Barcoded kaposi's sarcoma-associated herpesvirus molecules

In the first method, organic dyes are used for tagging the DNA molecules. Organic fluorophores are not as bright and photostable as the quantum dots but are smaller. Their small size will not limit the high density labeling and have a weaker effect on the physiological activity of their biological targets. However, the largest possible number of fluorophores is not used, since such dyes are prone for self-quenching at high densities.¹⁴ DNA molecules are fluorescently labeled at specific sequence locations with sequence-dependent color tags to create an optical pattern resembling a barcode. This unique barcode allows for identifying the DNA fragment.

Barcoding protocol

Kaposi's sarcoma-associated herpesvirus is a herpesvirus, and has a large double-stranded DNA virus. KSHV has a genome of about 150 Kbp in length. This virus which exists as a circular piece. This molecule has several terminal repeat units (each 801 base pair in length).

Knowing the sequence of the repeat units, we designed complimentary site probes for those repeat units to barcode the DNA with fluorophores (AT647 and Cy5, eurogins Genomics).

Because phototoxicity and the light scattering are reduced at long wavelengths, fluorophores with excitation/emission maxima in the near infrared are preferred for live-cell imaging.¹⁴ We designed two different probes, which their sequences are the complementary sites of those repeat unit terminals. The probes contain a fluorophore for visualization (used as barcodes on those specific binding sites). Based on the molecule map in Figure 4.12., TR probes (containing ATTO dye) have the complimentary sequences of the repeat units which are repeated 40 times, and DR4 probes (containing Cy5 dye) are the complimentary of 2 repeat units.

Figure 4.12. Linearized KSHV molecule with the terminal repeat units (each 801 bp). We selected the repeat units, which are repeated 2 times and also 40 times. The designed probes contain the complementary sequences of these repeat units.

9 µL of circular viral genome KSHV containing Bacmid constructs with the concentration of 340 ng/uL is cleaved by PacI restriction enzyme to obtain a linearized molecule. The recognition sequence by this restriction enzyme is 5′-TTAATTAA-3′. Then, 1 µL of DNA was diluted in 4 µL of 1x M-MuLV Reverse Transcriptase reaction buffer supplemented with 1 µL of dNTPs, 1 µL of H₂O, 12 µL of the labeled probes and a mixture of unlabeled random 6-14mer oligonucleotides (details in Table 4.2).

Table 4.2. The mixture reaction vial for barcoding of the KSHV molecules. The probes with fluorophore, and random oligonucleotides are hybridized on their complimentary site of the single stranded molecule to make a barcoded double stranded DNA molecule.

Sequence element Probe to label (5’) Number

of bases

Number of repeat units

DR4 CTGAGGGCTCGCAGTTTCACACAGAAGTTC 30 2

TR CGCCCTCTCTCTACTGTGCGAGGAGTCTG 29 40

Quantity Elements

1 µL 340 ng/µL circular DNA

2 µL random 6

2 µL random 8

2 µL random 10

2 µL random 12

2 µL random 14

1 µL DR4 with Cy5 fluorophore 1 µL TR with ATTO 647 fluorophore

4 µL Buffer M/MuLV

1 µL enzyme

1 µL dNTP

1 µL H₂O

Dilution should prevent rehybridization after the denaturation. The mixture was denatured at 95°C for 5 minutes in a thermocycler, and incubated at 60°C for 30 seconds to allow the probes to bind their complementary sites (Figure 4.13). Subsequently the reaction was set to 37°C for 10 minutes to allow the random oligonucleotides to bind. Digestion enzyme M-MuLV RT (Cat-600084-51) was added to fill in the gaps between the probes and the random oligomers. This enzyme does not have an exonuclease activity. This step should result in mainly double stranded DNA with the single strand nicks, which should be suitable to prevent the rehybridization of the virus genome and the formation of partially hybridized aggregates. To remove the unbound probes and the oligonucleotides, the reaction mixture of 80 µL of TE is added, following by centrifuging at 12200 with steps of 2 minutes, 5 minutes, 5 minutes and then 10 minutes respectively, with 500 µL of TE. The last purification is done using Microcon filter device (Millipore).

Figure 4.13. Schematics of barcoding KSHV-DNA molecules at its terminal repeat units (each 801 base pairs). TR probes (containing AT647 dye) are the complimentary sites of the 40 terminal repeat units and, DR4 probes (containing Cy5 dye) are complimentary sites of the 2 repeat units. (a) circular viral genome is linearized by a restriction enzyme (PacI). (b) the linearized DNA, the mixture of reaction buffer, the designed probes, and the unlabeled random oligonucleotides for hybridization process is denatured at 95°C for 5 minutes. Double stranded DNA becomes two single stranded. (c) an incubation process at 60°C for 30 seconds allows binding of the probes to their complimentary sequences (sites) on the single stranded DNA. (d) adding another enzyme at 37°C for 10 minutes allows binding of the random oligonucleotides. (e) adding the digestion enzyme fills the gaps in between the probes and random oligomers. This process results in a double stranded DNA molecule. (f) cleaning and purification process: removing the unbound probes and oligonucleotides by centrifuging and using filter devices.

We will stain the backbone of the DNA molecules with intercalating dyes to confirm the presence of the DNA while measuring in real time. Since TOTO-3 has a high affinity of the double stranded DNA, we intentionally created the double stranded at the end of the barcoding process.

Detection of photolum inescence signal of the barcoded D N A

After barcoding a deterministic optical pattern along the molecule, the DNA molecules are stretched out to identify the position of those patterns on the genome. The backbone of double stranded KSHV-DNA molecule is counterstained with the bis-intercalator TOTO-3, which is served as the reference to confirm the presence of the molecule and avoid fake signals. It also shows the beginning and end of the molecule, i.e. length of the molecule.

Increasing the PL intensity signal from the noise level evidences the beginning of the molecule, and the intensity drops determines the end of the DNA molecule.

A 633 nm laser wavelength is selected to detect specific fluorophore tags of the intercalated DNA. The excitation and the emission wavelength of all fluorophores are in the range of the chosen laser wavelength (λex/λem of TOTO-3: 642 nm/660 nm, ATTO 647: 643 nm/664 nm, Cy5: 646 nm/673 nm). Once extended, the DNA molecule passed through a focused laser spot, and the emission wavelengths are read out in real time to visualize the barcode. This unique sequence-specific marks along the DNA are shown in Figure 4.14.

The base line shows the DNA molecule, and the intensity increase at specific locations along the signal evidences the presence of other fluorophores at those sites. This detected increase in the signal is in agreement with the expected locations.

Figure 4.14. Real time optical mapping of barcoded KSHV-DNA molecule. Individual fluorescently tagged DNA containing a barcode is electrophoretically driven into the nanochannel and stretched by physical confinement. The fluorescent tags and the backbone dyes of the DNA molecule is excited by a focused laser spot. (a) The photoluminescence signal is recorded as it passed through under the point light source in real time. (b) schematic of the expected barcode of the DNA molecule. (c) the smooth PL recorded signal along time. The presence of the molecule is confirmed by an increase and then drop in intensity profile signal along time. The distance between the sequence-specific markers is comparable with expected schematic in (b).

Usually, thermal (Brownian) fluctuations of the molecule that induce distortions of the barcode. However, since we measure the molecules in real time at high sensitivity, small features are not blurred out due to thermal fluctuation and diffusion. All the measurements have been performed at room temperature. Any knowledge concerning the exact location of a large scale mutation is still unknown when using this technique.

Using this technique, the detection of changes along the DNA molecules takes place only in the time frame of seconds to minutes instead of day(s) to weeks as in the conventional

sequencing techniques. This technique can reveal the preliminary results in a quick manner and facilitates in decision making for further analysis using more sophisticated, time consuming, and expensive techniques.