Region-specific analysis of mitochondrial DNA deletions in neurodegenerative disorders in humans
qChristian Mawrin
a,*, Elmar Kirches
a, Guido Krause
a, Regine Schneider-Stock
b, Bernhard Bogerts
c, Christian K. Vorwerk
d, Knut Dietzmann
aaDepartment of Neuropathology, Otto-von-Guericke-University, Leipziger Strasse 44, D-39120 Magdeburg, Germany
bDepartment of Pathology, Otto-von-Guericke-University, Leipziger Strasse 44, D-39120 Magdeburg, Germany
cDepartment of Psychiatry, Otto-von-Guericke-University, Leipziger Strasse 44, D-39120 Magdeburg, Germany
dDepartment of Ophthalmology, Otto-von-Guericke-University, Leipziger Strasse 44, D-39120 Magdeburg, Germany Received 29 August 2003; received in revised form 24 October 2003; accepted 26 November 2003
Abstract
Mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) aberrations has been implicated in the neuronal death in neurodegenerative disorders. Significant neuronal damage can occur if the percentage of mtDNA mutations may reach a critical threshold.
mtDNA mutations also accumulate during normal aging. Here we quantified the 5 kB common mtDNA deletion (CD) usingreal-timePCR in various brain regions from neurodegenerative disorders and controls. We confirmed previous results that the CD levels increase with age, reaching highest levels in the basal ganglia. High CD levels were also found in affected regions in frontotemporal dementia, Parkinson’s disease, and dementia with Lewy bodies, but not in Alzheimer’s disease. This suggests that mtDNA damage may occur in a region-specific distribution in neurodegenerative disorders.
q2003 Elsevier Ireland Ltd. All rights reserved.
Keywords:Mitochondrial DNA; Neurodegeneration; Aging
Mitochondria are the most important intracellular source of reactive oxygen species (ROS), and they are protected against them by several antioxidants [15]. However, mitochondrial DNA (mtDNA) can be subject to severe oxidative damage, because it is located in close vicinity to the respiratory chain and is not protected by histones[1,2].
Although mitochondria do not completely lack DNA repair systems, mtDNA mutation frequency is higher than that of nuclear DNA [3,4,10]. If a certain threshold of mutant mtDNA is reached, this may cause a defect of oxidative phophorylation and ultimately cell death [6]. Although it may be discussed controversially, whether such mutations can reach sufficient levels within a neuron to generate severe OXPHOS deficiency and energy crisis, a burst of free
radicals may lead to cell death by other, yet unknown pathways.
In normal aging, as well as in neurodegenerative diseases, a variety of mtDNA mutations have been described, especially the so called ‘4977 bp common deletion (CD)’ [7,8]. A recent study reported multiple mtDNA deletions/rearrangements in the substantia nigra of patients with Parkinson’s disease (PD)[12]. Theses findings suggest that the mtDNA deletions, and hence the CD, may thus be viewed as a mitochondrial marker of oxidative stress.
However, regarding the fact that mtDNA deletions increase with normal aging, the evaluation of the exact level of such mutations is critical to evaluate the possible contribution to pathological cell death which occurs in neurodegenerative disorders, especially with regard to the regional distribution. We established a quantitative real- time PCR assay for the detection of the CD using frozen autopsy tissue, and screened various brain regions from patients affected by common neurodegenerative disorders.
Brain tissue for DNA isolation was obtained within 24 h
0304-3940/03/$ - see front matterq2003 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.neulet.2003.11.073
Neuroscience Letters 357 (2004) 111–114
www.elsevier.com/locate/neulet
qSupported in part by a start-up grant from the University of Magdeburg (to C.M.).
* Corresponding author. Tel.:þ49-391-671-5814; fax:þ49-391-671- 3300.
E-mail address: christian.mawrin@medizin.uni-magdeburg.de (C.
Mawrin).
after death (seeTable 1). The tissue was frozen in ice-cold isopentane and stored at 280 8C until further processing.
Neuropathological diagnoses were established using stan- dard investigations. DNA was prepared using a proteinase- K digest and the Spin-Tissue-Mini-kit (Invitek, Berlin, Germany) according to the manufacturers instructions.
DNA was eluted in a total volume of 50ml, five of which were used for subsequent PCR reactions. The breakpoint of the CD was amplified as a 350 bp fragment with the primers CCCCTCTAGAGCCCACTGTA (forward) and GAGTGC- TATAGGCGCTTGTC (reverse), while the reference region (hypervariable region 2, HVR2) was amplified as a 400 bp fragment with the primers CTCTCACCCTAT- TAACCACT (forward) and GTTAAAAGTGCA- TACCGCCA (reverse) in a Light-Cycler (Roche, Indianapolis, USA) using the SYBR Green method (DNA Master SYBR Green I, Roche), 56 8C annealing tempera- ture, 40 cycles and 2.5 mM MgCl2. HVR2 is a fragment of the mitochondrial control region, containing essential elements for mtDNA replication. It can thus be viewed as a reference fragment, representing the total amount of mtDNA in a tissue sample. Dilution series of plasmids containing the CD breakpoint and the HVR2 region were used to calibrate the quantification by the Light Cycler software. They were constructed from DNA of a patient with 50% CD in skeletal muscle and from blood samples (HVR2) using the PCR-Script Amp (SKþ) vector in Xl-1 blue cells (Stratagene, La Jolla, CA). Both dilution series spanned a range of 10,000-fold dilution in four decadic steps, resulting in standard curves (cycle number versus log concentration) of high linearity (r.0:98). After 40 PCR cycles a melting profile was generated by slowly melting the double stranded products during 10 min. The plot dF/dT versus T (velocity of fluorescence change versus tempera- ture) revealed a single peak for plasmids and tissue samples for both amplified regions, which was not present in controls containing only PCR premix without DNA. The ratio of CD copy numbers versus HVR2 copy numbers in the tissue DNA samples represented the fraction of mtDNA molecules harbouring the CD.
The clinico-pathological data of all cases are summar-
ized in Table 1. In all control cases, the presence of a previously unrecognized neurodegenerative disease was ruled out. The percentage of deleted mtDNA molecules (ratio CD/HVR2) was determined for each region. Because the basic levels of mtDNA deletions may vary between individuals, we also normalized the CD/HVR2 ratios by division through the ratio found in the cerebellum, where no age -or disease-related increase occurs[7].
It has been suggested that mtDNA deletions accumulate in the basal ganglia with ageing[7]. We confirmed that the amount of the CD was markedly raised with increasing age (Fig. 1). However, although both cases with an age below 40 years (cases nos. 1 and 8) demonstrated low CD levels, independent of the presence of a neurodegenerative disorder, it should be noted that a significant variation occurred between the CD levels in the remaining patients covering an age range from 54 to 84 years, with surprisingly low values in the case with the highest age. We also confirmed that the lowest CD levels in individual cases are found in the cerebellum, without any age-related increase [7].
Certain regions of the brain are preferentially affected in
Table 1
Clinicopathological data of diseased patients and controls Case Age
(years)
Sex Diagnosis Neurological symptoms Cause of death PMD
(hours)
Immunohistochemical features
1 33 M FTDþMND Dementia, mutism Pneumonia 6 Ubiquitin-positive neuronal inclusions
2 84 F AD Disorientation Pneumonia 22 Tau-positive neuronal inclusions
3 74 F DLB Dementia; visual hallucinations Cardiac failure 6 Ubiquitin-positive neuronal Lewy bodies
4 54 F PD Rigor, hypomimia Cardiac failure 19 Ubiquitin-positive neuronal Lewy bodies
5 54 M Co – Cardiac failure 18 NS
6 75 F Co – Ruptured aortal aneurism 13 NS
7 63 M Co – Hepatic cancer 14 NS
8 35 F Co – Pancreatitis 20 NS
M, male; F, female; FTDþMND, frontotemporal dementia with motor neuron disease-like inclusions; AD, Alzheimer’s disease; DLB, dementia with Lewy bodies; PD, Parkinson’s disease; PMD, post mortem delay; CO, control and NS, no specific immunohistochemical staining.
Fig. 1. Increase of mtDNA deletion levels (common deletion [CD]) with increasing age within the basal ganglia. Values represent the CD/HVR2 ratio.
C. Mawrin et al. / Neuroscience Letters 357 (2004) 111–114 112
a specific neurodegenerative disease. In our case suffering from fronto-temporal dementia with motor neuron disease- like inclusions (FTD-MND; case no. 1), we measured high CD/HVR2 ratios in the brain stem, where motor neuron disease-like ubiquitin inclusions were found with high density (Fig. 2A). Interestingly, the frontal and temporal lobe, both characterized by severe neuropathological changes, showed also high mtDNA deletion levels after normalization to the cerebellar values (Fig. 2B). The case with Lewy-body dementia (DLB) had very high CD levels in the occipital cortex, whereas the other brain regions showed no increase of the CD. Interestingly, besides dementia, visual hallucinations were the most prominent neurological symptom seen in this patient. In the cases with PD and Alzheimers’s disease (AD), no major increases were seen in the CD/HVR2 ratio. However, after normalization for the individual mtDNA deletion level in the cerebellum, an increase could be observed in the substantia nigra of the PD patient (Fig. 2B).
Although the contribution of mtDNA mutations to the process of neurodegeneration has been implicated in common disorders such as amyotrophic lateral sclerosis (ALS) and Parkinson’s disease [11,12], their role for the death of the neurons has not been defined so far. The evaluation of the significance of mtDNA mutations is
further complicated by the observation that their amount increases with increasing age [7], but the most common neurodegenerative disorders also affects older individuals.
In neurodegenerative disorders, we measured an increase of mtDNA mutations in some affected brain regions. In the FTD-MND case, the raised CD levels corresponded to the affected brain regions. In this disease, a role of mitochondria was so far not discussed. In PD mitochondrial dysfunction seems to be involved based on several observations, including animal models[13], and mtDNA rearrangements in the substantia nigra (SN) [12]. This suggests that the specific involvement of the SN may be based on the quantitative accumulation of mitochondrial damage, exceeding a critical threshold in this brain region. This would explain our observation of increased CD levels in this region in the case with PD. In AD, there is also evidence for oxidative stress and a dysfunction of OXPHOS complexes [5,9]. However, in our AD case, we neither detected a general increase in the CD levels, nor did we see regional differences. This corroborates earlier observations by Chinnery et al.[6]who reported a lack of mtDNA mutations in AD. Finally, in the DLB case, we observed increased mtDNA deletion levels especially in the occipital lobe. In this disorder, a role for oxidative stress has been recently implicated [14] However, Chinnery and colleagues [6]
failed to detect mutations in the entire mtDNA control region in brain DNA from patients with DLB, but these authors did not state in detail about the brain regions examined in their study.
In summary, our real-time PCR assay allows to measure the exact amount of CD, which in turn can provide hints for the presence of mtDNA damage as a cause of neurodegeneration.
Acknowledgements
We thank S. Hartmann and T. Fuchs for preparing the slides. Furthermore, the technical assistance of I. Schellhase is gratefully acknowledged.
References
[1] J.A. Allen, M.M. Coombs, Covalent binding of polycyclic aromatic compounds to mitochondrial and nuclear DNA, Nature 287 (1980) 244 – 245.
[2] J.M. Backer, I.B. Weinstein, Mitochondrial DNA is a major cellular target for a dihydrodiol-epoxide derivative of benzo[a]pyrene, Science 209 (1980) 297 – 299.
[3] D.F. Bogenhagen, Repair of mtDNA in vertebrates, Am. J. Hum.
Genet. 64 (1999) 1276 – 1281.
[4] D.F. Bogenhagen, K.G. Pinz, R.M. Perez-Jannotti, Enzymology of mitochondrial base excision repair, Prog. Nucleic Acid Res. Mol.
Biol. 68 (2001) 257 – 271.
[5] D.S. Cassarino, J.P. Bennett, An evaluation of the role of mitochondria in neurodegenerative diseases: mitochondrial mutations Fig. 2. Region-specific levels of the 5 kB common deletion (CD) of the
mtDNA in the brains of different neurodegenerative disorders and controls.
(a) The amount is given as CD/HVR2 ratio (CD, common deletion; FTD, frontotemporal dementia; PD, Parkinson’s disease; AD, Alzheimer’s disease; and DLB, dementia with Lewy bodies). (b) CD/HVR2 ratios normalized for the cerebellum, regarding different basic mtDNA deletion levels in individuals. For controls, mean^SEM is shown.
C. Mawrin et al. / Neuroscience Letters 357 (2004) 111–114 113
and oxidative pathology, protective nuclear responses, and cell death in neurodegeneration, Brain Res. Brain Res. Rev. 29 (1999) 1 – 25.
[6] P.F. Chinnery, G.A. Taylor, N. Howell, D.T. Brown, T.J. Parsons, D.M. Turnbull, Point mutations of the mtDNA control region in normal and neurodegenerative human brains, Am. J. Hum. Genet. 68 (2001) 529 – 532.
[7] M. Corral-Debrinski, T. Horton, M.T. Lott, J.M. Shoffner, M.F. Beal, D.C. Wallace, Mitochondrial DNA deletions in human brain: regional variability and increase with advanced age, Nat. Genet. 2 (1992) 324 – 329.
[8] G.A. Cortopassi, N. Arnheim, Detection of a specific mitochondrial DNA deletion in tissues of older humans, Nucleic Acids Res. 18 (1990) 6927 – 6933.
[9] D.A. Cottrell, E.L. Blakely, M.A. Johnson, P.G. Ince, D.M. Turnbull, Mitochondrial enzyme-deficient hippocampal neurons and choroidal cells in AD, Neurology 57 (2001) 260 – 264.
[10] D.L. Croteau, R.H. Stierum, V.A. Bohr, Mitochondrial DNA repair pathways, Mutat. Res. 434 (1999) 137 – 148.
[11] G.K. Dhaliwal, R.P. Grewal, Mitochondrial DNA deletion mutation levels are elevated in ALS brains, NeuroReport 11 (2000) 2507 – 2509.
[12] G. Gu, P.E. Reyes, G.T. Golden, R.L. Woltjer, C. Hulette, T.J.
Montine, J. Zhang, Mitochondrial DNA deletions/rearrangements in Parkinson disease and related neurodegenerative disorders, J. Neuropathol. Exp. Neurol. 61 (2002) 634 – 639.
[13] J.W. Langston, P. Ballard, J.W. Tetrud, I. Irwin, Chronic Parkinson- ism in humans due to a product of meperidine-analog synthesis, Science 219 (1983) 979 – 980.
[14] J.H. Power, J.M. Shannon, P.C. Blumbergs, W.P. Gai, Non-selenium glutathione peroxidase in human brain: elevated levels in Parkinson’s disease and dementia with lewy bodies, Am. J. Pathol. 161 (2002) 885 – 894.
[15] C. Richter, Oxidative damage to mitochondrial DNA and its relationship to ageing, Int. J. Biochem. Cell Biol. 27 (1995) 647 – 653.
C. Mawrin et al. / Neuroscience Letters 357 (2004) 111–114 114
