• Keine Ergebnisse gefunden

1. Study registries 2. PubMed 3. Cochrane Library 4. Livivo 5. Web of Science 6. Google Scholar 7. Google 8. Study websites 9. Reference lists*

N/A
N/A
Protected

Academic year: 2022

Aktie "1. Study registries 2. PubMed 3. Cochrane Library 4. Livivo 5. Web of Science 6. Google Scholar 7. Google 8. Study websites 9. Reference lists*"

Copied!
1
0
0

Wird geladen.... (Jetzt Volltext ansehen)

Volltext

(1)

Additional file 2: Sources where published articles were identified

Number of publications identified in biomedical databases and other sources by using an incremental search strategy from 1. to 9. * including PubMed tools “Similar articles“ and “Cited by“.

Of the 947 identified published journal articles, a great proportion (894; 94%) was identified in three sources only: the references of more than half (541; 57%) of the identified articles were reported in the study registries, additional 276 (29%) were found via PubMed, and a Google Scholar search revealed another 77 (8%) articles. The incremental benefit of the other databases was marginal. The remaining 53 articles were identified in the Cochrane Library (17), Livivo (3), via Google (10), Web of Science (10), study websites (4) and PubMed tools "Similar articles" and "Cited by" and reference lists (9).

It must be emphasized that the proportion of identified articles in each source strongly depends on the sequence the sources were searched, as the article was assigned to the source were it was found first.

1. Study registries 2. PubMed

3. Cochrane Library 4. Livivo

5. Web of Science 6. Google Scholar 7. Google 8. Study websites 9. Reference lists*

Referenzen

ÄHNLICHE DOKUMENTE

12, both Conveyor ‘‘On’’ and ‘‘Off’’ states of the THC exist under the same net freshwater flux, but under two distinct sets of conditions: (1) for the same (DF a , K q

PRV152 labels morphologically distinct retinal ganglion cell types 32 Common properties of local circuits of PRV152 labelled ganglion cells 37 Monostratified amacrine cells

To assess the involvement of TIMP3 in a variety of other macular dystrophies, the authors have screened this gene for disease-causing mutations in age-related macular

Lagenammina ampullacea (Brady, 1881) Placopsilina bradyi Cushman & McCulloch, 1939 Psammosphaera fusca Schulze, 1875.. Reophax agglutinatus Cushman, 1913 Reophax scorpiurus

GAGGGGGGCTTACCATGCAAGTCGAGCGGTAGCACAAGAGAGCTTGCTCTCTGGGTGACGAGCGGCGGACG

Our study on the robustness of Google Scholar delivers surprising results: It seems that Google Scholar is far easier to spam than the classic Google Search for web

1) What is the relationship between hegemonic practices of signification and political regimes? For example, how do the totalitarian, authoritarian and democratic hegemonic logic

Thus, in Stalinist photography, work is depicted with a markedly military and competitive character, and has no longer anything to do with the ideology of the work ethic