depending on the enzymes used, BSA was either added to the reaction or not.
Table 2.8: Restriction reaction mix
component amount
DNA 1-2 μg
restriction enzyme 10 U
buffer (10x) 2 μl
BSA (2 mg/ml) 2 μl
dH2O ad 20 μl
If only one enzyme was used for plasmid restriction digest, the resulting linearized vector was dephosphorylated with calf intestinal phosphatase (CIP) for 30 minutes at 37°C to avoid religation of the vector. If the restriction digest had taken place in a buffer other than NEB3, the vector was first purified via a MyBudget column according to the manufacturerʻs instructions and eluted in dH2O.
Table 2.9: CIP reaction mix
component amount
vector 2 μg
NEB3 buffer 3 μl
CIP (10 U) 1 μl
dH2O ad 30 μl
2.4.1.4 Agarose gel electrophoresis
Agarose gel electrophoresis was used to purify DNA fragments and to determine the size of vectors and DNA fragments. Samples were mixed with loading buffer containing bromephenol blue and xylene cyanol FF, which behave like 300 bp and 4000 bp fragments, respectively. Depending on their size, gels were run in TAE buffer at 80 to 110 V for 20 to 45 minutes. For fragments below 1500 bp, a 1.5% TAE agarose gel was used; for larger fragments, a 1% agarose gel. The intercalating chemical ethidiumbromide (0.1 µg/ml) was added to gels at a ratio of 1:10,000.
Therefore, DNA fragments could be visualized under UV illumination and compared to a size marker. For smaller fragments, 5 µl HyperLadder IV (100 - 1000 bp) per lane were used, for larger fragments 5 µl HyperLadder I (200 - 10,000 bp).
2.4.1.5 Extraction of DNA fragments
DNA fragments from agarose gels were purified using the kit NucleoSpin Extract II according to the manufacturerʻs instructions, DNA fragments from PCR reactions using the MyBudget PCR product purification kit according to the manufacturerʻs instructions. Subsequent agarose gel electrophoresis of an aliquot of the eluted DNA served to confirm the purification and to determine the concentration of the DNA.
2.4.1.6 Measuring DNA concentration by photometer
Concentration and purity of DNA samples was also determined using a photometer. An aliquot of DNA was diluted 1:50 in dH2O and its extinction was measured at 260 and 280 nm. The 260 nm value indicated the concentration of the sample at 50 µg/ml for an extinction of 1. The ratio of the 260 value to the 280 value gives an impression of the purity of the sample and should be close to 1.8.
2.4.1.7 Ligation of DNA fragments into expression plasmids or the pGEM-T easy vector
For a ligation, 50-100 ng restricted vector were used. The restricted insert was added in threefold molar excess and the required amount calculated as follows: 50-100 ng vector * x bp of insert * 3 / y bp of vector = z ng insert.
The ligation reaction was incubated for at least 4 hours at room temperature or overnight.
Table 2.10: Ligation reaction mix
component volume
T4 ligase 1 μl (400 U)
ligase buffer (10x) 1 μl
insert x μl
vector (50-100 ng) y μl
dH2O ad 10 μl
In some cases, prior ligation into the pGEM-T easy vector was necessary, which possesses an overhang of multiple thymidines at its 3ʻ-end. Therefore, simple A-tailing of the insert, that is the addition of several desoxyadenosines to the blunt 3ʻ-end via the Taq polymerase, makes it available for ligation into the vector. A-tailing took place at 70°C for 30 minutes immediately before ligation at 4°C overnight.
Table 2.11: A-tailing reaction mix
component volume
PCR product 5 μl
Taq polymerase buffer (10x) 1 μl
MgCl2 (25 mM) 1 μl
dATPs (1 mM) 2 μl
Taq polymerase (GoTaq) 1 μl Table 2.12: pGEM-T easy ligation mix
component volume
rapid ligation buffer 5 μl
pGEM-T easy 1 μl
ligase 1 μl
A-tailing reaction mix 3 μl
2.4.1.8 Generation of and transformation into competent E. coli bacteria
Ligated vector-insert DNA was transformed into competent E. coli XL1 blue bacteria. To generate competent bacteria, a 5 ml LB medium liquid culture with 15 µg/ml tetracycline was grown overnight. The following morning, 1 ml of the culture were added to 100 ml of LB medium with antibiotics and grown until an OD600 of 0.5 was reached. Then, the bacteria were pelleted at 800g for 15 minutes at 4°C and resuspended in 30 ml ice-cold Tfb1 buffer. They were incubated on ice for 2 hours and occasionally inverted. After centrifugation at 800g and 4°C for 15 minutes they were resuspended in 5 ml ice-cold Tfb2 buffer. Aliquots of 50 or 100 µl were then frozen down immediately in liquid nitrogen and stored at -70°C.
When needed, aliquots were thawed on ice immediately prior to use. Five µl of the ligation reaction mix were added to 50 µl of competent bacteria and incubated on ice for 30 minutes followed by a
heat shock at 42°C for 45 seconds. Samples were cooled on ice for 2 minutes before 950 µl prewarmed SOC medium were added. The bacteria were shaken for 1 hour at 37°C and then plated on LB agar plates containing antibiotics to select for the transformed plasmid. To account for varying transformation success and therefore growth density, different volumes of the mixture were plated. First, two plates with either 50 µl mixture and 150 µl SOC medium or 200 µl mixture were prepared. The remaining mixture was spun down at 2150 g for 8 minutes. All but 200 µl of the supernatant were removed and the pellet was resuspended and plated. Agar plates were incubated at 37°C overnight.
2.4.1.9 Small-scale extraction of plasmid DNA
For initial analysis of single clone colonies, plasmid DNA was extracted using a silicone-based method that exploits the specific binding of DNA to silicone in the presence of high salt concentrations. Single colonies from plates of transformed E. coli were picked, transferred into 5 ml LB selection medium and shaken over night at 37°C. The following morning 4 ml of the culture were pelleted at 6,000 g for 5 minutes. The bacteria pellet was resuspended in 250 µl STET buffer before addition of 10 µl lysozyme stock solution and incubation on ice for 10 minutes. The solution was then heated to 95°C for 90 seconds. The resulting bacterial lysate was kept on ice for 3 minutes and then centrifugated at 12,000g and room temperature for 15 minutes. The supernatant was added to 500 µl of a 6 M sodium iodide solution and 10 µl silicone suspension and lightly shaken at 37°C for 5 minutes to allow binding of the DNA to the silicone particles. The suspension was then spun down at 12,000 g for 1 minute and the sediment was washed once with 1 ml New Wash buffer. After removal of the wash buffer, the sediment was kept at 56°C for 5 minutes to remove excess ethanol. It was then resuspended in 50 µl DNAse-free dH2O (aqua ad iniectabilia Delta Select) and incubated for 5 minutes at 56°C to release the DNA from the silicone particles.
The silicone particles were sedimented and DNA aliquots could be taken from the supernatant to measure their concentration photometrically. The DNA-silicone solutions were stored at -20°C.
For subsequent sequencing, plasmid DNA was extracted from a second culture batch and isolated using the NucleoSpin® Plasmid kit according to the manufacturerʻs instructions. The amount of purified DNA is comparable to the silicone-based method but is much purer (OD260/280 ≈ 1.8).
2.4.1.10 Large-scale extraction of plasmid DNA
E. coli XL1 blue bacteria were transformed and grown over night on LB selection plates. A clone was transferred into 50 to 100 ml LB selection medium and grown in liquid culture overnight at 37°C. The bacteria were spun down and their plasmid DNA was extracted using the Nucleobond® Plasmid PC100 kit according to the manufacturerʻs instructions.
2.4.1.11 DNA sequencing
DNA samples were sequenced by AGOWA GmbH (Berlin).
2.4.1.12 Linearisation for transfection
The concentration of the plasmid DNA from a large-scale extraction was measured and a volume equaling 30 μg was digested with SacII and ApaI which recognize sites within the integration sequence. The reaction mix was first incubated at room temperature for 30 minutes to allow optimal digestion with ApaI and then moved to 37°C for 1 hour for SacII restriction. If the insert
contained either an ApaI or SacII restriction site, only one enzyme was used for linearization. If both sites were present, the restriction enzyme PshAI was used. The linearized plasmid was purified via the NucleoSpin® Extract II kit and the concentration was measured in an agarose gel.
As a final concentration, 5 to 10 μg DNA were needed in a volume of 10 μl.
2.4.1.13 Specific cloning strategies
Table 2.13, Part I: Cloning strategy specifics for individual constructs Final parasite
strain
vector promoter insert amplification primer pair 5ʻ-3ʻ (internal reference number) Pb-mCherry pL0017 pbeef1α,
constitutive
mCherry cDNA
ATCGGGATCCATGGTGAGCAAGGGCGAG (forward, 914)
ATGCTCTAGACTACTTGTACAGCTCGTCC (reverse, 915)
Pb-tdTomato pL0017 pbeef1α, constitutive
tdTomato cDNA
GGGATCCTGTACGACGATGACG (forward, 948)
GCTCTAGAGCTTTGTTAGCAGCCGGATC (reverse, 986)
Pb-Display-mCherry
pL0017 pbeef1α, constitutive
Display-mCherry cDNA
TTGGATCCATGGAGACAGACACACTCCTGC (forward, 1542)
TTTCTAGACTAACGTGGCTTCTTCTGCCAAA GC
(reverse, 1543)
Pb-LLS-Exp1-mCherry
pL17.1.1 Ch
of gene
Pb103464.00.0 (PlasmoDB), late liver stage-specific
Exp1 cDNA
---(not obtained by PCR amplification but by direct restriction of plasmid)
Table 2.13, Part II: Cloning strategy specifics for individual constructs Final
parasite strain
via pGEM
restriction sites used
linearization enzymes
strategy and result subcloned
Pb-mCherry no BamHI, XbaI ApaI, SacII replacement of GFP with mCherry, cytosolic expression during all developmental stages
yes
Pb-tdTomato
no BamHI, XbaI ApaI, SacII replacement of GFP with tdTomato, cytosolic expression during all developmental stages
yes
Pb-Display-mCherry
yes BamHI, XbaI PshAI replacement of GFP with Display-mCherry, visualization of parasite membrane during all developmental stages
no
Pb-LLS- Exp1-mCherry
--- BamHI ApaI, SacII fusion of Exp1 to mCherry,
visualization of the PVM during late liver stages
no