2. Materials and Methods
2.2. Chemicals, Buffers & Consumables
2.2.1. Chemicals
Chemicals used in thesis study are listed in table 2.2:
Table 2.2.: Chemicals and Solutions
Chemical or solution Manufacturer
30% Acrylamid/Bis Solution (37,5:1) Bio-Rad, California, USA Adenosine 5’triphosphate, ATP Roth, Karlsruhe, Germany
Agarose Sigma-Aldrich, Steinheim, Germany
anti FITC microbeads Miltenyi Biotec, Bergisch Gladbach, Germany auto MACS rinsing buffer Miltenyi Biotec, Bergisch Gladbach, Germany
β-Mercaptoethanol Sigma-Aldrich, Steinheim, Germany
Bacillol Bode, Hamburg, Germany
Biocoll Lymphoprep Solution Biochrom, Berlin, Germany Bovine Serum Albumin BSA Serva, Heidelber, Germany Brilliant Blue G Sigma-Aldrich, Steinheim, Germany
Chloroform J. T. Baker, Deventer, Netherlands
Complete protease inhibitor, EDTA-free Roche, Mannheim, Germany
Coomassie Plus Thermo Scientific, Massachusetts, USA Disodiumhydrogenphosphate Roth, Karlsruhe, Germany
Dithiothreitol (DTT) Sigma-Aldrich, Steinheim, Germany
DMSO Sigma-Aldrich, Steinheim, Germany
dNTPs Peqlab, Erlangen, Germany
Dynabeads Protein G Life Technologies AS, Oslo, Norway
EDTA Sigma-Aldrich, Steinheim, Germany
MTT (Thiazolyl Blue Tetrazolium Bromide) Sigma-Aldrich, Steinheim, Germany
Nonidet P-40 Fluka, Missouri, USA
2.2. CHEMICALS, BUFFERS & CONSUMABLES 25
Chemical or solution Manufacturer
Random Primers Invitrogen, Karlsruhe, Germany Re-Blot Plus Mild Solution (10x) Millipore, Massachusetts, USA
RNase away Molecular BioProducts, San Diego, USA
RNase free H2O Sigma-Aldrich, Steinheim, Germany
Trypanblaue 0.4% in PBS Sigma-Aldrich, Steinheim, Germany
Tween 20 Sigma-Aldrich, Steinheim, Germany
Western lightning Plus ECL Perkin Elmer, Waltham, USA
2.2.2. Buffers and Solutions
Buffers and solutions used in this study are listed in table 2.3:
Table 2.3.: Buffers
Buffer Recipe
Ago2-RIP lysis buffer 25 mM Tris HCl pH 7.5 150 mM KCl Ago2-RIP wash buffer 50 mM TrisHCl pH 7.5
300 mM NaCl 6x Laemmli buffer 375 mM Tris HCl pH 6,8
9% SDS
50% (v/v) Glycerol 0.03% Bromphenoleblue 9% (v/v) beta-Mercaptoethanol MTT Solution I 5 mg/mL MTT in PBS MTT Solution II 33 % DMSO (v/v),
5 % (v/v) Formic acid 62 % (v/v) Isopropanol Nucl. extraction buffer A 10 mM HEPES pH 7.9
10 mM KCl Continued on next page
26 2| Materials and Methods
Buffer Recipe
10 mM EDTA 10 mM EGTA 1 mM DTT Nucl. extraction buffer B 20 mM HEPES
400 mM KCl
Separation gel mix 250 mM Tris-base, pH 8.8
25% (v/v) Acrylamid/Bis solution (40 %) 0.0004% (w/v) APS
0.00125% (v/v) TEMED Stacking gel mix 250 mM Tris Base pH 6.8
12.5% (v/v) Acrylamid/bis solution (40 %)
Inhibitors used in this study are listed in table 2.4:
Table 2.4.: Inhibitors
2.3. EQUIPMENT 27
2.2.4. Consumables
Consumables used in this study are listed in table 2.5:
Table 2.5.: Consumables
Consumable Manufacturer
96 well PCR plates Applied Biosystems, Foster City, California, USA Agilent RNA 6000 Pico Kit Agilent Technologies, Waldbronn, Germany Agilent Small RNA kit Agilent Technologies, Waldbronn, Germany
Cell culture flasks Nunclon, Rosklide, Denmark
Cryotubes Nunc, Wiesbaden, Germany
DNA loBind tubes 1,5 mL, safe lock PCR clean Eppendorf, Hamburg, Germany
FACs tubes Becton Dickinson, Franklin Lakes, USA
Falcon tubes 15 ml Falcon, Reynosa, Mexico
Falcon tubes 50 ml Greiner Bio-One, Kremsmuenster, Austria MACS LS columns Miltenyi Biotec, Bergisch Gladbach, Germany MACS pre separation filters Miltenyi Biotec, Bergisch Gladbach, Germany Multiwell cell culture plates Nunclon, Rosklide, Denmark
Nucleofection cuvettes Amaxa-biosystems, Cologne, Germany
PVDF membrane Biorad, Hercules, USA
Reaction tubes (0.5, 1.5, 2.0 mL) Eppendorf, Hamburg, Germany Siliconized Tubes, 1,7ml (25 Tubes) Active Motif, La Hulpe, Belgium
2.3. Equipment
Equipment used in this study is listed in table 2.6:
Table 2.6.: Equipment
Instrument Manufacturer
7500 Fast Real-Time PCR System Applied Biosytems, Foster City, California, USA Advanced Fluorescence Imager Intas, Goettingen, Germany
Amaxa Nucleofector 4D Lonza, Basel, Switzerland
Bioanalyzer2100 Agilent Waldbronn, Germany
FACS Calibur, FACS Aria III Becton Dickinson, Franklin Lakes, USA Heraeus Multifuge 3L Thermo, Waltham, USA
Microcentrifuge 5424 Eppendorf, Hamburg, Germany Multiscan Ex Platereader Thermo, Waltham, USA
NanoDrop1000 Thermo, Waltham, USA
Neubauer Counting Chamber Improved Lo Labor Optik, Friedrichsdorf, Germany Thermocycler T3000 Biometra, Goettingen, Germany
28 2| Materials and Methods
2.4. Stimulants
Stimulants used in this study are listed in table 2.7:
Table 2.7.: Stimulants
Description Final conc. Manufacturer
F(ab’)2 Fragment Goat α-human IgG 13 μg/mL Jackson ImmunoResearch, Suffolk, UK F(ab’)2 Fragment Goat α-human IgM 13 μg/mL Jackson ImmunoResearch, Suffolk, UK
sCD40L 200 ng/mL Autogen bioclear, Wiltshire, UK
LPS 1 μg/mL Sigma-Aldrich, Steinheim, Germany
2.5. ANTIBODIES 29
2.5. Antibodies
Antibodies used for immunoblotting, FACS and Ago2-RIP are listed in table 2.8.
Table 2.8.: Antibodies
Antibody Species Order no. Working solution Manufacturer Ago2 clone 11A9 rat SAB4200085 1:1,000 5% BSA TBS-T SIGMA, St. Louis, USA
3.6 μg per 4.5 μg beads
P-AKT (Ser473) rabbit 4060P 1:1,000 5% BSA TBS-T Cell Signalling Technology, Dan-vers, USA
AKT (67E7) rabbit 4691P 1:1,000 5% BSA TBS-T Cell Signalling Technology, Dan-vers, USA
BCL-6 rabbit 5650 1:1,000 5% BSA TBS-T Cell Signalling Technology,
Dan-vers, USA
BTK (D3H5) rabbit 8547 1:1,000 5% BSA TBS-T Cell Signalling Technology, Dan-vers, USA
P-BTK (Tyr223) rabbit 5082 1:1,000 5% BSA TBS-T Cell Signalling Technology, Dan-vers, USA
CD77 mouse 551353 50 μL per1x108cells Beckton Dickinson, New Jersey,
c-MYC rabbit ab32072 1:5,000 5% BSA TBS-T USAAbcam, Cambridge, UK
ELK-1 rabbit 9182 1:1,000 5% BSA TBS-T Cell Signalling Technology,
Dan-vers, USA
P-ELK1 (Ser383) rabbit 9180 1:1,000 5% BSA TBS-T Cell Signalling Technology, Dan-vers, USA
ERK rabbit sc-94 1:1,000 5% BSA TBS-T Santa Cruz, Dallas, US
P-ERK (Tyr204) mouse sc-7383 1:1,000 5% BSA TBS-T Santa Cruz, Dallas, US
GAPDH mouse ab8245 1:10,000 5% BSA TBS-T Abcam, Cambridge, UK
LIMK1 rabbit 3842 1:1,000 5% BSA TBS-T Cell Signalling Technology,
Dan-vers, USA
p53 rabbit 9282 1:1,000 5% BSA TBS-T Cell Signalling Technology,
Dan-vers, USA
PCNA rabbit ab19167 1:1,000 5% BSA TBS-T Abcam, Cambridge, UK
PUMA rabbit 12450 1:1,000 5% BSA TBS-T Cell Signalling Technology,
Dan-vers, USA
VRK3 rabbit 3260 1:1,000 5% BSA TBS-T Cell Signalling Technology,
Dan-vers, USA
IgG2a (aRTK2758) rat ab18450 3.6 μg per 4.5 μg beads Abcam, Cambridge, UK (iso type ctrl)
mouse IgG HRP sheep NXA931 1:10,000 5% BSA TBS-T GE Healthcare Chicago, USA rabbit IgG HRP donkey NA934V 1:10,000 5% BSA TBS-T GE Healthcare Chicago, USA rat IgG HRP goat sc-2032 1:10,000 5% BSA TBS-T Santa Cruz, Dallas, USA
30 2| Materials and Methods
2.6. Oligonucleotides
2.6.1. Primer
MiRNAs were detected using miScript Precursor Assays. Used primers are listed in table 2.9:
Conventional primers used for qRT-PCR or conventional PCR are listed in table 2.10:
Table 2.10.: Primer
pri-miR-23a rev AGC TAA GCC CTG CTC CTC AG pri-miR-23b fw AGCTGAGGAAGATGCTCAC pri-miR-23b rev ACCAATCACTGTTCACCAATC
SLAMF7 fw CAGAGAGCAATATGGCTGGTTCC
SLAMF7 rev GCTGCTGACCCTGTGAGCTG