7. MATERIALS AND METHODS
7.18 Buffers and Media
7.18.3 Buffer for bacterial lysis, extraction and Ni-NTA purification
Lysis buffer
Tris-HCl 20 mM
EDTA 1 mM
PMSF 1 mM
lysozyme 100 µg/ml
1 protease inhibitor tablet (for 50 ml) pH 8, 4°C
106
glutathione, oxidized 0.3 mM
glutathione, reduced 1 mM
pH 8, 4°C
CuSO4 refolding buffer
Tris-HCl 50 mM
CuSO4 40 µM
N-lauroylsarcosine sodium salt 2%
pH 8, 4°C
DsbC refolding buffer
Tris-HCl 20 mM
L-arginine 500 mM
glutathione, oxidized 0.3 mM
glutathione, reduced 1 mM
2-fold DsbC (relating to the concentration of protein to refold)
pH 8, 4°C
7.18.5 Other buffers for different applications
PBS
Materials and Methods
7.18.6 Buffers for cell culture
Cell culture lysis buffer
potassium phosphate dibasic, pH 7.8 100 mM Triton X-100 0.2 % (v/v)
coenzyme A trilithium salt 270 µM luciferin potassium salt
ONPG solution dissolved in Z buffer 4 mg/ml stored at -20°C
108 2x HBS
NaCl 280 mM
KCl 10 mM
Na2HPO4 1.5 mM
glucose 12 mM
HEPES 50 mM
pH 6.95
109
110
8. Sequences
WT-EPO (cloned in pET11a, with point mutation G C(*))
NdeI
CATATGGCACCGCCTCGTCTGATTTGTGATAGCCGTGTTCTGGAACGTTATC TGCTGGAAGCAAAAGAAGCCGAAAATATTACCACCGGTTGTGCAGAACATTGT AGCCTGAATGAAAACATTACAGTGCCGGATACCAAAGTGAATTTTTATGCCTGG AAACGTATGGAAGTTGGTCAGCAGGCAGTTGAAGTTTGGCAGGGTCTGGCACT GCTGAGCGAAGCAGTTCTGCGTGGTCAGGCACTGCTGGTTAATAGCAGCCAG CCGTGGGAACCGCTGCAGCTGCATGTTGATAAAGCAGTTAGCGGTCTGCGTAG CCTGACCACCCTGCTGCGTGCACTGC*GTGCCCAGAAAGAAGCAATTTCTCCG CCTGATGCAGCATCTGCAGCACCGCTGCGTACCATTACCGCAGATACCTTTCG TAAACTGTTTCGCGTGTATAGCAATTTTCTGCGTGGCAAACTGAAACTGTATAC CGGTGAAGCATGTCGTACCGGTGATCGTCATCACCATCATCATCATTAAGGATC C
BamHI
WT-EPO (cloned into pET11a)
NdeI
CATATGGCACCGCCTCGTCTGATTTGTGATAGCCGTGTTCTGGAACGTTATC TGCTGGAAGCAAAAGAAGCCGAAAATATTACCACCGGTTGTGCAGAACATTGT AGCCTGAATGAAAACATTACAGTGCCGGATACCAAAGTGAATTTTTATGCCTGG AAACGTATGGAAGTTGGTCAGCAGGCAGTTGAAGTTTGGCAGGGTCTGGCACT GCTGAGCGAAGCAGTTCTGCGTGGTCAGGCACTGCTGGTTAATAGCAGCCAG CCGTGGGAACCGCTGCAGCTGCATGTTGATAAAGCAGTTAGCGGTCTGCGTAG CCTGACCACCCTGCTGCGTGCACTGCGTGCCCAGAAAGAAGCAATTTCTCCGC CTGATGCAGCATCTGCAGCACCGCTGCGTACCATTACCGCAGATACCTTTCGT AAACTGTTTCGCGTGTATAGCAATTTTCTGCGTGGCAAACTGAAACTGTATACC GGTGAAGCATGTCGTACCGGTGATCGTCATCACCATCATCATCATTAAGGATCC
BamHI
Sequences
111
T7 RNA polymerase (cloned intp pET11a with NcoI and EcoRI)
ATGCAGCTGATCGGCAAACTGATCATAAAAATCGGCCAGAACATCACAGCTT
112
DSB-K-EPO (cloned in pET11a, with point mutation G C(*))
NdeI
CATATGGCACCGCCTCGTCTGATTTGTGATAGCCGTGTTCTGGAACGTTATC TGCTGGAAGCAAAAGAAGCCGAAAAAATCACCACCGGTTATGCAGAACATTATA GCCTGAATGAGAAAATCACCGTTCCGGATACCAAAGTGAACTTTTATGCATGGA
Sequences
1Pro-EPO (cloned in pET11a, with point mutation G C(*))
NdeI
IleRS (cloned in pET11a with HindIII and EcoRI)
ATGAGTGACTATAAATCAACCCTGAATTTGCCGGAAACAGGGTTCCCGATGC
114
Sequences
ValRS (cloned in pET11a with ClaI and EcoRI)
ATGGAAAAGACATATAACCCACAAGATATCGAACAGCCGCTTTACGAGCACT
116
Sequences
118 K-EPO126TAG (cloned in pET11a)
NdeI
CATATGGCACCGCCTCGTCTGATTTGTGATAGCCGTGTTCTGGAACGTTATC TGCTGGAAGCAAAAGAAGCCGAAAAAATCACCACCGGTTGTGCAGAACATTGT AGCCTGAATGAGAAAATCACCGTTCCGGATACCAAAGTGAACTTTTATGCATGG AAACGTATGGAAGTTGGTCAGCAGGCAGTTGAAGTTTGGCAGGGTCTGGCACT GCTGAGCGAAGCAGTTCTGCGTGGTCAGGCCCTGCTGGTTAAAAGCAGCCAG CCGTGGGAACCGCTGCAACTGCATGTTGATAAAGCAGTTAGCGGTCTGCGTAG TCTGACCACCCTGCTGCGTGCACTGGGTGCACAGAAAGAAGCAATTAGCAATT CAGATGCAGCATAGGCAGCACCGCTGCGTACCATTACCGCAGATACCTTTCGT AAACTGTTTCGCGTGTATAGCAATTTCCTGCGTGGTAAACTGAAACTGTATACC GGTGAAGCATGTCGTACCGGTGATCGTCATCATCATCACCATCATTAAGGATCC
BamHI
K-EPO24/38/83TAG (cloned in pET11a)
NdeI
CATATGGCACCGCCTCGTCTGATTTGTGATAGCCGTGTTCTGGAACGTTATC TGCTGGAAGCAAAAGAAGCAGAATAGATTACCACCGGTTGTGCAGAACATTGT AGCCTGAATGAATAGATCACCGTTCCGGATACCAAAGTGAACTTTTATGCATGG AAACGTATGGAAGTTGGTCAGCAGGCAGTTGAAGTTTGGCAGGGTCTGGCACT GCTGAGCGAAGCAGTTCTGCGTGGTCAGGCCCTGCTGGTTTAGAGCAGCCAG CCGTGGGAACCGCTGCAACTGCATGTTGATAAAGCAGTTAGCGGTCTGCGTAG TCTGACCACCCTGCTGCGTGCACTGGGTGCACAGAAAGAAGCAATTAGCAATT CAGATGCAGCAAGCGCAGCACCGCTGCGTACCATTACCGCAGATACCTTTCGT AAACTGTTTCGCGTGTATAGCAATTTCCTGCGTGGTAAACTGAAACTGTATACC GGTGAAGCATGTCGTACCGGTGATCGTCATCATCATCACCATCATTAAGGATCC
BamHI
119
120
9. References
[1] aB. Yin, Y. Gao, C. Y. Chung, S. Yang, E. Blake, M. C. Stuczynski, J. Tang, H. F.
Kildegaard, M. R. Andersen, H. Zhang, M. J. Betenbaugh, Biotechnology and bioengineering 2015, 112, 2343-2351; bP. Wang, S. Dong, J. A. Brailsford, K. Iyer, S. D. Townsend, Q. Zhang, R. C. Hendrickson, J. Shieh, M. A. Moore, S. J.
Danishefsky, Angewandte Chemie 2012, 51, 11576-11584; cY. Kagawa, S.
Takasaki, J. Utsumi, K. Hosoi, H. Shimizu, N. Kochibe, A. Kobata, The Journal of biological chemistry 1988, 263, 17508-17515.
[2] aH. Staudinger, J. Meyer, Helv Chim Acta 1919, 2, 635-646; bR. Serwa, I.
Wilkening, G. Del Signore, M. Muhlberg, I. Claussnitzer, C. Weise, M. Gerrits, C. P.
Hackenberger, Angewandte Chemie 2009, 48, 8234-8239.
[3] J. W. Chin, Annual review of biochemistry 2014, 83, 379-408.
[4] P. Russell, iGenetics, 3rd ed., 2010.
[5] C. D. Spicer, B. G. Davis, Nature communications 2014, 5, 4740.
[6] H. F. Bunn, Cold Spring Harbor perspectives in medicine 2013, 3, a011619.
[7] E. Hoffmann, K. Streichert, N. Nischan, C. Seitz, T. Brunner, S. Schwagerus, C. P.
Hackenberger, M. Rubini, Molecular bioSystems 2016.
[8] aS. B. Krantz, Blood 1991, 77, 419-434; bM. J. Koury, M. C. Bondurant,
Transfusion 1990, 30, 673-674; cJ. L. Spivak, T. Pham, M. Isaacs, W. D. Hankins, Blood 1991, 77, 1228-1233.
[9] aP. H. Lai, R. Everett, F. F. Wang, T. Arakawa, E. Goldwasser, The Journal of biological chemistry 1986, 261, 3116-3121; bJ. K. Browne, A. M. Cohen, J. C.
Egrie, P. H. Lai, F. K. Lin, T. Strickland, E. Watson, N. Stebbing, Cold Spring Harbor symposia on quantitative biology 1986, 51 Pt 1, 693-702.
[10] K. Jacobs, C. Shoemaker, R. Rudersdorf, S. D. Neill, R. J. Kaufman, A. Mufson, J.
Seehra, S. S. Jones, R. Hewick, E. F. Fritsch, et al., Nature 1985, 313, 806-810.
[11] aS. Elliott, T. Lorenzini, S. Asher, K. Aoki, D. Brankow, L. Buck, L. Busse, D. Chang, J. Fuller, J. Grant, N. Hernday, M. Hokum, S. Hu, A. Knudten, N. Levin, R.
Komorowski, F. Martin, R. Navarro, T. Osslund, G. Rogers, N. Rogers, G. Trail, J.
Egrie, Nature biotechnology 2003, 21, 414-421; bE. Goldwasser, C. K. Kung, J.
Eliason, The Journal of biological chemistry 1974, 249, 4202-4206.
[12] J. C. Cheetham, D. M. Smith, K. H. Aoki, J. L. Stevenson, T. J. Hoeffel, R. S. Syed, J.
Egrie, T. S. Harvey, Nature structural biology 1998, 5, 861-866.
[13] aW. Jelkmann, Transfusion medicine and hemotherapy : offizielles Organ der Deutschen Gesellschaft fur Transfusionsmedizin und Immunhamatologie 2013, 40, 302-309; bV. H. Haase, American journal of physiology. Renal physiology 2010, 299, F1-13.
[14] O. Livnah, E. A. Stura, S. A. Middleton, D. L. Johnson, L. K. Jolliffe, I. A. Wilson, Science 1999, 283, 987-990.
[15] S. Elliott, A. M. Sinclair, Biologics : targets & therapy 2012, 6, 163-189.
[16] A. W. Gross, H. F. Lodish, The Journal of biological chemistry 2006, 281, 2024-2032.
[17] J. S. Philo, K. H. Aoki, T. Arakawa, L. O. Narhi, J. Wen, Biochemistry 1996, 35, 1681-1691.
[18] R. Apweiler, H. Hermjakob, N. Sharon, Biochimica et biophysica acta 1999, 1473, 4-8.
References
121
[19] R. D. Cummings, Molecular bioSystems 2009, 5, 1087-1104.
[20] J. Hoseki, R. Ushioda, K. Nagata, Journal of biochemistry 2010, 147, 19-25.
[21] aA. Varki, Glycobiology 1993, 3, 97-130; bK. W. Moremen, M. Tiemeyer, A. V.
Nairn, Nature reviews. Molecular cell biology 2012, 13, 448-462.
[22] A. V. Nairn, W. S. York, K. Harris, E. M. Hall, J. M. Pierce, K. W. Moremen, The Journal of biological chemistry 2008, 283, 17298-17313.
[23] R. G. Spiro, Glycobiology 2002, 12, 43R-56R.
[24] aM. Takeuchi, N. Inoue, T. W. Strickland, M. Kubota, M. Wada, R. Shimizu, S.
Hoshi, H. Kozutsumi, S. Takasaki, A. Kobata, Proceedings of the National
Academy of Sciences of the United States of America 1989, 86, 7819-7822; bC. T.
Yuen, P. L. Storring, R. J. Tiplady, M. Izquierdo, R. Wait, C. K. Gee, P. Gerson, P.
Lloyd, J. A. Cremata, British journal of haematology 2003, 121, 511-526.
[25] aZ. Kiss, S. Elliott, K. Jedynasty, V. Tesar, J. Szegedi, European journal of clinical pharmacology 2010, 66, 331-340; bJ. C. Egrie, J. K. Browne, Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association 2001, 16 Suppl 3, 3-13.
[26] S. Elliott, J. Egrie, J. Browne, T. Lorenzini, L. Busse, N. Rogers, I. Ponting, Experimental hematology 2004, 32, 1146-1155.
[27] D. W. Briggs, J. W. Fisher, W. J. George, The American journal of physiology 1974, 227, 1385-1388.
[28] S. Dube, J. W. Fisher, J. S. Powell, The Journal of biological chemistry 1988, 263, 17516-17521.
[29] L. O. Narhi, T. Arakawa, K. H. Aoki, R. Elmore, M. F. Rohde, T. Boone, T. W.
Strickland, The Journal of biological chemistry 1991, 266, 23022-23026.
[30] M. Higuchi, M. Oh-eda, H. Kuboniwa, K. Tomonoh, Y. Shimonaka, N. Ochi, The Journal of biological chemistry 1992, 267, 7703-7709.
[31] W. Jelkmann, American journal of hematology 2010, 85, 771-780.
[32] M. Beranova, R. Wasserbauer, D. Vancurova, M. Stifter, J. Ocenaskova, M. Mara, Biomaterials 1990, 11, 521-524.
[33] aW. M. Deen, M. P. Bohrer, B. M. Brenner, Kidney international 1979, 16, 353-365; bB. M. Brenner, T. H. Hostetter, H. D. Humes, The American journal of physiology 1978, 234, F455-460.
[34] J. M. Harris, R. B. Chess, Nature reviews. Drug discovery 2003, 2, 214-221.
[35] C. Monfardini, O. Schiavon, P. Caliceti, M. Morpurgo, J. M. Harris, F. M. Veronese, Bioconjugate chemistry 1995, 6, 62-69.
[36] L. S. Lee, C. Conover, C. Shi, M. Whitlow, D. Filpula, Bioconjugate chemistry 1999, 10, 973-981.
[37] J. M. Harris, N. E. Martin, M. Modi, Clinical pharmacokinetics 2001, 40, 539-551.
[38] A. W. Richter, E. Akerblom, International archives of allergy and applied immunology 1983, 70, 124-131.
[39] aT. L. Cheng, P. Y. Wu, M. F. Wu, J. W. Chern, S. R. Roffler, Bioconjugate chemistry 1999, 10, 520-528; bA. Abuchowski, T. van Es, N. C. Palczuk, F. F. Davis, The Journal of biological chemistry 1977, 252, 3578-3581.
[40] F. M. Veronese, P. Caliceti, O. Schiavon, J Bioact Compat Pol 1997, 12, 196-207.
[41] G. Pasut, F. M. Veronese, Journal of controlled release : official journal of the Controlled Release Society 2012, 161, 461-472.
[42] F. H. Crick, Symposia of the Society for Experimental Biology 1958, 12, 138-163.
[43] P. C. Zamecnik, 1960, 54.
[44] T. A. Steitz, Nature reviews. Molecular cell biology 2008, 9, 242-253.
[45] P. D. a. Schimmel, Protein synthesis and ribosome structure, Wiley-VCH, 2004.
[46] M. M., Multi-AARS complexes, Landes Biosciences, Georgetown, TX, 2003.
[47] H. T. M., Regulation of Aminoacyl-tRNA Synthetase gene expression in bacteria, Landes Biosciences, Georgetown, TX, 2003.
[48] P. J. Beuning, K. Musier-Forsyth, Biopolymers 1999, 52, 1-28.
122
[49] T. L. H. a. P. Schimmel, Transfer RNA-dependent amino acid discrimination by aminoacyl-tRNA syntheses, Landes Biosciences, Georgetown, TX, 2003.
[50] aA. R. Fersht, The Royal Society 1981, 212; bA. R. Fersht, J. S. Shindler, W. C. Tsui, Biochemistry 1980, 19, 5520-5524.
[51] L. S. J.M. Berg, J.L. Tymoczko, Stryer Biochemie, Vol. 7, Springer Spektrum, Springer Spektrum, 2013.
[52] A. B. Shtarov, P. J. Krusic, B. E. Smart, W. R. Dolbier, Jr., Journal of the American Chemical Society 2001, 123, 9956-9962.
[53] B. C. Buer, E. N. Marsh, Protein science : a publication of the Protein Society 2012, 21, 453-462.
[54] aS. Purser, P. R. Moore, S. Swallow, V. Gouverneur, Chemical Society reviews 2008, 37, 320-330; bA. Vulpetti, C. Dalvit, Drug discovery today 2012, 17, 890-897.
[55] aM. Salwiczek, E. K. Nyakatura, U. I. Gerling, S. Ye, B. Koksch, Chemical Society reviews 2012, 41, 2135-2171; bR. Saladino, G. Botta, M. Crucianelli, Mini reviews in medicinal chemistry 2012, 12, 277-300; cT. L. March, M. R. Johnston, P. J.
Duggan, J. Gardiner, Chemistry & biodiversity 2012, 9, 2410-2441.
[56] U. I. M. Gerling, M. Salwiczek, C. D. Cadicamo, H. Erdbrink, C. Czekelius, S. L.
Grage, P. Wadhwani, A. S. Ulrich, M. Behrends, G. Haufe, B. Koksch, Chem Sci 2014, 5, 819-830.
[57] aL. M. Gottler, R. de la Salud-Bea, E. N. Marsh, Biochemistry 2008, 47, 4484-4490; bK. H. Lee, H. Y. Lee, M. M. Slutsky, J. T. Anderson, E. N. Marsh, Biochemistry 2004, 43, 16277-16284; cB. C. Buer, B. J. Levin, E. N. Marsh,
Journal of the American Chemical Society 2012, 134, 13027-13034; dB. C. Buer, J.
L. Meagher, J. A. Stuckey, E. N. Marsh, Proceedings of the National Academy of Sciences of the United States of America 2012, 109, 4810-4815.
[58] aS. S. Pendley, Y. B. Yu, T. E. Cheatham, 3rd, Proteins 2009, 74, 612-629; bD.
Roderer, R. Glockshuber, M. Rubini, Chembiochem : a European journal of chemical biology 2015, 16, 2162-2166; cM. Rubini, M. A. Scharer, G. Capitani, R.
Glockshuber, Chembiochem : a European journal of chemical biology 2013, 14, 1053-1057.
[59] N. Budisa, C. Minks, S. Alefelder, W. Wenger, F. Dong, L. Moroder, R. Huber, FASEB journal : official publication of the Federation of American Societies for Experimental Biology 1999, 13, 41-51.
[60] Y. Tang, D. A. Tirrell, Journal of the American Chemical Society 2001, 123, 11089-11090.
[61] P. Kast, H. Hennecke, Journal of molecular biology 1991, 222, 99-124.
[62] aK. Wang, W. H. Schmied, J. W. Chin, Angewandte Chemie 2012, 51, 2288-2297;
bJ. C. Anderson, T. J. Magliery, P. G. Schultz, Chemistry & biology 2002, 9, 237-244.
[63] J. Xie, P. G. Schultz, Methods 2005, 36, 227-238.
[64] aH. Neumann, S. Y. Peak-Chew, J. W. Chin, Nature chemical biology 2008, 4, 232-234; bS. M. Hancock, R. Uprety, A. Deiters, J. W. Chin, Journal of the American Chemical Society 2010, 132, 14819-14824; cT. Mukai, T. Kobayashi, N. Hino, T.
Yanagisawa, K. Sakamoto, S. Yokoyama, Biochemical and biophysical research communications 2008, 371, 818-822; dP. R. Chen, D. Groff, J. Guo, W. Ou, S.
Cellitti, B. H. Geierstanger, P. G. Schultz, Angewandte Chemie 2009, 48, 4052-4055; eA. Gautier, D. P. Nguyen, H. Lusic, W. An, A. Deiters, J. W. Chin, Journal of the American Chemical Society 2010, 132, 4086-4088; fA. Bianco, F. M.
Townsley, S. Greiss, K. Lang, J. W. Chin, Nature chemical biology 2012, 8, 748-750; gS. Greiss, J. W. Chin, Journal of the American Chemical Society 2011, 133, 14196-14199.
[65] aJ. W. Chin, T. A. Cropp, J. C. Anderson, M. Mukherji, Z. Zhang, P. G. Schultz, Science 2003, 301, 964-967; bJ. W. Chin, T. A. Cropp, S. Chu, E. Meggers, P. G.
Schultz, Chemistry & biology 2003, 10, 511-519; cN. Wu, A. Deiters, T. A. Cropp,
References
123
D. King, P. G. Schultz, Journal of the American Chemical Society 2004, 126, 14306-14307; dH. Edwards, P. Schimmel, Molecular and cellular biology 1990, 10, 1633-1641; eH. Edwards, V. Trezeguet, P. Schimmel, Proceedings of the National Academy of Sciences of the United States of America 1991, 88, 1153-1156; fV. Trezeguet, H. Edwards, P. Schimmel, Molecular and cellular biology 1991, 11, 2744-2751; gK. Sakamoto, A. Hayashi, A. Sakamoto, D. Kiga, H.
Nakayama, A. Soma, T. Kobayashi, M. Kitabatake, K. Takio, K. Saito, M. Shirouzu, I. Hirao, S. Yokoyama, Nucleic acids research 2002, 30, 4692-4699; hW. Liu, A.
Brock, S. Chen, S. Chen, P. G. Schultz, Nature methods 2007, 4, 239-244.
[66] C. T. Walsh, S. Garneau-Tsodikova, G. J. Gatto, Jr., Angewandte Chemie 2005, 44, 7342-7372.
[67] M. W. G. Crankshaw, G. A., Modification of Cysteine, Wiley, 1996.
[68] J. M. Chalker, G. J. Bernardes, Y. A. Lin, B. G. Davis, Chemistry, an Asian journal 2009, 4, 630-640.
[69] D. R. Goddard, L. Michaelis, Journal of Biological Chemistry 1935, 112, 361-371.
[70] E. M. Sletten, C. R. Bertozzi, Angewandte Chemie 2009, 48, 6974-6998.
[71] M. L. Smith, J. A. Lindbo, S. Dillard-Telm, P. M. Brosio, A. B. Lasnik, A. A.
McCormick, L. V. Nguyen, K. E. Palmer, Virology 2006, 348, 475-488.
[72] S. Kalkhof, A. Sinz, Analytical and bioanalytical chemistry 2008, 392, 305-312.
[73] T. Nakamura, Y. Kawai, N. Kitamoto, T. Osawa, Y. Kato, Chemical research in toxicology 2009, 22, 536-542.
[74] N. Jentoft, D. G. Dearborn, The Journal of biological chemistry 1979, 254, 4359-4365.
[75] aM. Schnolzer, S. B. Kent, Science 1992, 256, 221-225; bP. E. Dawson, T. W. Muir, I. Clark-Lewis, S. B. Kent, Science 1994, 266, 776-779; cS. B. Kent, Chemical Society reviews 2009, 38, 338-351.
[76] aC. W. Tornoe, C. Christensen, M. Meldal, The Journal of organic chemistry 2002, 67, 3057-3064; bV. V. Rostovtsev, L. G. Green, V. V. Fokin, K. B. Sharpless, Angewandte Chemie 2002, 41, 2596-2599.
[77] Q. Wang, T. R. Chan, R. Hilgraf, V. V. Fokin, K. B. Sharpless, M. G. Finn, Journal of the American Chemical Society 2003, 125, 3192-3193.
[78] aD. C. Dieterich, A. J. Link, J. Graumann, D. A. Tirrell, E. M. Schuman, Proceedings of the National Academy of Sciences of the United States of America 2006, 103, 9482-9487; bA. J. Link, D. A. Tirrell, Journal of the American Chemical Society 2003, 125, 11164-11165; cA. J. Link, M. K. Vink, D. A. Tirrell, Journal of the American Chemical Society 2004, 126, 10598-10602; dA. Deiters, T. A. Cropp, D.
Summerer, M. Mukherji, P. G. Schultz, Bioorganic & medicinal chemistry letters 2004, 14, 5743-5745; eS. I. van Kasteren, H. B. Kramer, D. P. Gamblin, B. G.
Davis, Nature protocols 2007, 2, 3185-3194; fS. I. van Kasteren, H. B. Kramer, H.
H. Jensen, S. J. Campbell, J. Kirkpatrick, N. J. Oldham, D. C. Anthony, B. G. Davis, Nature 2007, 446, 1105-1109.
[79] aD. C. Kennedy, C. S. McKay, M. C. Legault, D. C. Danielson, J. A. Blake, A. F.
Pegoraro, A. Stolow, Z. Mester, J. P. Pezacki, Journal of the American Chemical Society 2011, 133, 17993-18001; bA. J. Link, M. K. Vink, N. J. Agard, J. A.
Prescher, C. R. Bertozzi, D. A. Tirrell, Proceedings of the National Academy of Sciences of the United States of America 2006, 103, 10180-10185.
[80] N. J. Agard, J. A. Prescher, C. R. Bertozzi, Journal of the American Chemical Society 2004, 126, 15046-15047.
[81] T. Plass, S. Milles, C. Koehler, C. Schultz, E. A. Lemke, Angewandte Chemie 2011, 50, 3878-3881.
[82] aP. V. Chang, J. A. Prescher, E. M. Sletten, J. M. Baskin, I. A. Miller, N. J. Agard, A.
Lo, C. R. Bertozzi, Proceedings of the National Academy of Sciences of the United States of America 2010, 107, 1821-1826; bM. Lo Conte, S. Staderini, A. Marra, M.
Sanchez-Navarro, B. G. Davis, A. Dondoni, Chemical communications 2011, 47, 11086-11088.
124
[83] E. Saxon, C. R. Bertozzi, Science 2000, 287, 2007-2010.
[84] aJ. A. Prescher, D. H. Dube, C. R. Bertozzi, Nature 2004, 430, 873-877; bG. A.
Lemieux, C. L. De Graffenried, C. R. Bertozzi, Journal of the American Chemical Society 2003, 125, 4708-4709; cW. Szymanski, B. Wu, C. Poloni, D. B. Janssen, B.
L. Feringa, Angewandte Chemie 2013, 52, 2068-2072.
[85] B. L. Nilsson, L. L. Kiessling, R. T. Raines, Organic letters 2000, 2, 1939-1941.
[86] E. Saxon, J. I. Armstrong, C. R. Bertozzi, Organic letters 2000, 2, 2141-2143.
[87] aN. Nischan, C. P. Hackenberger, The Journal of organic chemistry 2014, 79, 10727-10733; bR. Serwa, P. Majkut, B. Horstmann, J. M. Swiecicki, M. Gerrits, E.
Krause, C. P. R. Hackenberger, Chem Sci 2010, 1, 596-602; cR. A. Serwa, J. M.
Swiecicki, D. Homann, C. P. Hackenberger, Journal of peptide science : an official publication of the European Peptide Society 2010, 16, 563-567; dP. Majkut, V.
Bohrsch, R. Serwa, M. Gerrits, C. P. Hackenberger, Methods in molecular biology 2012, 794, 241-249.
[88] N. Nischan, A. Chakrabarti, R. A. Serwa, P. H. Bovee-Geurts, R. Brock, C. P.
Hackenberger, Angewandte Chemie 2013, 52, 11920-11924.
[89] J. W. Chin, S. W. Santoro, A. B. Martin, D. S. King, L. Wang, P. G. Schultz, Journal of the American Chemical Society 2002, 124, 9026-9027.
[90] M. Hamann, University of Konstanz 2010.
[91] E. J. Milner-White, L. H. Bell, P. H. Maccallum, Journal of molecular biology 1992, 228, 725-734.
[92] aL. O. Narhi, T. Arakawa, K. Aoki, J. Wen, S. Elliott, T. Boone, J. Cheetham, Protein engineering 2001, 14, 135-140; bR. S. Syed, S. W. Reid, C. Li, J. C. Cheetham, K. H.
Aoki, B. Liu, H. Zhan, T. D. Osslund, A. J. Chirino, J. Zhang, J. Finer-Moore, S.
Elliott, K. Sitney, B. A. Katz, D. J. Matthews, J. J. Wendoloski, J. Egrie, R. M. Stroud, Nature 1998, 395, 511-516.
[93] S. Elliott, T. Lorenzini, D. Chang, J. Barzilay, E. Delorme, Blood 1997, 89, 493-502.
[94] D. R. Wycuff, K. S. Matthews, Analytical biochemistry 2000, 277, 67-73.
[95] J. P. Boissel, W. R. Lee, S. R. Presnell, F. E. Cohen, H. F. Bunn, The Journal of biological chemistry 1993, 268, 15983-15993.
[96] H. S. Chan, S. Bromberg, K. A. Dill, Philosophical transactions of the Royal Society of London. Series B, Biological sciences 1995, 348, 61-70.
[97] P. Widder, niversity of Konstanz
[98] P. Wang, A. Fichera, K. Kumar, D. A. Tirrell, Angewandte Chemie 2004, 43, 3664-3666.
[99] aC. Jackel, M. Salwiczek, B. Koksch, Angewandte Chemie 2006, 45, 4198-4203;
bM. Salwiczek, B. Koksch, Chembiochem : a European journal of chemical biology 2009, 10, 2867-2870; cB. Bilgicer, A. Fichera, K. Kumar, Journal of the American Chemical Society 2001, 123, 4393-4399; dB. Bilgicer, X. Xing, K. Kumar, Journal of the American Chemical Society 2001, 123, 11815-11816; eM. A. Molski, J. L.
Goodman, C. J. Craig, H. Meng, K. Kumar, A. Schepartz, Journal of the American Chemical Society 2010, 132, 3658-3659; fL. M. Gottler, H. Y. Lee, C. E. Shelburne, A. Ramamoorthy, E. N. Marsh, Chembiochem : a European journal of chemical biology 2008, 9, 370-373; gL. Merkel, N. Budisa, Organic & biomolecular chemistry 2012, 10, 7241-7261.
[100] aH. P. Chiu, R. P. Cheng, Organic letters 2007, 9, 5517-5520; bH. P. Chiu, Y.
Suzuki, D. Gullickson, R. Ahmad, B. Kokona, R. Fairman, R. P. Cheng, Journal of the American Chemical Society 2006, 128, 15556-15557.
[101] P. Caliceti, F. M. Veronese, Advanced drug delivery reviews 2003, 55, 1261-1277.
[102] I. C. Macdougall, Current hematology reports 2005, 4, 436-440.
[103] aL. Liu, H. Li, S. R. Hamilton, S. Gomathinayagam, W. J. Rayfield, M. van Maanen, K. C. Yin, L. Hong, T. Prueksaritanont, Journal of pharmaceutical sciences 2012, 101, 4414-4418; bY. J. Wang, S. J. Hao, Y. D. Liu, T. Hu, G. F. Zhang, X. Zhang, Q. S.
Qi, G. H. Ma, Z. G. Su, Journal of controlled release : official journal of the
References
125
Controlled Release Society 2010, 145, 306-313; cJ. H. Nett, S. Gomathinayagam, S. R. Hamilton, B. Gong, R. C. Davidson, M. Du, D. Hopkins, T. Mitchell, M. R.
Mallem, A. Nylen, S. S. Shaikh, N. Sharkey, G. C. Barnard, V. Copeland, L. Liu, R.
Evers, Y. Li, P. M. Gray, R. B. Lingham, D. Visco, G. Forrest, J. DeMartino, T.
Linden, T. I. Potgieter, S. Wildt, T. A. Stadheim, M. d'Anjou, H. Li, N. Sethuraman, Journal of biotechnology 2012, 157, 198-206; dK. Jolling, J. J. Ruixo, A. Hemeryck, V. Piotrovskij, T. Greway, Journal of pharmaceutical sciences 2004, 93, 3027-3038; eY. J. Wang, Y. D. Liu, J. Chen, S. J. Hao, T. Hu, G. H. Ma, Z. G. Su,
International journal of pharmaceutics 2010, 386, 156-164.
[104] aD. L. Long, D. H. Doherty, S. P. Eisenberg, D. J. Smith, M. S. Rosendahl, K. R.
Christensen, D. P. Edwards, E. A. Chlipala, G. N. Cox, Experimental hematology 2006, 34, 697-704; bR. A. Cohan, A. Madadkar-Sobhani, H. Khanahmad, F.
Roohvand, M. R. Aghasadeghi, M. H. Hedayati, Z. Barghi, M. S. Ardestani, D. N.
Inanlou, D. Norouzian, International journal of nanomedicine 2011, 6, 1217-1227.
[105] V. Gaberc-Porekar, I. Zore, B. Podobnik, V. Menart, Current opinion in drug discovery & development 2008, 11, 242-250.
[106] J. V. Staros, H. Bayley, D. N. Standring, J. R. Knowles, Biochemical and biophysical research communications 1978, 80, 568-572.
[107] N. J. Greenfield, Nature protocols 2006, 1, 2527-2535.
[108] L. Karl, University of Konstanz 2015.
[109] G. R. Nakayama, M. C. Caton, M. P. Nova, Z. Parandoosh, Journal of immunological methods 1997, 204, 205-208.
[110] J. O'Brien, I. Wilson, T. Orton, F. Pognan, European journal of biochemistry / FEBS 2000, 267, 5421-5426.
[111] aS. Y. Chen, S. Cressman, F. Mao, H. Shao, D. W. Low, H. S. Beilan, E. N. Cagle, M.
Carnevali, V. Gueriguian, P. J. Keogh, H. Porter, S. M. Stratton, M. C. Wiedeke, L.
Savatski, J. W. Adamson, C. E. Bozzini, A. Kung, S. B. Kent, J. A. Bradburne, G. G.
Kochendoerfer, Chemistry & biology 2005, 12, 371-383; bG. G. Kochendoerfer, S.
Y. Chen, F. Mao, S. Cressman, S. Traviglia, H. Shao, C. L. Hunter, D. W. Low, E. N.
Cagle, M. Carnevali, V. Gueriguian, P. J. Keogh, H. Porter, S. M. Stratton, M. C.
Wiedeke, J. Wilken, J. Tang, J. J. Levy, L. P. Miranda, M. M. Crnogorac, S. Kalbag, P.
Botti, J. Schindler-Horvat, L. Savatski, J. W. Adamson, A. Kung, S. B. Kent, J. A.
Bradburne, Science 2003, 299, 884-887.
[112] aX. Zhang, R. Goncalves, D. M. Mosser, Current protocols in immunology / edited by John E. Coligan ... [et al.] 2008, Chapter 14, Unit 14 11; bA. M. Kruisbeek, Current protocols in immunology / edited by John E. Coligan ... [et al.] 2001, Chapter 3, Unit 3 1; cV. S. Gallicchio, M. J. Murphy, Jr., Experimental hematology 1979, 7, 219-224.
[113] aM. E. Giorgi, R. Agusti, R. M. de Lederkremer, Beilstein journal of organic chemistry 2014, 10, 1433-1444; bB. Byrne, G. G. Donohoe, R. O'Kennedy, Drug discovery today 2007, 12, 319-326.
[114] D. Rosner, T. Schneider, D. Schneider, M. Scheffner, A. Marx, Nature protocols 2015, 10, 1594-1611.
[115] H. Zhan, B. Liu, S. W. Reid, K. H. Aoki, C. Li, R. S. Syed, C. Karkaria, G. Koe, K.
Sitney, K. Hayenga, F. Mistry, L. Savel, M. Dreyer, B. A. Katz, J. Schreurs, D. J.
Matthews, J. C. Cheetham, J. Egrie, L. B. Giebel, R. M. Stroud, Protein engineering 1999, 12, 505-513.
[116] R. Peist, A. Koch, P. Bolek, S. Sewitz, T. Kolbus, W. Boos, Journal of bacteriology 1997, 179, 7679-7686.
126
10. List of Abbreviations
°C degree Celsius μl microlitre μg microgram μM micromol
10x tenfold concentrated
A Adenine
aa amino acid
aaRS aminoacyl tRNA synthetase ACS Amber Stop codon suppression Amp ampicillin
Asn Asparagine
APS ammonium persulfate
BCIP 5-bromo-4-chloro-3-indolyl phosphate BFU-E Burst-forming unit- erythroid
bp base pairs
BSA bovine serum albumin c concentration
C Cytosine
Cam chloramphenicol Carb carbenicillin CD Circular dichroism CHO Chinese hamster ovary
List of Abbreviations
127 CFU-E Colony-forming unit-erythroid Cys Cysteine
Cu Cooper Da dalton
DNA deoxyribonucleic acid DTT dithiotreitol
DSB Disulfide bridge E. coli Escherichia coli
EC Effective concentration
EDTA ethylenediaminetetra acetic acid EPO Erythropoietin
EPOR Erythropoietin receptor eq equivalent
F Fluor, fluoro- Fuc Fucose g gram
G Guanine
Gal Galactose
GalNAc N-acetylgalactosamine Glc Glucose
GlcA glucuronic acid GlcNAc N-acetylglucosamine Gln Glysine
hr hours
His-tag poly-histidine affinity tag HIF Hypoxia-inducible factor
128
HPLC high-performance liquid chromatography IdoA Iduronic acid
IleRS Isoleucyl-tRNA synthetase
IPTG isopropyl-β-D-1-thiogalactopyranoside
K Lysine
Kan kanamycin kDa kilo dalton l litre
LB Luria-Bertani Lys Lysine
M molar, [mol / l], Protein marker
MALDI Matrix-associated laser desorption/ ionization Man Mannose
mdeg milidegree Mg Magnesium mg milligram min minutes ml millilitre
mRNA messenger ribonucleic acid mM milimolar
MS mass spectrometry NCL native chemical ligation NBT nitro blue tetrazolium Ni-NTA Nickel-nitrilotriacetic acid nm nanometer
NMR nuclear magnetic resonance
List of Abbreviations
129 OD optical density
PAGE poly-acrylamide gel electrophoresis pAzF para-azido phenylalanine
PBS phosphate buffered saline PCR polymerase chain reaction PEG Poly ethylene glycol Pro Proline
R Phenylalanine rpm rotations per minute RT room temperature rh recombinant human SA Sialic acid
SDS sodium dodecyl sulphate sec seconds
Ser Serine
SPI selective pressure incorporation SPR Staudinger Phosphite Reaction
T Thymine
TBE Tris-Borate-EDTA
TCEP Tris(2-carboxyethyl)phosphine TEMED Tetramethylethylenediamine Thr Threonine
Tris Tris-(hydroxymethyl)aminoethane tRNA transfer ribonucleic acid
TOF Time of flight
TyrRS Thyrosyl-tRNA synthetase
130 V volt, volume
ValRS Valyl-tRNA synthetase wt wild-type
Xyl Xylose