• Keine Ergebnisse gefunden

Supplementary Figure 1 Sup Fig. 1. Crispr-generated knockout of

N/A
N/A
Info
Herunterladen
Protected

Academic year: 2022

Aktie "Supplementary Figure 1 Sup Fig. 1. Crispr-generated knockout of"

Copied!
2
0
0

Wird geladen.... (Jetzt Volltext ansehen)

Jetzt herunterladen ( 2 Seite )

Volltext

(1)

Supplementary Figure 1

Sup Fig. 1. Crispr-generated knockout of N. furzeri cGAS gene (a), A tandem duplication of 34bp (shown in bold) generated by crispr-mediated cleavage in the cGAS gene leads to a frameshift, resulting in multiple stop codons and truncation of the protein.(b), Protein architecture of human cGAS and killifish cGAS. The mutated killifish cGAS is stopped prematurely, truncating the C-terminal NTAse core and MAB21 domains (shown in orange) required for enzymatic activity.

(2)

Supplementary Figure 2

Confirmation of cGAS-/-: Genomic DNA from both cGASwt and cGAS-/- was amplified with Forward primer: GTTAAGGAACCCCTTCGCACT and Reverse primer:

TTGCCGTCATCTCCCATTCTG. PCR product was separated on 2.5% Agarose gel, 50V for 2 hr. The cGASwt DNA exhibits a PCR product at 554bp, whereas the cGAS-/- DNA, which contains a 34 bp duplicated sequence, has a PCR product at 588bp.

Referenzen

Jetzt herunterladen ( DOCX - 2 Seite - 309.01 KB )

ÄHNLICHE DOKUMENTE

Supplementary Figure 1 a)

a) A549 cells were transfected with non-targeting control siRNA (siCtrl) or siRNA (si) targeting the indicated transcripts for 48 h and immunoblotted for the indicated proteins.

Supplementary information Supplementary figure 1: Vascular colocalization of modified A

Colocalization of Aβ 1-17 , Aβ N3pE , and Aβ pS8 (D) demonstrates that vascular amyloid deposits could contain all three

Supplementary Fig.1 (a) (b)

[r]

On the number of minimal codewords in codes generated by the adjacency matrix of a graph

We study the number of minimal codewords in binary linear codes that arise by appending a unit matrix to the adjacency matrix of a graph..

Detection of a biolistic delivery of fluorescent markers and CRISPR/Cas9 to the pollen tube

Although nuclear signals of both vegetative and sperm cells were observed, fluorescence sig- nals derived from the delivered plasmid DNA were detected only in the vegetative

Generation of a polled phenotype in cattle using CRISPR/Cas

We hypothesized that the CRISPR/Cas12a mediated knock-in of the Polled Celtic variant into the genome of an originally polled HF breeding bull causes a polled phenotype

Characterization of cGAS-mediated DNA sensing in murine T-cells

To clarify if the WT version of HSV-1 escapes or is able to trigger innate responses comparable or different to HSV-1 ∆ UL41, we challenged WT and cGAS KO YAC-1 T- cells with the

This document is a preview generated by EVS

When an organization does not have an environmental management system, EPE can assist the organization in: — identifying its environmental aspects; — determining which aspects it