Bisulfite treatment

Bisulfite treatment of genomic DNA converts non-methylated cytosines into uracil whereas methylated cytosines (indicated as “CH3” in the figures) remain unchanged (fig. 27).

Figure 27: Conversion of cytosine molecules by bisulfite

Non-methylated cytosines within single stranded DNA are converted into uracil whereas

GGGACGAGCAGAGCGGGGACCGTGTGTCCGC5' 3'

CH3 CH3 CH3 CH3

Isolated, digested and denatured

GGGACGAGUAGAGCGGGGAUCGTGTGTUCGU 3'

5'

CH3

CH3 CH3 CH3

GGGACGAGCAGAGCGGGGACCGTGTGTCCGC5' 3'

CH3 CH3 CH3 CH3

GGGACGAGCAGAGCGGGGACCGTGTGTCCGC5' 3'

CH3

CH3 CHCH33 CHCH33 CHCH33

Isolated, digested and denatured

GGGACGAGUAGAGCGGGGAUCGTGTGTUCGU 3'

3.8.3.1 Preparation of solutions

Bisulfite treatment was performed using a modified protocol from HAJKOVA et al. (2002b). Chemical solutions and liquid agarose to form single beads were freshly prepared for each experimental replicate. A special set of micropipettes was exclusively used for bisulfite sequencing, solutions were prepared in a separate room and all potential sources of contamination were avoided. These precautions were crucial for the success of the method. Different solutions were necessary to perform the bisulfite treatment:

2.5 M bisulfite (pH 5) Hydroquinon

2 M NaOH

2% LMP agarose Heavy mineral oil

At first, 1.9 g of sodium disulphide (Na2S2O5) were filled into a 50 ml Greiner tube and 55 mg of hydroquinon (C6H6O2) were filled into a 2 ml safelock® tube. The tubes were immediately wrapped with aluminum foil to keep the chemicals in the dark because of light sensitivity. 2 g of NaOH was placed in a second 50 ml Greiner tube and 20 mg of low melting agarose was placed in a 2 ml safelock® tube.

All solutions were prepared in a separate extra clean room. The 2 M NaOH solution was first prepared by adding 25 ml of sterile water to the NaOH followed by vortexing until complete dissolution. Next, 2.5 ml of sterile water was transferred to the sodium disulphide and mixed with 750 µl of the freshly prepared NaOH solution.

A total of 500 µl sterile water was added to the hydroquinon and vortexed. Both, the bisulfite and the hydroquinon solution were incubated in a 50°C water bath until the chemicals were dissolved. During the entire bisulfite treatment both solutions were kept in the dark. The hydroquinon solution was vortexed after ~15 minutes of incubation to obtain complete dissolution. When both, the bisulfite and the hydroquinon solution were dissolved, hydroquinon was centrifuged and transferred to the bisulfite solution. Based on our experience, it cannot be recommended to put hydroquinon alone on ice because it crystallizes and cannot be used. The solutions

LMP agarose was dissolved by adding 1 ml of sterile water and incubation in a boiling water bath for 10 minutes followed by transfer to a 50°C water bath. For each DNA sample prepared for bisulfite treatment, one 2 ml safelock® tube was filled with 1 ml of heavy mineral oil and kept on ice.

3.8.3.2 Embedding DNA into agarose beads

Genomic DNA was incubated for a further 10 minutes at 98°C in the hot lid PTC-200 thermocycler immediately after digestion with suitable restriction enzymes.

The high temperature induced separation of the double stranded genomic DNA into single strands. Only cytosine nucleotides from single stranded DNA molecules are targets for the bisulfite solution and can be converted. The tubes were centrifuged following denaturation of the double stranded DNA, which minimizes the risk of losing DNA by opening the tubes prior to the addition of 0.8 µl of the 2 M NaOH solution.

The samples were mixed gently and centrifuged before embedding in agarose.

Adding NaOH to the denatured genomic DNA keeps the DNA molecules single stranded even at room temperature.

To produce agarose beads, it was necessary to handle the samples individually, to work quickly so that the bead formed before the agarose became solid, to hold the agarose constantly in the 50°C water bath and to be sure that the tubes containing the mineral oil were ice-cold. Seven µl of 50°C warm LMP agarose were transferred to one DNA sample and mixed by pipetting the DNA-agarose solution up and down avoiding air bubbles, which complicate production of the beads. Pipettes were changed from a 20 µl to a 100 µl and the DNA-agarose solution was transferred to the ice-cold mineral oil forming one bead. The tube was immediately put on ice. It is recommended to adjust the pipette to 15 µl although the volume of the DNA-agarose solution was only 11.6 µl since warm solutions tend to expand. It seemed crucial that the tubes were maintained on ice after formation of beads. Otherwise, the beads did not remain compact during bisulfite incubation.

3.8.3.3 Bisulfite incubation

Ice-cold 800 µl bisulfite/hydroquinon solution was transferred to the 2 ml tubes containing the agarose beads under mineral oil. The tubes were returned to ice and were covered with aluminum to avoid light damage. After 30 minutes on ice, the tubes were transferred to the 50°C water bath wrapped in aluminum foil. Bisulfite treatment was performed for four hours at 50°C.

3.8.3.4 Washing procedure

After four hours of bisulfite treatment, the mineral oil and the bisulfite/hydroquinon solution were replaced by 1 ml of 1xTris/EDTA buffer (TE buffer, pH 8) and removed by four washing steps. Between each step, the beads were incubated for 15 minutes in 1xTE buffer. Meanwhile, a 0.4 M NaOH solution was prepared using the 2 M NaOH solution as template. The beads were incubated twice in 500 µl of the 0.4 M NaOH solution to achieve desulphonation within a period of 20 minutes. The NaOH solution was removed from the beads and the beads were washed twice in 1 ml of 1xTE buffer followed by three further washing steps in sterile water with 15 minutes incubation between each step. The beads were incubated after the first washing step in sterile water overnight at 4°C to remove EDTA, which can inhibit the PCR reaction. The washing procedure was continued the next day prior to transfer of the beads into the PCR reaction.