At5g24080 gene expression is inducible by abscisic acid

Expression of theAt5g24080 co-regulated MYB domain transcriptional factor genes MYB102 and MYB41 is known to be inducible by the phytohormone abscisic acid (ABA) (Denekamp and Smeekens, 2003; Kosma et al., 2014). In order to check whether At5g24080 and further genes from its co-regulon are ABA inducible, expression of the top 50At5g24080 co-regulated genes after ABA treatment was analysed in an in silico approach using publically available microarray data. Expression data after 10 µM ABA treatment was retrieved using the TRABAS web interface (Choudhury and Lahiri, 2008) as log2 fold change in expression. Indeed, 36 out of the top 50 ATTED II microarray database co-regulated genes and 28 out of the top 50 ATTED II RNAseq database co-regulated genes were more than 2.0 log2 fold induced at 3 h after 10 µM ABA (Table. S10 and S11).At5g24080 itself showed a log2 fold induction of 3.3 at 3 h after 10 µM ABA treatment (Table. S10 and S11, top row).

Next, theAt5g24080 promoter region was analysed for presence of ABA responsive cis-acting elements. For this purpose the 1.1 kb genomic DNA-sequence upstream of the At5g24080 start-codon was analysed using PlantCARE World Wide Web interface (Lescot et al., 2002). In the 1.1 kb promoter region of At5g24080, several TATA-box core promoter elements, CAAT-box cis-acting elements as well as light responsive elements were identified (Fig. 21 and Table 4). Most important, an ABA response element (ABRE) was found 151 bp upstream of the At5g24080 start-codon (Fig. 21 and Table 4). Molecular analyses of ABA responsive promoters demonstrated that the ABRE sequence alone is not sufficient for induction of gene expression. Instead, two or more ABRE or a combination of an ABRE with a coupling element (CE) is required for ABA responsiveness of a plant promoter (Shen and Ho, 1995; Shenet al., 1996; Hobo et al., 1999; Narusaka et al., 2003; Shen et al., 2004). In a microarray analysis, At5g24080 was identified among genes regulated by the ABA responsive transcription factor ABI4 (ABA INSENSITIVE 4) (Reeves et al., 2011). ABI4 binds the CE1 coupling element (Niu et al., 2002). Therefore, the At5g24080 promoter was analysed for presence of a CE1

2004). However, the ABI4 binding site CACCG differs slightly from the CE1 core sequence (Niuet al., 2002). Both, the CCACC and CACCG sequences were found as overlapping parts of one sequence element within the At5g24080 promoter and were localised 26 or 27 bp respectively downstream of the ABRE cis-acting element (Fig. 21 and Table 4).

5´-GAAGCGCAAAGAAACGAGATGAATCATGATTCAGAAGAAAAATAAACATATTGTAAGCACATAGAAGACTTCTGTCCACATCAGAAGGATG AAAAAAGATTTTTGACTAATACTCCTTCTGTATATTATATTTGATGTTTTAAGTTTTGGCAAACCGATATTATTTATTAACTATTTAAAACATA AGATTTAACTAATTGTAAAATTAATATGCAGAATATAAACTGTCAAAACCAATAAAAAAAAATCTATTTTAAAATAACTTTTTGTAATAAAAGA TCAAGTAATAAACAGAGAGAATATATACTATATATATATATATATATCGTGTTCAAAAAAAAAAAATCATTATATATATTTAGACAAAGGATTA GTCTAAAATATCTAATCTAATTGAGCTATGAACGGTTTAACATGCATGCACTAGTTCATTTATTTGTTATTTGCTTCATAAACAAGGATTGATC CAAATAATCCCTTCAAAATGAGTATAGTCGTCAAATAACTCATTCAATCGATTTTTCTAATGGATCTAAAATGATGTACCATTTTGGCTAGCCA AATAAAAATAGTTTGATGATTTCATTTAATTTGTTGCCATCATTTAAACTTTTGAATATGAAAAGAGTATGTAGAGTAATAGTAATGGGGAACG CATAAACATTAGTTGATTTGTGCTGATTTATGTTGATTTATGCGACACTATATTATCTTACGTACCATGAACACACATTTCACAAATTATAGAT CATATATTGGTGTGAAAAATAAAGTTAATTGTTACATCTTCGACTATAGCTGGAGTTTTCATCCTATTAAATATTAATAAAAAAATACAAAAAG GCACAAAACAGGTGCCGCCATATCCAATATATCCAACATCGTCAATTATTCAGAGCCGACCATTTACAAAAACGAAGACCTTTTGTGAAAATCT AGTTCAACCATAAAAACACGTGCCACAATCTCATTCTTCAGAGTTCTCCCACCGAACCATCTCTCTAAATGCGTTCAAATTATATAAGTGAGTG ATATATAAAGATTACTAAACCACATGGTATACCGATTTTTTAGCCTCATTCTCTTTTGTTACAAGATTCTACTATG...-3´

Figure 21. In silico prediction of cis-acting elements in the At5g24080 promoter region.1.1 kb upstream of the start-codon were analysed using PlantCARE World Wide Web interface (Lescot et al., 2002). CE1 element was annotated according to its consensus sequence (Niuet al., 2002; Shenet al., 2004). Cis-acting elements are color-coded as shown in Table 4.

Table 4. Predicted cis-acting elements in the At5g24080 promoter region.

Site name Position (5´ to 3´) Sequence Function

ABRE 953 (+), 953 (-) CACGTG involved in abscisic acid responsiveness CE1 985 (+) / 986 (+) CCACC/CACCG involved in abscisic acid responsiveness

ATCT-motif 381 (+) tATCTAATCT involved in light responsiveness

CAAT-Box 233 (+), 754 (-), 866 (+) CCAAT cis-acting element in promoter and enhancer regions

GATA-motif 179 (+) AAcATAAGATT part of a light responsive element

TATA-box* 1032 (-), 1058 (-) TATA core promoter element

Taken together in silico analyses suggest that the G-type LecRLK At5g24080 represents an ABA inducible gene and is co-regulated with a set of other ABA responsive genes.

Furthermore, At5g24080 promoter region contains an ABRE as well as a CE1 cis-acting element, which are sufficient for ABA dependent gene induction.

In order to test the results of the in silico analysis experimentally,At5g24080 expression after ABA treatment was analysed by semi-quantitative RT-PCR. In this analysis, 12-days-old Arabidopsis Col-0 seedlings were incubated for 3 h and 24 h in 50 µM ABA and At5g24080 transcript abundance analysed by semi-quantitative RT-PCR. Expression of the known ABA inducible geneRD29B (Yamaguchi-Shinozaki and Shinozaki, 1993) was monitored as a control for successful ABA treatment. Transcript levels of the positive control RD29B were increased after 3 h and 24 h in 50 µM ABA treated samples as compared to mock (Fig. 22, middle panel), suggesting that ABA was taken up by A. thaliana Col-0 seedlings. At5g24080 transcript abundance was strongly increased in ABA treated samples as compared to mock after 3 h and 24 h of 50 µM ABA application. At5g24080 transcript levels were higher after 24 h of 50 µM ABA application as compared to 3 h (Fig. 22, upper panel).

Figure 22. Semi-quantitative RT-PCR analysis of At5g24080 and RD29B expression in 12-days-old Arabidopsis Col-0 seedlings treated with 50 µM ABA. Pools of 20 seedlings per sample were used for RNA extraction. “+“ indicates samples collected from ABA treated plants, whereas “-“ represents the mock treated control. The housekeeping gene Actin was amplified as a control. A genomic DNA (gDNA) control was included to monitor potential contamination by gDNA. A reverse primer which binds two exon borders and spans an intron sequence was used in case of the Actin gene to exclude gDNA amplification. The Actin cDNA PCR product corresponds to 302 bp. Expected sizes ofAt5g24080 PCR products are 79 bp cDNA and 161 bp gDNA. Sizes of RD29BPCR products are 72 bp cDNA and 170 bp gDNA. The arrowhead indicatesAt5g24080 orRD29 cDNA bands respectively. The experiment was repeated twice with similar results.

Additionally to the semi-quantitative RT-PCR analysis, At5g24080 expression after ABA treatment was analysed by qPCR. Again, expression of RD29B was monitored as a positive control.At5g24080 transcript levels were increased ca. 530 fold after 3 h and ca. 930 fold after

bp

abundance of the positive controlRD29B was ca. 1000 fold increased after 3 h and ca. 2360 fold after 24 h of 50 µM ABA application as compared to mock (Fig. 23B).

In summary,in silico analyses of publically available microarray data indicated thatAt5g24080 represents an ABA inducible gene and that the majority of its co-regulated genes is also ABA responsive. Moreover, in silico promoter analysis demonstrated that At5g24080 contains an ABRE cis-acting element as well as a CE1 coupling element in its promoter sequence. A combination of ABRE and a coupling element is known to be sufficient for transcriptional induction of ABA dependent genes (Shen and Ho, 1995; Shen et al., 1996; Hobo et al., 1999;

Narusaka et al., 2003; Shen et al., 2004). Semi quantitative RT-PCR and qPCR analyses of At5g24080 expression after ABA treatment confirmed inducibility of this G-type LecRLK gene by abscisic acid. The results corroborate thatAt5g24080gene expression is ABA inducible.

Figure 23. qPCR analysis of At5g24080 and RD29B expression in 12-days-old Arabidopsis Col-0 seedlings treated with 50 µM ABA.Bars represent means of gene expression ± standard deviation in arbitrary units from n = 3 biological replicates (1 replicate = pool of 20 seedlings), normalized to the expression ofUBQ5. 3 h mock was set to 1 and relative expression was normalised to this sample. Three technical replicates for each biological replicate were analysed by qPCR. *P < 0.05 using Student’s t-test for pairwise comparison of mock and ABA treatment. The experiment was performed once (A) At5g24080 transcript abundance in mock and ABA treated Col-0 seedlings.(B) RD29B transcript abundance in mock and ABA treated Col-0 seedlings.