A novel in vitro transcription-translation system: accurate

(1)

A novel in vitro transcription-translation system: accurate

and efficient synthesis of single proteins from cloned

DNA

sequences

Dietrich Stueber"3, Ibrahim Ibrahimi2.4, Daniel Cutler2, Bernhard Dobberstein2 and Hermann Bujardl'3

'MolekulareGenetik der Universitat Heidelberg, Im Neuenheimer Feld230, D-6900Heidelberg, and2European Molecular Biology Laboratory, Postfach 10.2209, D-6900 Heidelberg, FRG

3Presentaddress: Hoffman-La Roche and Co. AG, Grenzacher Strasse 124, CH4002 Basel, Switzerland.

40n research leave from the University of Jordan, Department of Biological Sciences, Amman, Jordan

Communicated by H.Bujard

Asystem is described whichpermits the efficient synthesis of single proteins in vitro. The essential element in this expression system is a strong promoter derived fromcoliphage T5 which produces, with high efficiency, specific RNAs in capped or uncapped form,depending upon the experimental conditions used. The transcription-coupled capping of RNA allows the direct translation of the RNA in eukaryotic ex- tracts from wheat germ aswell as from HeLa cells. The synthesis ofthree different proteins is reported,includinglyso- zyme, which is shown to be translocated across membranes whenappropriate assay conditions are used. Thesimplicityof the experimental procedure, the high purity and specific activity ofthe [35S]methionine-labefledproteins produced offer anumber of possibilities for the study of structure-function relationshipsof proteins.

Key words: transcription-coupled translation/T5 promoter/

membrane translocation Introduction

Cell-freeproteinsynthesizingsystemshave been instrumental in studying mechanisms of protein biosynthesis. They have also proved to be important tools for the analysis of mem-

branebiogenesis andthetranslocation of proteinsacross, or

integration into, membranes (Blobel and Dobberstein, 1975;

see Sabatini et al., 1982). A prerequisite in many of these studies is the availability of individual well defined mRNA species. There are, however, only a few ^casesin which suitable mRNA species can easily be purified from specialized tissues ^orcell lines.

With the advent of efficient cDNA cloningandscreening methods, it became feasible inprinciple to produce defined transcripts of any sequence encoding a protein of interest.

Furthermore, proteinscanbeproduced from modifiedDNA and subsequently tested in biological assays. Such an ap-

proach has already provided valuable information on structural features ofsignalsequences(Silhavyetal., 1977; Bedou- elle etal., 1980). What is now requiredis asimple efficient system in which selected DNA segments car be transcribed into functional mRNA and these then translated into proteins. An 'ideal' in vitro expression system wouldexpress a

singleproteinspecies from cloned DNAin bothprokaryotic and eukaryotic lysates in aquick and simple procedure.

Here^wedescribe a method whichpermits the production ofsingleproteinsincoupledtranscription-translation systems

of pro- and eukaryotic origin (Roberts et al., 1975; Yang et at., 1980; Paterson and Rosenberg, 1979). The salient featureof the system is the highly selective and efficient synthesis ofmRNA using a promoter of coliphage T5 (Bujard, 1980) which, depending upon the experimental conditions, produces capped or uncapped mRNA in high yields.

Results

Theexperimentaldesign

The most important step in the exclusive expression of a single protein species in vitro is the selective transcription of the gene of interest. This is achieved by cloning the proper sequenceinto theplasmidpDS6 whosemainproperties are as follows (see also Figure 1). (i) It contains multipleinsertion sites between the strong coliphage promoter PN25X/O and phage X terminator

to

(Figure 2). (ii) Downstream of

to

is located the promoter-free gene of chloramphenicol acetyl- transferase (cat),which carries its own ribosomalbinding site (RBS) and which isfollowedby asecondterminator. (iii) The replication region (orn) and the j3-lactamase gene (bla) are pBR322 derived. (iv) Using the proper in vitro transcription conditions, PN25X/O outcompetes the ,B-lactamase promoter 20-fold, thus, -95Vo of potentially translatable RNA is specified by the phage promoter. (v) There is no ATG between the transcriptional start sequenceand the mostdistal site for gene insertion. (vi) Under conditions described in Materials and methods PN25x/O efficiently initiates tran- scriptswith 7mGpppAresultingincappedmRNAs.

A foreign gene integrated downstream of the phage promoter can be expressed in in vitro systems with high efficiency usingEscherichia coli RNA polymerase for transcription and purified pro- or eukaryotic cell lysates for translation. Supplying [35S]methionine, theprotein of interest can beobtainedaslabelledproductofhighspecific activity,tested for different biological functions (e.g., translocation into membranes) and then be directly subjected to biochemical analyses(e.g.,electrophoresis followedbyautoradiography).

Since in vitro as well as in vivo 3-507o oftranscriptional readthrough occurs atterminator

to

somebicistronicmRNA willexist in both situations.In vivothis results inamoderate but distinctchloramphenicol resistance of the cell which can be utilized for controllingtheintegrity of thetranscriptional unit constructed.

Structure andproperties of theplasmidsystemspDS5and pDS6

All plasmids described here are derived from the plasmid family pDSl (StueberandBujard, 1982;Bujardetal., 1983).

Thesevectors were designedfor thecloningand

quantitative

analysis ofprokaryotic transcriptionand translation

signals.

ThepDSl plasmidscontain thebla gene,with itsoriginalpro- moter (P3, Stueber and Bujard, 1981) as an internal tran-

scriptional standard. For analysing various expression signals, these plasmids carry two indicator genes, dhfr (dihydrofolatereductase) andcatwhichcanbeputunder the

(2)

I

SI NGLE PROTEIN

k.

Ai -r ^- _{1-i1 .}

CLONING IRANS(RIPTIO)N TRANSLATION

Fig. 1.Coupled transcription-translationsystem forproductionofasingle protein species. DNAsequences of interestcanbe inserted at sixuniquerestriction endonucleasecleavagesites of theexpression plasmid pDS6 (Figure2)betweenastrongcoliphageT5-derivedpromoter(P)andanefficienttranscriptional terminator(T). Theintegrityof thetranscriptionalunit constructedcanbe monitoredbylow level resistance tochloramphenicoldue to thereadthrough occurringatthe terminator into thecatgenewhich lacks itspromoterbut stillcontains its ribosomalbindingsite(RBS).Thereadthrough transcriptsare efficiently terminatedatasecond termination site(T)infrontof thereplication region(on). Transformantscanindependentlybe selectedfor resistanceto ampicillin conferredbythe (3-lactamase(bla)gene. Coupledtranscriptionandtranslation:cappedmRNA isproduced bytranscribingtheplasmidwith E.coli RNApolymerase (RNA POL)inthepresenceof7mGpppAandthe four ribonucleosidetriphosphates (NTPs).TheRNA isdirectlytranslated inapro-or eukaryoticcelllysate (forexample, the wheatgermsystem)in the presenceof[35S]methionineandthe other 19 amino acids(AA)tovirtuallyasingle protein species.

control ofasinglepromoter.Thereareseveraladvantagesto usingthese indicatorgenes: (i)theirproductsaretoleratedby the E. colicellinlargeamounts andareeasily assayable; (ii) the respective sizes of their genes are only665 and 745 bp;

thus, theplasmids are still relatively small, which facilitates theintroduction of additionalunique cleavagesitesaswellas

the insertion of furthergeneticmaterial. Otheradvantagesof the pDS systems relating to their structural stability, their maintenance in E. coliand theirpotentialasefficientexpres-

sion systems have been described previously (Bujard et al., 1983, 1984).

The most relevant properties of the plasmids pDS5 and pDS6aredescribed inFigure2.Theyall haveincommonthe region spanningfrom the XbaItoXhoIcleavage sites, which corresponds to the PvuII/EcoRI fragment of pBR322. All constructs contain the promoter/operator fusion PN25X/O andthecatgenecarrying itsoriginal ribosomal bindingsite.

The main differences of the various constructs concern the regionbetweenthepromoterand thecatgeneand theintegra- tion oftranscriptionalterminatorsupstreamanddownstream of thecatregion. Thus, inpDS5/3 andpDS5/2thedhfrse- quenceispresentwith and withoutaribosomalbinding site, respectively. This allows thein vivo production of DHFR in the case ofpDS5/3, whereas only CAT is synthesised with pDS5/2 (Figure3A). The absence of visibleamountsofCAT in cellscarrying pDS5/3 is due totheterminator tobetween thedhfrandthecatgene. Elimination of the dhfrsequence

from pDS5/2 results in pDS5/1 which in turn was used for theconstruction ofpDS5 and pDS6. Both of theseplasmids containapolylinker with six uniquecleavagesitesfor thecon-

venient integration of foreigngenes and the terminator

t,

of the rrnBoperon(Brosiusetal., 1981) downstreamof thecat

region. The only difference between the two plasmids is the

presence oftoin pDS6toreduce transcriptional readthrough into thecatregion. Integration of thelysozymegeneleadsto

pDS5/4 which has been used in the experiments described below.

Translation of in vitro transcribed mRNAfrompDS5/1-3 in the wheatgermcell-freesystem

TranslationofamRNAbyE.coliribosomes isdependenton a functional ribosome binding site. In contrast, eukaryotic ribosomesarethoughttorecognizethe 5' end of themRNA,

tomovealongthe mRNA andtoinitiateprotein synthesisat the first AUG(Kozak, 1983).Foranefficientrecognitionofa

mRNA byeukaryotic ribosomes, the 5' end of themolecule hasto be 'capped' by7-methylguanosine.

Capping coupledtotranscription wasachieved in vitroby including 7mGpppA in thetranscription assay(Contreras et

al., 1982).Unlike 7mG which is^apotentinhibitor ofpolypep- tide chaininitiation, 7mGpppAhas^noinhibitoryeffectatthe concentrations used (datanotshown).

Using coliphage T5 promoter PN25X/O as the transcriptional start signal in plasmids pDS5/1-3, capped mRNAs

wereobtainedinthepresenceof 7mGpppA and E. coliRNA polymeraseingood yields. Since these mRNAsarebyfarthe most abundant translatable species in the assay, virtually single proteinsareproducedineachcaseusingawheatgerm

cell-freetranslationsystem. InFigure 3B theindividual pro-

teinsareshown: DHFR(from pDS5/2),anextended form of DHFR(from pDS5/3)and CAT(from pDS5/1).Asexpected ineukaryoticsystems, thetranslation wasalwaysinitiatedat

the first AUG codon of thecorrespondingmRNAs. The dif- ferencebetween pro- and eukaryotictranslation initiation is demonstrated best with pDS5/2: whereas in bacteria only CAT issynthesised from thebicistronic mRNA (thereis no

ribosomal binding site for DHFR), the eukaryotic in vitro translation system gives rise to only DHFR ^- provided 7mGpppA is used intranscription (Figure 3A,B).

Translation in the HeLa cell freesystem

Totestwhether theinvitroproducedcappedmRNAcanalso betranslated inamammaliancell-freesystem, mRNAderiv- ed from pDS5/2 was translated in a HeLa cell extract. As

seen in Figure 4, lane 3, translation of DHFR-mRNA was

LXPRLSSION PLASMID

T

.i:i... .

'11#1

rej-,

lo.-'

(3)

B

in vi'tro

%wo". 411 4-W

40mw 4-4-w.lo

4-4-opp

r- Operat-or Promoter

-43 -35 -10 .1 20

AAAAATT TTGCT TCAGGAAAATTTTTCTGLLLAGATTCAAATTGTGACCGGATAACAATTT- -mRNA-

EcoRI Polylinker HidjII RBS,cat

GAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGGTAAAATG Ca _ pDS SmaIBoinHI Sall PstI

Hind III

pDS6 pDS 5 /1

EcoRI HindIII

GAAYTCC.GGATCCGGCATCATG dhfr pOSS/.

BarnH-I

RBS Hind III

GAATTA||1||||1||1|||| TATGGGATCCGGCATCATG pOS 5/

BaimHI HindIII

EcoRI Hind IU

GAATTCCAAGCTT ATGL:':I: lsrr: : pDS5/4

HindIII

Fig. 2. Schematicdescription of plasmids. (A)Genetic and physicalmapof pDS5 and pDS6. Both plasmids contain the regionbetween PvuII(now Xbal)andEcoRI(nowXhoI) of pBR322 carrying the replication region (or,)andtheb/agene.Thepolylinker from pUC8 (Vieira and Messing, 1982)isplaced betweenPN25X/O(afusion ofcoliphage T5promoterPN25 with the lacoperatorofE.coli,tobepublished elsewhere)and the promoter-freegenefor CAT which still contains its original RBS. Cleavage sitesinterfering with the utilisation ofthepolylinkerwereremoved from theplasmids. Transcriptsfrom Pareterminated in vitro and invivoat terminatort1 of the rrnBoperonof E.coli and inaddition alsoat terminatortoof phageXinthepDS6system. The lowerpartof thefigure shows thesequencebetween the ^-43regionofPN25X/OofpDS5 and the startcodon of thecatgene aswellasthe insertionsiteof theterminatort ofphageXasit has been usedto convertpDS5topDS6. (B)Schematic descriptionofplasmids pDS5/1-4. Theseplasmidsdiffer frompDS5 within the region between the E. coli and HindIII site. pDS5/1: the 36-bp fragmentofpDS5isshortenedtoa 13-bp EcoRI-HindIII fragment.

pDS5/2: thecoding regionof thedhfrgene(187aminoacids)is inserted.

pDS5/3: asynthetic ribosomalbindingsite(RBS)isinserted in front of thedhfrgeneresultingina 192 amino acid fusionprotein;transcriptsare

terminated invivoatterminatort0o pDS5/4: the cDNA for chicken lysozyme (lsm)has been insertedintotheHindlIl site ofpDS5/1. For convenience,ATGs from whichprotein synthesisisinitiatedareunderlined andrelevant restrictioncleavagesitesaredenoted. IncontrasttopDS5and pDS6inpDS5/1-4thePstl and HindlI sites inthe blageneand the EcoRI site in thecatgene arestillpresent. Furthermore, plasmids pDS5/1, 2 and 4contain terminatortoatthe XbaI site(replacingtQ),whereas in pDS5/3this terminationsignalis located betweendhfrand cat.

achieved with an efficiency comparable with that obtained when an optimal concentration of mRNA from myeloma tumor MOPC 41 was translated under identical conditions.

1 2 3

2

1 2 3

Fig. 3. Synthesis of DHFR and CAT encoded byplasmids

pDS5/1 -3. (A) E. co/icells (C600r -AlacM15) harbouring the respective l, plasmidsweregrownovernight in Luria broth containing 100 tzg of

ampicillin/ml, harvested by centrifugation, solubilized in sample buffer and analysed by SDS-PAGE asdescribed before (Stueber and Bujard, 1982).

TheCoomassie blue stained gels showthe proteinpatternof cells containing pDS5/2 (lane 1), pDS5/3 (lane 2) and pDS5/1 (lane 3). The positions ofDHFR, its fusion derivative DHFRT (Figure 2) and of CAT

areindicated. Ascanbeseen, allthese proteinsaresynthesised invivoin high yields. (B) Plasmids pDS5/1 -3 weretranscribedwith E. coli RNA polymerase in thepresenceof7mGpppA. The resulting mRNAswere

translated inawheatgermcell-freesystem.The[35S]methionine-labelled proteinswereseparated by SDS-PAGE and visualizedby fluorography (lane1.pDS5/2; lane2:pDS5/3; lane3:pDS5/1). About 105c.p.m. were

routinely obtainedper1 alof translation mixture and5 1l of theassay

mixtureweredirectly appliedperslot of thegel. The dried gelwasexposed toKodak XAR5 film for 60min.

MOPC 41 mRNA primarily directs the synthesis of light chainsofIgG (Blobeland Dobberstein, 1975) (Figure 4, lane 2).

Translationand membrane translocation of chickenlysozyme

Tostudy functional features of signal^sequences involved in thetranslocation ofproteinsacrossmembraneswecloned the chicken lysozyme cDNA into the HindIII site of pDS5/1.

After transcription with E. coli RNA polymerase and translation of the capped mRNA in the wheat germ cell-free system, a single protein was obtained with the mol. wt. of prelysozyme (Figure 5, lane 1). To test whether this protein

canbetranslocated acrossthemembrane of theendoplasmic reticulum, translationwascarriedoutin thepresenceofeither Signal Recognition Particle (SRP), or salt washed rough microsomes (RMk) orof both SRP and RMk.

TheexperimentdepictedinFigure5 showsthatlysozymeis

A A

in vivo

B

PN25/O

EcoRI HindIl

GAATTCCAAGCTT

-m ---CAT 4- - DHFR*

DHFR-

(4)

-pLi

um-DHFR

4-

prelsm- 4_4E_

[smi-

Fig.4. Proteinsynthesisinthe HeLa cell-freesystem. The translation systemwassupplementedwithnoRNA(lane1),10 jtg/mlmRNAfrom MOPC41myelomatumour(which produces mainlymRNAfor thelight chain ofIgG, pLi) (lane 2)andanaliquotofaninvitrotranscriptionassay with plasmid pDS5/2astemplate (lane3. The secondmajor protein synthesisedunderthese conditionsmustbe relatedtoDHFRasitcanbe precipitatedwith anti DHFRantibodies).Theassayswereprocessedand evaluatedasdescribed in thelegendtoFigure3B. The HeLa cell-free systemwas asdescribed before(Garoffetal., 1978).

translocated into microsomal vesicles in an SRP-dependent

manner, typical for secretory proteins. As expected SRP inhibitstheproductionofprelysozymeandRMk byitselfcan

neither translocate nor process prelysozyme. Mature lyso-

zymeisfoundinside the microsomal vesiclesonlyifSRP and

RMk

^are both present

during translation,

^as

judged by

the protection ofmaturelysozyme againstexogenous proteinase K. This protection is eliminated upon solubilization of the membranebyTriton X-100.

Discussion

The experimental systemdescribed here permitstheefficient expression of protein-coding DNA sequences in vitro. The pertinent element in this system isa strongprokaryotic pro-

moterderived fromcoliphageT5whichacceptsATPas well as 7mGpppA for initiation of transcription. Consequently, depending upon the experimental conditions, capped or

uncappedmRNAscanbeproducedinasimple transcription

assay usingE. coli RNA polymerase. Several promoters of phage T5 have been foundtobelongtothestrongesttranscrip-

tioninitiationsignalsof theE.coli system.Invitro andin vivo

Fig.5. In vitrosynthesisand membranetranslocation oflysozyme.Plasmid pSD5/4containingthelysozymecDNAsequence(Figure 2)wastranscribed with E. coliRNApolymerasein thepresenceof7mGpppA.Theresulting RNAwastranslated inawheatgermcell-freesystem and the labelled proteinswereanalysed bySDS-PAGEasdescribed above. The different translationassaysweresupplementedfor the translocationprocessas

follows: lane1,noaddition;lane2, +SRP;lane3, +RMk; lane4, +SRP +RMk. After translationinthepresenceofRMk (lane 5)orSRP and RMk(lanes6-7), proteinase K (lanes5and6)orproteinase K and Triton X-100(lane 7)wereadded and the incubationwascontinued for 90min^on ice.

theyoutcompeteanyotherpromoter forRNApolymeraseif

proper conditions are provided (Gabain and Bujard, 1979;

Gentz et al., 1981; Deuschle and Bujard, in preparation;

Gentz and Bujard, in preparation). Therefore, in the ^expression system described here there is only one potentially translatable RNAproduced in addition tothe RNA synthesised under the control of the T5promoter: theblamRNA.

Thepromoter ofthis transcriptional unit, Pbla' is, however, outcompeted byPN25x/obyafactor of 25 (Deuschle andBu- jard, inpreparation). Thus, -95^% of the in vitromRNAis PN25x/Oderived.

The plasmid family developed for this expression system has several advantages over commonly used expressionvec-

tors (Roberts etal., 1975; Paterson and Rosenberg, 1979;

Meltonetal., 1984; Krieg and Melton, 1984).

(i) The indicator genes encode proteins which are easily assayableandtoleratedinlargeamountsbyE. coli;theycan

therefore be brought under the control of highly efficient expression signals (Bujardetal., 1983).

1 23

1 2 3 4 5 6 7

(5)

(ii) The plasmids contain terminators of transcription in appropriate sitesand can therefore be stablymaintained upon integration of strong promoters (Gentz et al., 1981; Stueber and Bujard, 1982; Bujard et al., 1984).

(iii) In cloning experiments, bacterial cells harbouring the desired plasmids can be selected not only by monitoring ampicillin resistance, but the successful integration of a sequence between the promoter and the cat gene re-estab- lishes chloramphenicol resistance in addition; thus the function of the transcriptional unit can be tested (prior phos- phatase treatment of the cleaved cloning vehicle is of course required).

(iv) Sequences cloned in pDS5 will not be translated in E.

coli since no ribosomal binding site is present. This permits the cloning of sequences coding forproteins poisonous to the E. coli cell. If fortuitous translation of such a sequence is suspected, transcription from PN25X/O can be efficiently repressed by the lac repressor.

(v) There is no ATG between the transcription initiation site and the last integration site for foreign sequences; thus translation of the capped RNA will start at a site correspond- ing to the first ATG of the newly inserted DNAsequence and we have shown that the distance between the 5' end of the RNA and the first ATG can vary between 42 and 67 bp without affecting the efficiency of the system (Figure 2).

(vi) For translation in prokaryotic systems, foreign DNA sequences can be integrated into pDS5/3 derivatives which carry an efficient ribosomal binding site. Here the repress- ibility oftranscription in vivo is useful since poisonous gene products can be kept at low enough levels to allow the cells to survive (Stueber et al., unpublished).

(vii) The DHFR protein, which can be produced in highly active form and yields of up to 50% of the total cellular protein (unpublished results) is a useful entity to construct fusion proteins and has the advantage of being considerably smaller than, e.g., f-galactosidase. As part of a fusion protein it can be translocated through membranes as demonstrated most elegantly in the following paper by Hurt et al.

(1984).

A major advantage of the overall expression system reported here is thesimplicity of theexperimental procedure.

The templates required can be isolated by the rapid 'mini prep' method according to Birnboim and Doly (1979). Ali- quots of the transcription assay can be directly added to eukaryotic translation systems without any purification and, using [35S]methionine, labelled proteins can be synthesised with high specific activity. Aliquots of this assay can again directly besubjected to, e.g., SDS-PAGE. Moreover, dueto the efficient labelling of the proteins autoradiograms canbe obtained after <30 min of exposure. Thus, a complete experiment can be carried out in a day. A word of caution should beadded here: preliminary data suggest that GC-rich sequencesarisingfromGC-tailingcanreduce theefficiencyof translation in this expression system.

We have demonstrated the usefulness of the system with the coding sequences for three different proteins: dihydrofolatereductase, chloramphenicol acetyltransferaseand lysozyme. Translation was specific and successful in the wheat germas well asin theHeLa cellextract andthe

efficiency

of translation ofmRNAobtained bytranscription-coupled capping in vitro was comparable with the translation ofmRNA isolated from mammalian cells (MOPC 41). After the work reported here had been completed, anotherefficient butmore

tedious transcription system was reported (Melton et al., 1984; Krieg and Melton, 1984). Transcripts, obtained with SP6 RNA polymerase, are purified and capped by guanyl- transferase.

Webelievethat the methoddescribed herewillprove tobe useful for avariety of studies ofprotein structureand function. Using the lysozyme cDNAsequence wehave shown that protein translocation through membranescanbeaccomplish- edin the assay and furtheranalysis of this process is being described in a forthcoming publication (Ibrahimi et al., in preparation). Anotherinterestingapplicationof thesystemis demonstrated in the accompanying paper by Hurt et al.

(1984). Wearealsoconfident that thisexpressionsystemwill be useful in the identification of cloned DNA sequences which code for proteins that are not tolerated in E. coli but against whichantibodies areavailable.

Materials and methods

E. coli RNA polymerase, 7-methylguanosine 5'-monophosphate and 7mGpppA were from PL-Biochemicals, human placental RNase inhibitor wasfrom BRL.

Constructionofplasmids and preparation of the plasmid DNA

Construction ofthe variousplasmids was performedby standard recombi- nant DNA methodsand, with the exceptionof pDS5/4, will be described in detail elsewhere. pDS5/4 was obtained by inserting the HindIII fragment (Krieg etal., 1984) containing the entire coding region of lysozyme cDNA (Land etal., 1981) into the HindIII site of pDS5/1 (Figure 2).

Plasmid DNA was prepared either according toBirnboim and Doly (1979) or by the cleared lysate method (Clewell and Helinski, 1969) followed by CsCI/ethidium bromide equilibrium centrifugation (Radloff et al., 1967).

Both types of preparations were equally suitable for in vitro transcriptionand translation.

Coupled transcription-translation

The transcription-translation system was modified from Contreras et al.

(1982), Roberts etal. (1975) and Muller etal. (1982). 2Agofplasmid DNA were transcribed by 0.3 unit of E. coli RNA polymerase in a final volume of 10AIcontaining 20 mM Hepes-KOH, pH 7.5, 10 mM Mg acetate, 200 mM K acetate, 0.2 mM spermidine, 5 mM dithiothreitol (DTT), 10units of human placental RNaseinhibitor (RNasin), 0.5 mM each of GTP, CTP, UTP, 5 AM

ATP and 0.25 mM 7mGpppA. After incubation for 5min at 37°C, I td of 5 mM ATP was added andincubation continued for 15 min at 37°C. The mixture was put on ice and withoutfurther purification used in the translation assay. A typical 25IL wheat germ translation assay contained 501of the transcriptionmixture, 10A1 of wheat germ extract, and was adjusted to the following final concentrations: 20 mM Hepes-KOH pH 7.5, 110 mM K acetate, 2.8 mM Mg acetate, I mMDTT, I mM ATP, 10 mM creatine phos- phate, 80jg/ml ^creatine phosphokinase, 5AM S-adenosyl methionine, 20AMof each of the 19amino acids minusmethionine, 10ACi[35S]methionine. Where indicated, SRP (5 units per assay) and/or membranes from dog pancreas(0.05 A,,oper assay)wereincluded. The assays were incubated at 25°C for 60 min. Translation in the HeLa cell free system was done as described previously (Garoff et al., 1978).

Isolation of SRP (Walter andBlobel, 1983) and membranes fromdog pancreas (Meyer etal., 1982),post-translational assays(Dobberstein and Blobel, 1977), SDS-polyacrylamide gel electrophoresis (SDS-PAGE; Maizel, 1969) andfluorography (ENHANCE, NEN) were doneasdescribed.

Acknowledgements

Weare grateful to Dr A.Colman forplasmid pSVSlysozymewhich contains the lysozyme cDNAon a HindIII fragment(Krieg etal., 1984). We thank Birgit Mattke and Elke Krause for excellent technical assistance and Annie Steiner fortyping themanuscript.This workwassupported bygrants BU/338 12-15 and DO 199/5-2 of the DeutscheForschungsgemeinschaft,bythe Fond der Chemischen Industrie Deutschlands to H.B., bya fellowship from the Deutschen Akademischen Austauschdienst toI.I. and anEMBOfellowship toD.C.

References

Bedouelle,H., Bassford,P.J., Fowler,A.V., Zabin,I., Beckwith,J. and Hoff- nung,M.(1980)Nature, 285,78-81.

Birnboim,H.C. andDoly,J. (1979)Nucleic AcidsRes., 7, 1513-1523.

(6)

Blobel,G. and Dobberstein,B. (1975) J. Cell Biol., 67, 835-851.

Brosius,J., Dull,T., Sleeter,D.D. and Noller,H.F. (1981)J.Mol.Biol.,148, 107-127.

Bujard,H. (1980) Trends Biochem. Sci., 5, 274-278.

Bujard,H., Baldari,C., Brunner,M., Deuschle,V., Gentz,R., Hughes,J., Kammerer,W. and Stueber,D. (1983) in Papas,T., Rosenberg,M. and Chirikjian,J.G. (eds.), GeneAmplification andAnalysis, Vol. III, Ex- pressionofCloned Genes in ProkaryoticandEukaryotic Cells, Elsevier North-Holland, pp.65-88.

Bujard,H., Stueber,D., Gentz,R., Deuschle,V. and Peschke,U. (1984) in Helinski,D.,Cohen,S.andClewell,D. (eds.),Plasmids inBacteria,Plenum Press,NY,in press.

Clewell,D.B.andHelinski,D.R. (1969)Proc.Natl. Acad. Sci.USA, 62,1159- 1166.

Contreras,R.,Cherontre,H., Degrave,W.andFiers,W. (1982)Nucleic Acids Res.,10, 6353-6362.

Dobberstein,B.andBlobel,G.(1977)Biochem.Biophys.Res.Commun., 74, 1675-1682.

Gabain,A.V.andBujard,H. (1979)Proc. Natl. Acad. Sci. USA, 76,189-193.

Garoff,H., Simons,K. and Dobberstein,B. (1978) J. Mol. Biol., 124, 587-600.

Gentz,R., Langner,A., Chang,A.C.Y., Cohen,S.N. and Bujard,H. (1981) Proc.Natl.Acad. Sci. USA, 78, 4936-4940.

Kozak,M. (1983) Microbiol. Rev.,47, 145.

Krieg,P.A. and Melton,D.A. (1984) Nucleic AcidsRes.,12,7057-7070.

Krieg,P.A., Strachan,R., Wallis,E., Tabe,L.andColman,A. (1984)J.Mol.

Biol.,in press.

Land,H., Grez,M., Hauser,H., Lindenmaier,W. and Schuetz,G. (1981) Nucleic AcidsRes., 9,2251-2266.

Maizel,J.V.(1979)inHabel,K. and Salzman,N.P. (eds.), Fundamental Tech- niquesin Virology,Academic Press, NY,pp.334.

Melton,D.A.,Krieg,P.A., Rebagliati,M.R.,Maniatis,T., Zinn,K.andGreen, M.R.(1984) Nucleic Acids Res., 12, 7035-7056.

Meyer,D.I., Krause,E. andDobberstein,B. (1982)Nature, 297, 647-652.

Mtiller,M., Ibrahimi,I., Chang,Ch.N., Walter,P. and Blobel,G. (1982) J.

Biol.Chem., 257, 11860-11863.

Paterson,B.M. andRosenberg,M. (1979) Nature, 279,692-696.

Radloff,R., Bauer,W.andVinograd,J. (1967)Proc. Natl.Acad. Sci. USA, 57, 1514-1521.

Roberts,B.E., Gorecki,M., Mulligan,R.C., Danna,K.J., Rozenblatt,S. and Rich,A.(1975) Proc. Natl.Acad. Sd. USA, 72, 1922-1926.

Sabatini,D.D., Kreibich,G., Morimoto,T. and Adesnik,M. (1982) J. Cell Biol., 92, 1-22.

Silhavy,T.J., Schuman,H.A., Beckwith,J.R. and Schwartz,M. (1977)Proc.

Natl. Acad.Sci. USA,74, 5411-5415.

Stueber,D. and Bujard,H. (1981)Proc.Natl. Acad. Sci. USA, 78, 4936-4940.

Stueber,D. and Bujard,H. (1982)EMBO J., 1, 1399-1404.

Vieira,J. andMessing,J. (1982) Gene, 19, 259-268.

Walter,P. andBlobel,G. (1983) Methods Enzymol., 96, 682-691.

Wiedmann,M., Huth,A. andRapoport,T.A. (1984) Nature,309,637-639.

Yang,H.-L.,Ivaslikiv,L., Chen,H.-Z.,Zubay,G. and Cashel,M. (1980) Proc.

Natl.Acad. Sci. USA, 77, 7029-7033.

Receivedon19October1984; revised on 24 October 1984