Cloning of NhaP1

2.2.1 Polymerase chain reaction

The NhaP1 encoding gene, Mj0057, has been previously cloned into the expression vector pET26b (Vinothkumar et al), which has a C-terminal hexa histidine tag. For designing new expression plasmids, NhaP1 was amplified using the above mentioned pET26b-NhaP (NhaP1His) as a template with the following forward (For1) and two reverse (Rev1& Rev2) primers (MWG-Biotech-AG);

For 1: 5’ TACG*CCGCGGACATATG*GAACTTATGATG3’

Rev 1: 5’TG*GAATTCTCGAG*TTAATGGTGGGATTCTTCTTT3’

The primers introduced a SacII (green) or Nde1 (blue) restriction enzyme site at the N-terminus and XhoI (orange) and EcoRI (cyan) restriction enzyme site at the C-terminus of the amplified product. 4 histidines were introduced when amplified with Rev2. Primers were resuspended in double distilled H2O to form a 10µM stock solution. 1µM of each primer was added to 1U Pfu DNA polymerase (Stratagene, Heidelberg), 0.2mM dNTPs, 1mM MgSO4, 1ng plasmid template, 5µl of 10X PCR buffer for Pfu DNA polymerase (Stratagene, Heidelberg). The total reaction volume was 50µl.

Template amplification was performed in a thermal cycler T3 thermocycler, Biometra, Göttingen) with the following programme:

5 min 95 C Hotstart Denaturation 30 cycle

45s 95°C Denaturation

30s 45°C Primer hybridization 45s 72°C Polymerization 10min 72°C End Polymerization Till cool down to 4°C

Reaction mixtures were analysed for PCR products of correct length by loading 1µl onto a 1.2% agarose gel (80V, 30mins, B1A, Owi seperation system USA Portmoth-NH). DNA was stained with ethidium bromide (~0.01%v/v) and visualised under UV illumination. Proteins, dNTPs and unused primers, were removed from successful PCR reaction mixtures using the commercially available, QIAquick® PCR purification kit (Qiagen).

2.2.2 Expression plasmids

Following expression plasmids were generated for the NhaP1 gene:

1. pSKB2LNB-NhaP1 (Novagen, modified). The expression cassette is under the transcriptional control of the T7 promoter. This plasmid has a N-terminal hexa histidine tag, which can be cleaved off using the PreScisson protease (Amersham

2005) was released by restriction digestion with Nde1 and Xho1(New England Biolabs) and subcloned into pSKB2LNB . The new expression plasmid with NhaP1 inserted into this vector will be further referred as HisNhaP1.

2. pASKIBA13plus-NhaP1 (IBA, Biotagnology, Göttingen) The expression cassette is under the transcriptional control of a tetracycline promoter. This plasmid has a N-terminal Strep-Tactin affinity tag (Strep tag II), which can be removed by cleavage with thrombin (Sigma-aldrich). The NhaP1 gene was amplified from a (Vinothkumar et al., 2005) previous construct with primer For 1 and Rev 1. The amplified PCR product was digested with SacII and Xho1 and cloned into the vector pASKIBA13plus. The new expression plasmid with NhaP1 inserted into this vector will be further referred as _StrepNhaP1.

2.2.3 Plasmid extraction

Colonies of transformed cells (DH5α) with the above plasmids were inoculated into 5ml LB with 50µg/ml Kanamycin (1) or 100µg/ml Ampicillin (2). The inoculated media was incubated for 16 hours at 37°C in a shaker at 180 rpm. Plasmids were purified using the commercially available QIAprep® Miniprep kit.

2.2.4 Estimation of plasmid concentration

The plasmid concentration can be determined spectrophotometrically. The plasmid was diluted by 1:100 and the absorbance (optical density) measured at 260nm. One absorbance unit at 260nm is equivalent to 50µg/ml of double stranded DNA for a pathlength of 1cm; this is the molar extinction coefficient of DNA. An average of three readings was taken. The formula given below was used to calculate the final concentration:

Absorbance ODλ260 x 50 x dilution factor = DNA sample concentration (µg/ml)

2.2.5 Agarose Gel Electrophoresis

0.8g of low-melt agarose (Sigma) was dissolved in 100ml of 1x TAE buffer (40mM tris-acetate pH8.0, 1mM EDTA) and heated in a microwave. The solution was allowed to cool down before pouring it out into a cast. Just before pouring, 1µl of

ethidium bromide solution was added. After the gel solidified, it was transferred into a Biorad sub-cell GT system and submerged with 1x TAE buffer. The sample was mixed with DNA loading buffer and electrophoresis was performed at 80V for 30 minutes. The stained bands were visualised with a UV illuminator (Biorad).

2.2.6 Restriction Enzyme Digestion

Before ligation, the PCR products and the plasmids require to be digested with the respective restriction enzymes to generate ‘sticky ends’ necessary for ligation.

Restriction digestion mix (Total volume 50µl with ddH20)

Plasmid PCR product DNA 10µl 20µl

Restriction enzyme 2U 2U

Buffer(10X)(NEB) 5µl 5µl

Each digest mixture was incubated for 3 hours in a 37°C. Digested PCR product was purified using the QIAquick® PCR purification kit (Qiagen) and the cleaved vector was purified by gel extraction.

2.2.7 Gel Extraction

After complete restriction digestion, the mixture was loaded onto a 1.2% agarose gel and the cleaved vector was separated by electrophoresis. Bands were visualised using UV illumination and the cleaved vector was excised. DNA was extracted from the agarose gel using the commercially available QIAquick® gel extraction kit (Qiagen).

2.2.8 Ligation

Insertion of digested and purified PCR product into digested and purified vector was carried out by ligation at 16°C for 16 hours using the ligation enzyme T4 DNA ligase (New England Biolab). TOP10 competent cells were transformed with the resulting ligation mixture via electroporation (details above) plated onto LB agar plates containing required antibiotics, Kanamycin-50µg/ml and Ampicillin-100µg/ml.

2.2.9 Screening for positive clones Positive clones were checked as follows:

1. Plasmids were extracted from liquid LB cultures grown overnight. The mobility shifts of the plamids were compared to the vector.

2. Plasmids, which show a mobility shift, were subjected to restriction digestion to check for insert release.

The positive clones are then preserved as glycerol stocks and their plasmids extracted and stored at -20°C.

2.2.10 Sequencing

The positive clones are further confirmed by sequencing. The resulting sequences were compared with the expected sequence using the web based server Multalin (CORPET, 1988).