Title: Analytical and Clinical Performance of Droplet Digital PCR in the Detection and Quantification of SARS-CoV-2 Author: Kyoung Bo Kim, M.D.

(1)

Title: Analytical and Clinical Performance of Droplet Digital PCR in the Detection and Quantification of SARS-CoV-2

Author: Kyoung Bo Kim, M.D.^1,2, Hayoung Choi, B.S.², Gun Dong Lee, M.T.², Jaewoong Lee, M.D.^{2, 3}, Seungok Lee, M.D., Ph.D.^{2, 3}, Yonggoo Kim, M.D., Ph.D.^{2, 3}, Sung-Yeon Cho, M.D., Ph.D.^{4, 5}, Dong-Gun Lee, M.D., Ph.D.^4,

5, Myungshin Kim, M.D., Ph.D.^{2, 3}

Affiliation:

1. Department of Laboratory Medicine, Keimyung University School of Medicine, Daegu, Korea

2. Catholic Genetic Laboratory Center, Seoul St. Mary’s Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea

3. Department of Laboratory Medicine, College of Medicine, The Catholic University of Korea, Seoul, Korea 4. Division of Infectious Diseases, Department of Internal Medicine, College of Medicine, The Catholic University of Korea, Seoul, Republic of

5. Vaccine Bio Research Institute, College of Medicine, The Catholic University of Korea, Seoul, Korea

Corresponding Author:

Myungshin Kim

Department of Laboratory Medicine, Seoul St. Mary’s Hospital, College of Medicine, The Catholic University of Korea

222, Banpo-daero, Seocho-gu, Seoul, 06591, Republic of Korea Tel: +82 02-2258-1643

E-mail: microkim@catholic.ac.kr

(2)

Supplemental Materials

2. Method and materials 2.3 RT-qPCR for SARS-CoV-2

2.3.1 RNA extraction protocol

alphaPrep^TM Viral DNA/RNA Extraction Mini Kit (Cat. No. VID-C110, VID-C120, ALPHAGENE, Seongnam- si, Korea) with NC-15 PLUS instrument (Cat. No. HWTD-01-32, HWTD-01-48, HANWOOLTPC, Bucheon-si, Korea):

Before extraction of nucleic acids, the NC-15 PLUS instrument was turned on and 8-strip containing five reagents and magnetic beads was inserted to the magnetic bar in the instrument. One vial of proteinase K powder in the kit was dissolved by 1.05 mL of proteinase K buffer. And then, add 200 μL of sample and 20 μL of proteinase K was added to 1st or 7th well in the 96-well plate. After all samples were added, the plate was inserted in the instrument and RNA extraction was processed. When operation is finished, the plate was removed from instrument and then 80 μL of extracted nucleic acids (6th or 12th well) was transferred to the 1.5 mL tube.

AdvanSure^TM Nucleic Acid R kit with AdvanSure E3 System (Cat. No. YETS0001EG; Cat. No. YSTP0500KG (Strip), LG chem, Seoul, Korea):

A sample 200 μL was added to well on 1st, 5th or 9th row of 96 reactions reagent plate (Cat. No. RPE0001K01, LG chem). Proteinase K (Cat. No. RPK0001K01, LG chem) was voltexed for 10 seconds and spinned down, and then 20 μL was added to wells sample prepared. The reagent plate was inserted in the AdvanSure E3 System instrument and RNA extraction was processed. When operation is finished, the plate was removed from instrument and then 80-100 μL of extracted nucleic acids (4th, 8th or 12th well) was transferred to the 1.5 mL tube.

NX-48 Viral NA Kit (Cat. No. VN101, VN111, VN121, Genolution, Seoul, Korea) with Nextractor^® NX-48 (Cat.

No. NX-48, Genolution):

A sample was mixed well and cover on the plate was removed carefully before extraction. Each sample 200 μL was added to well on 1st, 5th or 9th row of 96 well plate. A strip was inserted to strip holder of the Nextractor^® NX-48 instrument, and the reagent plate was inserted in the instrument. And then RNA extraction was started.

When operation is finished, the plate was removed from instrument and then 60-80 μL of extracted nucleic acids (4th, 8th or 12th well) was transferred to the 1.5 mL tube.

(3)

2.3.2 RT-qPCR protocol

All four RT-qPCR was tested with CFX96 real-time PCR with a C1000 thermal cycler (Cat. No. 185-5096, Bio- Rad, Hercules, CA).

PowerChek^TM 2019-nCoV Real-time PCR Kit (Cat. No. R6900TD, KogeneBiotech, Seoul, Korea; PowerChek kit):

During all test runs, PowerChek™ RNA Process Control Kit (Cat No. IC0002, KogeneBiotech; RPC) was included from RNA extraction stage to amplification for validating correct RNA extraction process. Before amplification, PCR mixture (15.5 μL per sample) was prepared by mixing Primer/Probe Mix 1 (for E gene) or Primer/Probe Mix 2 (for RdRp gene) 4 μL, Primer/Probe Mix (for RPC) 0.5 μL and RT-PCR Premix 11 μL. No Template Control (NTC) and Negative Process Control (NPC) were made by adding 4.5 μL of nuclease-free water and extracted RNA from the RPC-spiked nuclease-free water and prepared to the negative sample wells. NTC and NPC wells were capped before processing. And then extracted RNAs from clinical samples were added to each well containing the reaction mixture. Positive Control (PC) was made by adding 1,000-fold diluted Control 1 or Control 2 (included in kit), which became 20 copies/μL of E gene or RdRp gene, and prepared to the wells for the positive control samples. Next, each well was closed, mixed and centrifuged. Amplification was performed according to manufacturer’s instrument manual by PCR protocol below: 50ºC for 30 minutes, 95ºC for 10 minutes, 94ºC for 15 seconds and 60ºC for 60 seconds repeated 40 cycles. Fluorescence was detected at 60°C.

The fluorescence curves were analyzed in the FAM (E gene or RdRP gene), JOE (or HEX, internal control; IC), and Cy5 (RPC) fluorescence detection by CFX Manager^TM Software v.3.1. Threshold for determining cycle of quantification (Cq) was set by manufacturer’s instruction: 100 for E gene and RdRp gene, 150 for IC and 200 for RPC. Interpretation criteria for control and patients was according to manufacturer’s instruction: Detected in case of Cq ≤ 37 for E gene or RdRp gene, or not detected; Detected in case of Cq ≤ 35 for RPC, or not detected; Detected in case of Cq ≤ 28 for IC, or not detected. The cases that RdRp gene with/without E gene detected was reported as “positive”. Limit of detection (LoD) established by manufacturer was 4 copies/μL for E gene and RdRp gene, respectively, with 95% positivity rate (based on raw specimen concentration, not extract state).

Allplex^TM 2019-nCoV Assay (Cat. No. RP10243X / RP10252W, Seegene, Seoul, Korea; Allplex kit):

During all test runs, 10 μL of Internal Control (RP-V IC) was added before the extraction to amplification for validating correct RNA extraction process. Before amplification, One-Step RT-PCR Mastermix (17 μL per sample) was prepared by mixing 2019-nCoV MOM (MuDT Oligo Mix; the brand name of manufacturer) 5 μL, RNase- free water 5 μL, 5X Real-time One-Step Buffer (containing dNTP) 5 μL and Real-time One-step Enzyme 2 μL.

Into PCR tubes 17 μL of Mastermix was aliquoted. And then 8 μL of the clinical sample RNA, PC and NC was added into the tubes containing aliquot of the Mastermix. Amplification was performed according to

(4)

manufacturer’s instrument manual by PCR protocol below: 50ºC for 20 minutes, 95ºC for 15 minutes, 94ºC for 15 seconds and 58ºC for 30 seconds repeated 45 cycles. Fluorescence was detected at 58°C.

The fluorescence curves were analyzed in the FAM (E gene), HEX (IC), Cal Red 610 (RdRp gene) and Quasar 670 (N gene) fluorescence detection by Seegene 2019-nCoV Viewer software v.3.20 (Seegene). Threshold for determining cycle of quantification (Cq) was set automatically by the software. Interpretation criteria for control and patients was according to manufacturer’s instruction: Detected in case of Cq ≤ 40 for each target, or not detected. The cases that three target genes were detected was reported as “positive”. The cases that one or two target genes were detected were reported as “indeterminate”. Limit of detection (LoD) established by manufacturer was 4.167 copies/μL for each target gene, respectively, with 95% positivity rate (based on raw specimen concentration, not extract state).

Real-Q 2019-nCoV Detection Kit (Cat. No. BS7nCoV, BioSewoom, Seoul, Korea; Real-Q kit):

Before amplification, PCR master mix (20 μL per sample) was prepared by mixing 2X PCR reaction mixture 12.5 μL, nCoV probe and primer mixture 3 μL, RT-PCR enzyme1 μL and DNase/RNase free water 3.5 μL. In real time PCR strip tubes or plate wells 20 μL of master mixture was aliquoted. And then 5 μL of the clinical sample RNA was added into each tube or well containing aliquot of the master mixture. Provided positive control (PC) 5 μL and free water 5 μL was added into PC well and negative control well. Next, each well was closed, mixed and centrifuged. Amplification was performed according to manufacturer’s instrument manual by PCR protocol below:

50ºC for 30 minutes, 95ºC for 15 minutes, 95ºC for 15 seconds and 62ºC for 45 seconds repeated 40 cycles.

Fluorescence was detected at 62°C.

The fluorescence curves were analyzed in the FAM (RdRP gene), HEX (E gene), and Cy5 (IC; human RNase P) fluorescence detection by CFX Manager^TM Software v.3.1. Threshold for determining cycle of quantification (Cq) was set by manufacturer’s instruction: 300 for E gene and RdRp gene and 200 for IC. The Cq of PC should be within 28±5, and Cq of NC should be negative for each target gene. Interpretation criteria for patients was according to manufacturer’s instruction: Detected in case of Cq ≤ 38 for E gene or RdRp gene, or not detected;

Detected in case of Cq ≤ 35 for IC, or not detected. The cases that RdRp gene with/without E gene detected was reported as “positive”. Limit of detection (LoD) established by manufacturer was 6.25 copies/μL for nasopharyngeal swab (NP swab) and 3.125 copies/μL for sputum, respectively, with 95% positivity rate (based on raw specimen concentration, not extract state).

STANDARD M nCoV Real-Time Detection kit (Cat. No. M-NCOV-01, SD BIOSENSOR, Suwon-si, Korea;

STANDARD M kit):

During all test runs, 5 μL of Internal Control (internal control A) was added before the extraction to amplification for validating correct RNA extraction process. Before amplification, PCR mixture (20 μL per sample) was prepared by mixing 2019-nCoV Reaction Solution 14 μL and reverse transcriptase mix 6 μL. Into PCR tubes 20 μL of PCR mixture was aliquoted. And then 10 μL of the clinical sample RNA, PC and NC was added into the

(5)

tubes containing aliquot of the PCR mixture. Amplification was performed according to manufacturer’s instrument manual by PCR protocol below: 50ºC for 15 minutes, 95ºC for 3 minutes, 95ºC for 5 seconds and 60ºC for 40 seconds repeated 5 cycles (pre-amplification, according to manufacturer), then 95ºC for 5 seconds and 60ºC for 40 seconds repeated 40 cycles (amplification, according to manufacturer). Fluorescence was detected at 60°C.

The fluorescence curves were analyzed in the FAM (RdRp gene), JOE/VIC/HEX (E gene) and Cy5 (IC) fluorescence detection by CFX Manager^TM Software v.3.1. Threshold for determining cycle of quantification (Cq) was not presented by manufacturer, so threshold was set at each institution by referring to experience using other kits. Interpretation criteria for control and patients was according to manufacturer’s instruction: Detected in case of Cq ≤ 36 for each target gene, or not detected. The cases that RdRp gene with/without E gene detected was reported as “positive”. Limit of detection (LoD) established by manufacturer was 0.25 copies/μL for NP swab and 0.125 copies/μL for sputum, respectively, with 95% positivity rate (based on raw specimen concentration, not extract state).

All remnant RNA extract samples after RT-qPCR test were stored in -70℃ before ddPCR test was performed.

2.4 ddPCR for SARS-CoV-2

2.4.1. ddPCR primers sequence

According to manufacturer’s instruction for use (IFU) of Bio-Rad SARS-CoV-2 ddPCR Kit (Cat. No. 12008202, Cat. No. 1864021, Cat. No. COV019 and Cat. No. COV000; Bio-Rad), the oligonucleotide primers and probes for detection of SARS-CoV-2 were the same as those reported by Center for Disease Control and Prevention (CDC) and were selected from regions of the virus nucleocapsid (N) gene, which was designed for specific detection of the SARS-CoV-2 (two primer/probe sets). An additional primer/probe set to detect the human RNase P gene (RP) in control samples and clinical specimens was also included in the panel. This kit included these three sets of primers into a single assay multiplex to enable a one-well reaction. The oligonucleotide sequences of primer set recommended by CDC were same as below (probe modification was not informed by manufacturer):

N1 forward (GACCCCAAAATCAGCGAAAT), reverse (TCTGGTTACTGCCAGTTGAATCTG) and probe (FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1); N2 forward (TTACAAACATTGGCCGCAAA), reverse (GCGCGACATTCCGAAGAA) and probe (FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1); RP forward (AGATTTGGACCTGCGAGCG), reverse (GAGCGGCTGTCTCCACAAGT) and probe (FAM- TTCTGACCTGAAGGCTCTGCGCG-BHQ-1).

2.4.2. ddPCR analysis and interpretation

The data analysis using QuantaSoft^TM Analysis Pro software (AP) was performed according to IFU. After opening .qlp file acquired from QX200 Droplet Reader in AP, in the Plate Editor tab, all the wells were selected and applied with Experiment type as Direct Quantification (DQ) and with Assay Information as Probe Mix Triplex.

(6)

Target information of each target (signal Ch1, signal Ch2) was set as follows: N1 (FAM, None); N2 (FAM, HEX);

RP (None, HEX). And then, in 2D amplitude plot tap showing droplets on graph with x-axis (channel 2, HEX) and y-axis (channel 1, FAM), eight clusters were assigned by fluorescence intensities as follows (Fig. S1): triple negative cluster, N1 cluster (single, intermediate positive of FAM channel), N2 cluster (weak positive of both FAM and HEX channel), RP cluster (single, intermediate positive of HEX channel), N1+N2 cluster (strong positive of FAM channel and weak positive of HEX channel), N1+RP cluster (intermediate positive of both FAM and HEX channel), N2+RP cluster (weak positive of FAM channel and strong positive of HEX channel) and triple positive cluster (strong positive of both FAM and HEX channel). Quantifications were provided as copies/μL of the final 1X ddPCR reaction volume for each of the targets (N1, N2 and RP). Threshold for assigning cluster was not determined as absolute scale or intensity due to variability of fluorescence intensities among samples, so cluster assignments were performed individually for each test.

(7)

Table S1. RNA extraction and RT-qPCR methods by institutions

Institution RNA extraction kit^†

Extraction instrument^a

Extraction input vol.

(μL)

Extraction output vol.

(μL)

n RT-qPCR kit^b RT-qPCR instrument

RT-qPCR template vol.

(μL)

RT-qPCR reaction vol.

(μL)

RT-qPCR target

gene

CMC1

alphaPrep^TM Viral DNA/RNA extraction mini Kit

NC15-PLUS 200 80

7 PowerChek

CFX96 real-time PCR with a C1000

4.5 20 RdRp, E

83 Allplex 8 25 RdRp, E,

N

115 Real-Q 5 25 RdRp, E

CMC2 AdvanSure

Nucleic Acid R kit

AdvanSure

E3 System 200 80-100

30 PowerChek

4.5 20

RdRp, E

4 STANDARD

M 10 20

CMC3 AdvanSure

Nucleic Acid R kit

AdvanSure

E3 System 200 80-100

17 PowerChek

4.5 20 RdRp, E

2 STANDARD

M 10 20 RdRp, E

SML NX-48 Viral NA Kit

Nextractor

NX-48 200 60-80 108 PowerChek CFX96 real-time

PCR with a C1000 4.5 20 RdRp, E

CMC1, Seoul St. Mary's hospital; CMC2, Incheon St. Mary's hospital; CMC3, Uijeongbu St. Mary's hospital; NP swab, Nasopharyngeal swab; RT-qPCR, reverse transcription real-time polymerase chain reaction; SML, Samkwang Medical Lab; vol., volume

aalphaPrepTM Viral DNA/RNA Extraction Mini Kit (Cat. No. VID-C110, VID-C120, ALPHAGENE), AdvanSureTM Nucleic Acid R kit (Cat. No. RPE0001K01 (reagent plate); Cat. No. RPK0001K01 (Proteinase K), LG chem), AdvanSure E3 System (Cat. No. YETS0001EG (Instrument); Cat. No. YSTP0500KG (Strip), LG chem), NC-15 PLUS instrument (Cat. No. HWTD-01-32, HWTD-01-48, HANWOOLTPC),

bPowerChek™ 2019-nCoV Real-time PCR Kit (KogeneBiotech, Seoul, Republic of Korea), Allplex™ 2019-nCoV Assay (Seegene, Seoul, Republic of Korea), STANDARD M nCoV Real-Time Detection kit (SD BIOSENSOR, Suwon-si, Gyeonggi-do, Republic of Korea), Real-Q 2019-nCoV Detection Kit (BioSewoom, Seoul, Republic of

(8)

Korea)

(9)

Table S2. Mean, SD and %CV of copy values of five serial dilutions measured to evaluate precision

Sample^a

N1 N2

Number of analyzed replicates^**

Mean (copies/μL)

SD (copies/μL)

%CV (%)

Number of analyzed replicates^**

Mean (copies/μL)

SD (copies/μL)

%CV (%)

Dilution (1:10) 8 36965.65 4714.3 12.75 8 29851.01 3580.09 11.99

Dilution (1:100) 10 7130.44 613.19 8.6 10 6187.18 741.6 11.99

Dilution (1:1,000) 9 708.33 31.63 4.47 9 614.29 55.9 9.1

Dilution (1:10,000) 10 70.06 11.17 15.94 9 57.97 11.81 20.38

Dilution (1:100,000) 8 6.53 0.8 12.26 10 5.38 2.09 38.84

SD, standard deviation; %CV, percent coefficient of variation

Each dilution was tested ten times, and then in each dilution group the results which were 1.5 interquartile range (IQR) above the third quartile or 1.5IQR below the first quartile were recognized as outliers and excluded

aUndiluted pooling sample was not tested adequate times due to shortage of sample volume, so was not analyzed

(10)

Table S3. Summary of sample with interpretation of RT-qPCR and ddPCR

ddPCR^a N1 N2

Pos Neg Pos Neg Pos Neg

RT- qPCR Result

All samples (n=366) Pos^b 169 4 160 13 165 8

Neg^b 63 130 26 167 50 143

Institution

CMC1 (n=205)

Pos^b 87 4 80 11 85 6

Neg^b 42 72 12 102 38 76

CMC2 (n=34)

Pos 4 0 4 0 4 0

Neg 13 17 11 19 7 23

CMC3 (n=19)

Pos 19 0 19 0 19 0

Neg - - - -

SML (n=108)

Pos 59 0 57 2 57 2

Neg 8 41 3 46 5 44

RT-qPCR kit^c

PowerChek (n=162)

Pos 82 1 79 4 80 3

Neg 21 58 14 65 12 67

Allplex (n=83)

Pos^b 74 2 68 8 72 4

Neg 6 1 6 1 6 1

STANDARD M (n=6)

Pos 6 0 6 0 6 0

Neg - - - -

Real-Q (n=115)

Pos 7 1 7 1 7 1

Neg 36 71 6 101 32 75

Target gene

RdRp (n=366)

Pos 164 3 158 9 160 7

Neg 68 131 28 171 55 144

E (n=366)

Pos 164 2 159 7 160 6

Neg 68 132 27 173 55 145

N^d (n=83)

Pos 73 1 68 6 71 3

Neg 7 2 6 3 7 2

CMC1, Seoul St. Mary's hospital; CMC2, Incheon St. Mary's hospital; CMC3, Uijeongbu St. Mary's hospital; Neg, Negative; Pos, Positive; RT-qPCR, reverse transcription quantitative real-time polymerase chain reaction; SML, Samkwang Medical Lab

(11)

addPCR was interpreted as positive when two or more positive droplets observed in either N1 or N2 region on droplet reader

bOf 16 RT-qPCR indeterminate samples, nine samples had one or two, but not three target gene Cq, and seven samples did not have Cq within positive criteria range

cPowerChek™ 2019-nCoV Real-time PCR Kit (KogeneBiotech, Seoul, Republic of Korea), Allplex™ 2019-nCoV Assay (Seegene, Seoul, Republic of Korea), STANDARD M nCoV Real-Time Detection kit (SD BIOSENSOR, Suwon-si, Gyeonggi-do, Republic of Korea), Real-Q 2019-nCoV Detection Kit (BioSewoom, Seoul, Republic of Korea)

dN gene was included as target in only Allplex RT-qPCR kit, so results tested by Allplex RT-qPCR kit were counted

(12)

Table S4. Analysis of discrepancy cases between RT-qPCR and ddPCR interpretation Cases of positive or indeterminate RT-qPCR result and negative ddPCR interpretation (n=4) Sample

number

Patient

number Institution

Sample type (before extraction)

RT-qPCR kit^a

RT-qPCR interpretation

Cq value Copy value

(copies/μL) Droplet count

RdRp E N N1 N2 N1 N2 Total

SC_130 SCMC117 CMC1 NP swab Real-Q pos 36 34.2 0.00 0.00 0 0 15429

SC_185 SCMC122 CMC1 EDTA Blood Allplex indeter 36.93 - - 0.00 0.44 0 1 10809

SC_193 SCMC123 CMC1 EDTA Blood Allplex indeter - - 38.8 0.00 0.36 0 1 13089

SC_205 SCMC127 CMC1 NP swab Real-Q pos 37.41 35.07 0.43 0.43 1 1 10959

Cases of negative RT-qPCR result and positive ddPCR interpretation (n=63) Sample

number

Patient

number Institution

RT-qPCR kit^a

COVID-19 related symptom^b

Later RT-qPCR Result^c

Copy value

(copies/μL) Droplet count N1 N2 N1 N2 Total

SC_015 SCMC015 CMC1 NP swab Real-Q none not tested 0.00 0.78 0 2 12137

SC_028 SCMC028 CMC1 NP swab Real-Q none neg (1 month later) 0.00 0.74 0 2 12686

SC_029 SCMC029 CMC1 NP swab Real-Q none neg (1 month later) 0.00 0.65 0 2 14469

SC_034 SCMC034 CMC1 NP swab Real-Q none neg (3 months later) 0.00 0.95 0 3 14916

SC_036 SCMC036 CMC1 NP swab Real-Q none nf 0.00 1.00 0 3 14108

SC_040 SCMC040 CMC1 NP swab Real-Q fever, myalgia nf 0.00 0.96 0 3 14763

SC_044 SCMC044 CMC1 NP swab Real-Q fever not tested 0.37 0.74 1 2 12783

SC_045 SCMC045 CMC1 NP swab Real-Q none neg (23 days later) 0.00 1.02 0 3 13829

(13)

Cases of negative RT-qPCR result and positive ddPCR interpretation (n=63) (cont'd) Sample

number

Patient

number Institution

RT-qPCR kit^a

COVID-19 related symptoms^b

Copy value

SC_057 SCMC057 CMC1 NP swab Real-Q fever neg (15 days later) 0.70 1.04 2 3 13513

SC_084 SCMC084 CMC1 NP swab Real-Q fever, myalgia nf 0.00 1.29 0 3 10917

SC_087 SCMC087 CMC1 NP swab Real-Q fever, diarrhea nf 0.00 1.21 0 3 11680

SC_088 SCMC088 CMC1 NP swab Real-Q fever, diarrhea not tested 0.74 0.00 2 0 12797

SC_092 SCMC092 CMC1 NP swab Real-Q vomiting not tested 0.00 0.89 0 2 10597

SC_093 SCMC093 CMC1 NP swab Real-Q fever neg (2 months later) 0.00 1.55 0 4 12149

SC_096 SCMC096 CMC1 NP swab Real-Q none, contact to a patient neg (25 days later) 0.00 1.68 0 4 11228 SC_097 SCMC097 CMC1 NP swab Real-Q none, contact to a patient neg (25 days later) 0.00 1.26 0 3 11217 SC_098 SCMC098 CMC1 NP swab Real-Q none, contact to a patient neg (25 days later) 0.00 0.81 0 2 11686

SC_105 SCMC105 CMC1 NP swab Real-Q fever neg (1 month later) 0.00 1.72 0 5 13669

SC_107 SCMC107 CMC1 NP swab Real-Q fever, headache nf 0.71 2.12 2 6 13304

SC_134 SCMC117 CMC1 Sputum Allplex confirmed case, follow up pos (same day)^d 1.23 1.54 4 5 15323 SC_137 SCMC117 CMC1 NP swab Allplex confirmed case, follow up pos (6 days later) 0.83 2.21 3 8 17061 SC_138 SCMC117 CMC1 NP swab Allplex confirmed case, follow up pos (4 days later) 1.58 5.52 6 21 17912 SC_139 SCMC117 CMC1 NP swab Allplex confirmed case, follow up pos (4 days later) 2.21 3.69 9 15 19148 SC_140 SCMC117 CMC1 Sputum Allplex confirmed case, follow up pos (4 days later) 1.32 3.42 5 13 17886

SC_157 SCMC119 CMC1 NP swab Allplex confirmed case, follow up nf 0.82 4.91 3 18 17264

(14)

Cases of negative RT-qPCR result and positive ddPCR interpretation (n=63) (cont'd) Sample

number

Patient

number Institution

RT-qPCR kit^a

COVID-19 related symptoms^b

Copy value

IC_004 ICMC004 CMC2 NP swab PowerChek none not tested 0.73 0.00 2 0 12918

IC_009 ICMC009 CMC2 NP swab PowerChek fever not tested 0.71 0.00 2 0 13182

IC_012 ICMC012 CMC2 NP swab PowerChek fever neg (5 days later) 0.92 1.23 3 4 15311

IC_018 ICMC018 CMC2 NP swab PowerChek cough, sore throat nf 0.72 0.00 2 0 13016

IC_019 ICMC019 CMC2 NP swab PowerChek sore throat not tested 0.78 1.16 2 3 12134

IC_021 ICMC021 CMC2 NP swab PowerChek fever, myalgia not tested 1.59 0.32 5 1 14795

IC_022 ICMC022 CMC2 NP swab PowerChek fever neg (2 months later) 0.70 1.05 2 3 13412

IC_029 ICMC029 CMC2 NP swab PowerChek cough nf 0.36 0.73 1 2 12957

SG_4818 SML002 SML NP swab PowerChek n/a n/a 3.08 0.38 8 1 12235

CMC1, Seoul St. Mary's hospital; CMC2, Incheon St. Mary's hospital; Indeter, indeterminate; n/a, not available; nf, not followed up; NP swab, nasopharyngeal swab; RT- qPCR, reverse transcription quantitative real-time polymerase chain reaction; ; SML, Samkwang Medical Lab

(15)

aPowerChek™ 2019-nCoV Real-time PCR Kit (KogeneBiotech, Seoul, Republic of Korea), Allplex™ 2019-nCoV Assay (Seegene, Seoul, Republic of Korea), STANDARD M nCoV Real-Time Detection kit (SD BIOSENSOR, Suwon-si, Gyeonggi-do, Republic of Korea), Real-Q 2019-nCoV Detection Kit (BioSewoom, Seoul, Republic of Korea)

bCOVID-19 related symptoms were defined according to WHO case definition [22].

cA patient history was accessible only in CMC1 and CMC2

dNP swab sample collected at same day showed positive result in both RT-qPCR and ddPCR

(16)

a. b.

c.

Fig. S1 2D amplitude plot of SARS-CoV-2 ddPCR assay. Channel 1 amplitude (y-axis) was fluorescence intensity of FAM, and channel 2 amplitude was fluorescence intensity of HEX. A plot of positive reference material (a) showed eight distinct clusters of single or mixed target amplification. Negative reference material (b) containing human RNase P showed RP positive cluster, and no template control (free-water) (c) showed no positive cluster.

(17)

Fig. S2 RT-qPCR/ddPCR discrepancy cases comparison with copy value of N1 and N2. The cases were classified to three groups by interpretation of RT-qPCR and

ddPCR, and the three groups were compared by Kruskal-Wallis test (all three group), Mann-Whitney U test (RT(+)/dd(-) and RT(-)/dd(+); RT(+)/dd(-) and RT(-)/dd(-)) and independent T-test (RT(-)/dd(+) and RT(-)/dd(-)). In each group N1 and N2 was described with gray and white box, respectively. The p-value is shown (N1/N2) with significant results marked with an asterisk

PN, RT-qPCR(+)/ddPCR(-); NP, RT-qPCR(-)/ddPCR(+); NN, RT-qPCR(-)/ddPCR(-)