Immune response in persistent bacterial infections:
Identification of Borrelia burgdorferi sensu lato and Chlamydia pneumoniae antigens
Dissertation
zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften
an der Universität Konstanz (Fachbereich Biologie) vorgelegt von
Sebastian Bunk
Universität Konstanz Mai 2007
Tag der mündlichen Prüfung: 12. Juli 2007 Referent: Prof. Dr. Dr. Thomas Hartung
Referent: Prof. Dr. Albrecht Wendel
ACKNOWLEDGEMENTS
Acknowledgements
The work presented in this thesis was carried out between April 2004 and Mai 2007 at the Chair of Biochemical Pharmacology at the University of Konstanz under the supervision of Prof. Dr. Dr. Thomas Hartung and PD Dr. Corinna Hermann.
First, I want to thank Prof. Dr. Dr. Thomas Hartung for entrusting me with this interesting project, for his continuous support, motivation, and confidence in my work.
I especially want to thank my supervisor PD Dr. Corinna Hermann for innovative guidance, for her continuous help in every way, her enthusiasm, and for the critical reading of the manuscript.
I thank Prof. Dr. Albrecht Wendel for welcoming me into the group, for his interest in my project, the support in arranging external collaborations, and his engagement in the
“Graduiertenkolleg IRTG 1331”
I am grateful for the excellent working facilities provided at the Chair of Biochemical Pharmacology and for the opportunities I had to attend conferences.
I am indebted to the German Research Council FOR 434 for the financial support.
Many thanks go to all of my current and former lab colleagues who contributed to this work by creating an enjoyable working atmosphere. I especially would like to thank Dr. Susanne Deininger, Christian Draing and Shajahan Shaid for always giving mental support and for forcing me to share in activities outside the lab. I thank Dr. Sonja von Aulock for her scientific assistance and constructive comments. Special thanks to Dr. Thomas Meergans for many valuable discussions, inspiring ideas and for funny evenings on skat tournaments. I am grateful to our team of technicians, especially Anne Gnerlich and Annette Haas, for their excellent technical assistance and for keeping the lab running. Furthermore, the support of Gudrun Kugler and Josepha Ittner in all organizational work was very helpful.
I want to thank all the co-authors and collaborators for their valuable contributions to this work.
Finally, I would like to thank my parents, my brother and Steffi for their perpetual support and never-ending faith in me.
LIST OF PUBLICATIONS
List of Publications
Major parts of this thesis are published or submitted for publication.
• S. Bunk, M. Mueller, I. Diterich, M. Weichel, C. Rauter, D. Hassler, C. Hermann, R. Crameri and T. Hartung: Identification of Borrelia burgdorferi ribosomal protein L25 by the phage surface display method and evaluation of the protein’s value for serodiagnosis. J Clin Microbiol (2006) 44:3778-80
• S. Bunk, I. Susnea, J. Rupp, J. T. Summersgill, M. Maass, W. Stegmann, A. Schrattenholz, A. Wendel, M. Przybylski and C. Hermann: Immunoproteomic identification of novel Chlamydia pneumoniae antigens enables serological determination of persistent Chlamydia pneumoniae infections. Submitted for publication
• S. Bunk, C. Goletz, S. Zeller, N. Frey, F. Kern, J. Rupp, M. Maass and C. Hermann: Detection of Chlamydia pneumoniae-specific memory CD4+ T-cells in donors with evidence for persistent infection. Submitted for publication
• S. Bunk, S. Erath, S. Shaid and C. Hermann: Transcriptional upregulation of genes involved in peptidoglycan biosynthesis during the Chlamydia pneumoniae infection cycle. Submitted for publication
ABBREVIATIONS
Abbreviations
ACA acrodermatitis chronica atrophicans
AB aberrant body
APC allophycocyanin
bp base pairs
CCR chemokine receptor
CD cluster of differentiation
CFU colony forming units
CMV cytomegalovirus
COPD Chronic Obstructive Pulmonary Disease
CV coefficient of variation
DC dendritic cell
DNA desoxyribonucleic acid
DTT dithiothreitol
EB elementary body
EBV Eppstein Barr Virus
EDTA etylendiamintetraacetat
EIA enzyme immuno assay
ELISA enzyme-linked immunosorbent assay
EM Erythema migrans
FACS fluorescence-activated cell sorter
FCS fetal calf serum
FSC forward scatter
FITC fluorescein isothiocyanate
GE genome equivalents
HBSS Hanks balanced salt solution
HIV human immunodeficiency virus
IEF isoelectric focussing
IFN interferon
IgG immunoglobulin G
IL interleukin
IPG immobilized pH gradient
kDA kilodalton
LB Lyme borreliosis
LPS lipopolysaccharide
MALDI-FT-ICR matrix assisted laser desorption/ionization Fourier transform ion cyclotron resonance mass
ABBREVIATIONS
MEM minimal essential medium
MHC major histocompatibility complex
MIF microimmunofluorescence
MS mass spectrometry
MOI multiplicity of infection
NOD nucleotide-binding oligomerization domain
OD optical density
ORF open reading frame
PAGE polyacrylamid gel electrophoresis
PAMP pathogen associated molecular pattern
PBMC peripheral blood mononuclear cells
PBS phosphate buffered saline
PCR polymerase chain reaction
PE phycoerythrin
PerCP peridinin-chlorophyll
PGN peptidoglycan
p.i. post infection
PRR PAMP recognition receptor
RB reticulate body
rRNA ribosomal ribonucleic acid
RT room temperature
RT-PCR reverse transcription PCR
SDS sodium dodecyl sulfat
SEB staphylococcal enterotoxin B
SEM standard error of the mean
SSC side scatter
TBS Tris-buffered saline
TCM central memory T-cell
TEM effector memory T-cell
Th helper T-cell
TLR toll-like receptor
Tris tris-(hydroxymethyl)-aminomethan
Tween20 polyoxyethylensorbitan monolaurate
TABLE OF CONTENT
Table of content
1 Introduction...1
1.1 Persistent bacteria ...1
1.2 Borrelia burgdorferi sensu lato ...1
1.3 Chlamydia pneumoniae...4
1.4 Generation of T-cell memory and recall responses...9
2 Aims of the study ...11
3 Identification of Borrelia burgdorferi ribosomal protein L25 by the phage surface display method and evaluation of the protein’s value for serodiagnosis ...12
3.1 Abstract...12
3.2 Results and Discussion...12
3.3 Acknowledgments ...17
4 Immunoproteomic identification of novel Chlamydia pneumoniae antigens enables serological determination of persistent Chlamydia pneumoniae infections...18
4.1 Abstract...18
4.2 Introduction ...19
4.3 Results ...20
4.4 Discussion...28
4.5 Materials and Methods...30
4.6 Acknowledgements ...35
5 Detection of Chlamydia pneumoniae-specific memory CD4+ T-cells in donors with evidence for persistent infection ...36
5.1 Abstract...36
5.2 Introduction ...37
5.3 Material and methods...38
5.4 Results ...41
5.5 Discussion...47
5.6 Acknowledgements ...49
TABLE OF CONTENT 6 Transcriptional upregulation of genes involved in peptidoglycan
biosynthesis during the Chlamydia pneumoniae infection cycle ...50
6.1 Abstract...50
6.2 Introduction ...51
6.3 Material and Methods...52
6.4 Results ...55
6.5 Discussion...57
6.6 Acknowledgements ...59
7 Summarizing Discussion ...60
7.1 Identification of B. burgdorferi antigens by genomic phage surface display...61
7.2 Identification of C.pneumoniae antigens using immunoproteomics...62
7.3 Serology as a marker for persistent C. pneumoniae infections ...63
7.4 C. pneumoniae-specific recall responses...65
7.5 Transcriptional analysis of Chlamydia genes required for PGN synthesis ...66
8 Summary ...68
9 Zusammenfassung...70
10 Declarations of authors’ contributions...73
11 References ...75
INTRODUCTION
1 Introduction
1.1 Persistent bacteria
Chlamydia pneumoniae and Borrelia burgdorferi sensu lato belong to a group of bacteria that can establish persistent infections in humans, characterized as long-term or life-long relationship with the host. Persistence is normally established after an acute infection period and although often not clinically apparent, it can be harmful to the host.
In case of C. pneumoniae, persistent infections have been implicated in the development of chronic inflammatory diseases, such as asthma and COPD (26, 88, 141) and even more importantly, artherosclerosis (21, 40). Chronic infections with B. burgdorferi are associated with different clinical manifestations of late-stage Lyme borreliosis (LB) (235). Like other persistent bacteria, C. pneumoniae and B. burgdorferi have evolved different strategies to evade the antimicrobial defense of the host’s immune system. Immune evasion strategies include the inhabitation of an immune privileged niche or intracellular compartment, host mimicry, extensive antigenic variation and modification of immune response effector functions. These mechanisms do not only allow the bacteria to survive but also have important consequences for the development of reliable diagnostic tools or vaccination strategies. An efficient diagnosis or vaccination depends on the identification of highly immunogenic and pathogen-specific antigens, which in case of C. pneumoniae and B. burgdorferi is challenged by their immune evasion strategies (1, 14, 17). Likely due to this reason, the routine laboratory diagnosis of C. pneumoniae and B. burgdorferi infections, commonly done by serology, has important limitations regarding sensitivity and specificity. Furthermore, for both pathogens, the current diagnosis does not allow discrimination between past and persistent infection, which is needed to study the risks associated with chronic infections.
1.2 Borrelia burgdorferi sensu lato
Borrelia burgdorferi sensu lato, the etiological agent of Lyme borreliosis (LB), was first isolated in 1982 from the midgut of ticks (Ixodes scapularis) by W. Burgdorfer (36).
B. burgdorferi is a vigorously motile, helically shaped bacterium with multiple endoflagella. The cells are 10 to 30 µm in length and 0.2 to 0.3 µm in width (36). The cell wall of the Gram-negative bacteria consists of a cytoplasmatic membrane with a
INTRODUCTION
closely associated peptidoglycan (PGN) layer surrounded by the flagella. The flagella and the periplasmatic space are covered by a loosely associated, fluid-like outer membrane which contains an abundance of outer surface proteins (e.g. OspA-F). The natural reservoirs of Borrelia seem to be small rodents and birds (72, 133, 198). The bacteria can be transmitted by different arthropodic vectors that may also represent a natural reservoir. Larger animals appear to be incompetent as reservoir host (119), but may be necessary for the maintenance of the tick population (241).
Borrelia are adapted to a parasitic lifestyle, which is reflected by the lack of genes required for the synthesis of amino acids, fatty acids and nucleotides (68). The complex regulation of their protein expression dependent on different environmental conditions enables the bacteria to inhabit a broad range of warm-blooded vertebrate hosts and arthropodic vectors (55). Differential expression has been demonstrated dependent on several factors, including temperature, pH and nutrients (42, 197, 211, 228). For example, B. burgdorferi express large amounts of OspA lipoproteins inside the midgut of unfed ticks (37), but when the tick attaches to the mammalian host and begins feeding, the bacteria downregulate OspA expression and begin rapid synthesis of OspC (229). Once inside the mammalian host the transition from OspA to OspC is completed (178, 196, 228). Beside Osp’s, several other B. burgdorferi lipoprotein genes, including VlsE, DbpA, BBK32, Erp and Mlp (53, 66, 171, 196, 260) are either only expressed in the mammalian host or show a significant upregulation in that environment. It is known that surface-exposed lipoproteins play a central role for pathogenicity of the bacteria (84, 146). The expression of alternative surface lipoproteins, dependent on antibody recognition, allows Borrelia to evade humoral immune responses (145, 148). Different surface lipoproteins were also shown to bind host proteins (83, 144, 210) and immune modulator components (103, 193), which might act as molecular camouflage or to counteract humoral defense effectors. Another immune evasion strategy is the expression of antigenic variants of surface proteins, such as VlsE (13, 265).
1.2.1 B. burgdorferi as a human pathogen
In humans, infections with B. burgdorferi cause LB, a multisystemic disorder that can affect several organ systems, primarily skin, joints, nervous system and heart (235, 236). To date, about eleven different genospecies have been described of which at least three species (B. burgdorferi sensu stricto, B. afzelii, B. garinii) are pathogenic in humans. The progression of the disease can be divided into three stages, early
INTRODUCTION
localized, disseminated infection and late persistent infection (235, 236). The most characteristic clinical manifestation of the initial stage is a slowly expanding skin lesion, termed erythema migrans (EM), at the site of the tick bite. It is recognized in about 60%
to 80% of the patients (150, 235) and may be accompanied by flu-like symptoms, such as fever, headache, myalgia and arthralgia. In the second stage the bacteria disseminate throughout the body with different clinical manifestations involving multiple EM lesions, arthritis, neuroborreliosis and atrioventricular conduction defects. If left untreated, B. burgdorferi can persist for years leading to third stage manifestations, such as Acrodermatitis chronica atrophicans, chronic neuroborreliosis and chronic arthritis.
1.2.2 Diagnosis of B. burgdorferi infections
At present, diagnosis of B. burgdorferi infections is usually based on clinical manifestations of LB combined with a history of exposure to ticks (31, 235). The clinical diagnosis is commonly confirmed by serological testing, except for patients with EM.
Currently for C. pneumoniae serodiagnosis a two-step approach is recommended (1, 255). For this purpose, a serological screening assay, mostly ELISAs, is used in the first step and positive results are confirmed by immunoblot analysis. ELISAs used for the screening can be based on whole cell lysate that has been improved with respect to crossreactivity (255) or recombinant antigens. Recently, specific recombinant antigens (i.e. BBK32, DbpA and VlsE) and synthetic peptides (C6-peptide of the invariable region of VlsE) have successfully been used in the USA (9, 161, 207) and in Europe (101, 136, 143). As a confirmatory assay, specific immunoblots based on whole lysate or recombinant antigens are used (255). Recombinant antigens have certain advantages over whole cell lysate-derived antigens. Beside truncated antigens with higher specificity also in vivo expressed antigens can be used that will not be found in lysates.
Furthermore, commercially available recombinant antigen blots are better standardized than conventional blots. For the evaluation of the immunoblots, specific criteria have been defined by the Centers for Disease Control in the USA. However, in Europe these criteria cannot be used due to the different B. burgdorferi genospecies causing LB in Europe (98, 218). As for the ELISAs, the immunoblots recently have been improved by the addition of antigens, primarily expressed in vivo (i.e. VlsE and DbpA) (79, 227).
Despite recent improvements the limitations regarding sensitivity and specificity of the tests still restrict their use to support diagnosis in patients having pre-test probability for
INTRODUCTION
infection between 0.2 to 0.8 (1). To date, the cross-reactivity of borrelial antigens, the delayed appearance or even lack of measurable immune responses in the early stage of LB and the absence of a marker for persistent or active infections are the main challenges for serodiagnosis (31).
Beside serodiagnosis the cultivation of B. burgdorferi and the molecular detection of its DNA represent alternative diagnostic approaches for LB. Culture may be helpful in individual cases when the clinical picture suggest LB despite a negative antibody assay (e.g. in atypical EM, suspected acute neuroborreliosis or suspected LB in patients with immune deficiencies (1, 255). Although PCR as well as culture is highly sensitive in skin biopsy samples from patients with EM (59) such testing is not necessary, since the diagnosis can easily made by eye (1). However, both methods should be confined to specific situations and specialized laboratories (1, 31, 255).
1.3 Chlamydia pneumoniae
Chlamydia pneumoniae (also Chlamydophila pneumoniae) was first isolated in 1965 from a conjunctiva of a child in Taiwan (isolate TW183). After the genus Chlamydia was established in 1966 it was named C. psittaci before it was classified as the new species C. pneumoniae in 1989 (81, 82). More recently, a taxonomic analysis suggested splitting the genus Chlamydia into two genera, Chlamydia and Chlamydophila (62), but this classification is controversially discussed (226).
The obligate intracellular bacteria replicate in a unique infection cycle, alternating between extracellular, infectious but metabolically inactive elementary bodies (EB) and intracellular, non-infectious but metabolically active reticulate bodies (RB) (182). The infection of host cells starts with the attachment of EB, to yet poorly defined host cell receptors, followed by the internalization into a host-derived vacuole, termed the chlamydial inclusion. After internalization the EB differentiates into RB which multiplies by 8 to 12 rounds of binary fission within the inclusion. The inclusion was shown to interact with post-Golgi secretory vesicles allowing its expansion through incorporation of host phospholipids (64, 86). In the final stage of the chlamydial growth the RB redifferentiate into EB which are released from the host cell by cytolysis or extrusion of the whole inclusion (90). In case of C. pneumoniae the whole developmental cycle is completed at about 60-84h post infection (257). As an important characteristic, the bacteria are able to modify the intra- and extravacuole environment by proteins inserted
INTRODUCTION
into the inclusion membrane (10, 239) or secreted by a type III secretion system (17, 109). The ability of the bacteria to interfere with the host cell function (e.g. prevention of phagolysosomal fusion, modulation of cytokine production, MHC molecule downregulation, modification of cell death-related protein expression) plays not only an important role to evade the host mediated immune response but also represents a key feature to establish long-term persistent infections (90, 107, 263).
Persistent C. pneumoniae infections have been described in vitro as a metabolically active but non-replicating growth stage residing in a long-term relationship with the host cell (19). In vitro, persistence can be established with different treatments or conditions, such as with cytokines (18, 170, 240), antibiotics (46, 166, 257), deprivation of nutrients (5, 47, 96) or continuous infection (134). The majority of these in vitro models share the same altered chlamydial growth characteristics during persistence, such as a loss of infectivity and small inclusions which are accompanied by comparable ultrastructural changes with enlarged pleomorphic RB, that are inhibited in binary fission and their redifferentiation into EB.
1.3.1 C. pneumoniae as a human pathogen
Chlamydia pneumoniae is a widespread pathogen which can cause respiratory tract and systemic infections in humans. Exposure to this pathogen is extremely common and infections occur repeatedly among most people. The prevalence of antibody titers to C. pneumoniae increases from the age of five, were the first seroconversions occur, to 50% by the age of 20 and continuously rise to 75% seropositives in the elderly population (80). C. pneumoniae, which spread via aerosol droplets in close personal contact, is believed to infect mainly the upper respiratory tract (91) causing mild symptoms or even asymptomatic infections (78, 80, 87, 174). Notably, the pathogen has been associated with about 10% of lower respiratory tract infections, including community-acquired pneumonia, but this incidence is controversially discussed (132).
Persistent infections have been described in humans (63, 92, 173) and animal data also support the existence of latent C. pneumoniae infections (20, 108, 137, 162, 262).
Persistent infection with C. pneumoniae has been associated with chronic inflammatory diseases, such as asthma and COPD (20, 108, 137, 162, 262) and more importantly with cardiovascular diseases (21, 40). Evidence for the latter association has emerged from nearly 40 studies in which the pathogen could be detected in atherosclerotic tissue, partially even in a viable state (21, 40). Furthermore, this association is
INTRODUCTION
strengthened by animal models (39, 110, 175, 185) as well as in vitro studies demonstrating that infection of different cell types (e.g. monocytes/macrophages, vascular endothel or smooth muscle cells) leads to similar processes known to be involved in atherogenesis. To date it is assumed that C. pneumoniae disseminate from the respiratory tract via infected phagocytes (75, 159, 176) or T-lymphocytes (125) and exhibit tropism to arterial vasculature (70).
The first evidence for a link between cardiovascular diseases and prior infection with C. pneumoniae came from a serological study in 1988 by Saikku et. al. (222). In this study individuals with higher antibody titers to C. pneumoniae were found to have an increased risk for myocardial infarction and coronary artery disease. Although many seroepidemiological studies confirmed the link between C. pneumoniae and atherosclerosis, several large prospective studies found no association (28, 112).
Contradicting results stem also from antibiotic treatment trials (28, 112). For the latter two study types the diagnosis of C. pneumoniae infection was mostly based on serology leading to substantial limitations in the interpretation of the results due to the inherent problems of the current C. pneumoniae serodiagnosis that is not able to discriminate between past and persistent infection.
1.3.2 Diagnosis of C. pneumoniae infections
To date, a reliable diagnosis of respiratory and systemic infection with C. pneumoniae remains difficult because of the lack of standardization of commercially available tests (28, 132). Many studies used different diagnostic tools and criteria leading to extensive variations of the incidence of C. pneumoniae infections. As an example, the portion of lower respiratory tract infections due to C. pneumoniae, including community-acquired pneumonia, varied from 0% to 17% in adults and from 3% to 45% in childrens when analyzing studies from the last five years (132). Commonly, the diagnosis of C. pneumoniae infection is based on (i) serologic testing, but also (ii) culture or (iii) PCR-based detection methods have been used:
(i) Serologic methods include microimmunofluorescence (MIF) tests and enzyme immuno assays (EIA) or enzyme-linked immunosorbent assays (ELISA). In a recent standardization workshop, the MIF was considered the only acceptable serological test (58). The MIF uses immobilized chlamydial EB as antigen preparation allowing the quantitative determination of IgM, IgA and IgG antibodies bound to the EB. As recommended, criteria for an acute infection (58) include a fourfold rise in the IgG titer
INTRODUCTION
or an IgM titer of ≥ 16. A past infection is indicated in individuals having an IgG titer of
≥ 16. Despite the MIF is recommended, the test suffers from important limitations, such as subjective interpretation, cross-reactivity between different chlamydial species and interlaboratory variations (28, 104, 151, 205). Further, the MIF has been demonstrated to be insensitive in studies including patients with culture confirmed infection, particularly in children (97, 135) but also in adults (93). Although EIAs or ELISAs based on recombinant antigens may overcome these limitations by being more sensitive, objective and less technically complex, the development of reliable assays is hampered by the poor knowledge about species-specific and highly immunogenic antigens of C. pneumoniae.
Although the C. pneumoniae-specific antibody response has been characterized by immunoblotting (41, 61, 113, 120) only a few major antigens (i.e. MOMP, OMP2 and CrpA) have been identified so far (128, 187, 258). The antigenic properties of MOMP, which are controversial (41, 113, 120), were shown to be conformation-dependent (61, 258), hampering its use as recombinant antigen. Furthermore, C. pneumoniae OMP2 and CrpA, which were found to be highly immunogenic, displayed strong cross-reactivity with C. trachomatis-positive sera (128).
(ii) Although culture is essential for further biological and molecular characterization of clinical isolates, its use for routine diagnosis is not recommended (132). The major limitations of this approach stem from the difficulty in growing C. pneumoniae, especially from tissue samples (58) leading to variable results depending on the methodology (156, 252) and a questionable sensitivity (71).
(iii) The PCR-based detection of C. pneumoniae DNA in clinical samples has been demonstrated by various investigators. Most of the studies used different protocols that lack appropriate standardization and validation (28, 132). As a consequence, PCR-based assays reveal extensive variations when compared in multicenter studies (7, 44, 152) which limits their use for routine diagnosis.
1.3.3 Immune recognition of C. pneumoniae and role of chlamydial peptidoglycan The initial recognition of invading pathogens by the innate immune system is crucial for the subsequent induction of efficient defense mechanisms. Innate immune cells are equipped with specific receptors that recognize highly conserved and unique pathogen- specific structures, termed “pathogen associated molecular patterns” (PAMPs). The most prominent PAMP recognition receptors (PRR) are the Toll-like receptors (TLRs)
INTRODUCTION
(3, 4) and the recently identified nucleotide-binding oligomerization domain (NOD) proteins (43, 116). For C. pneumoniae, the activation of immune cells was found to be dependent on TLR2 and TLR4 (34, 54, 184, 190). Whereas the TLR2 receptor mainly recognize lipoteichoic acid of Gram-positive bacteria (105, 180), the TLR4 receptor is crucial for the detection of lipopolysaccharide (LPS), the main immunostimulatory principle of Gram-negative bacteria (216). Compared to prototypical Gram-negative bacteria, the lipopolysaccharide from C. pneumoniae seems to be a less potent immune activator (102, 114). The lower potency of chlamydial LPS might explain the observations that TLR2 is more important for the recognition of Chlamydia than TLR4 (209). However, it was demonstrated that the Chlamydia-induced cytokine induction and activation of immune cells can also occur via TLR-independent mechanisms (189, 191, 220), likely due to the involvement of NOD proteins.
NOD1 and NOD2 are cytosolic PRR that recognize muropeptides, the building blocks of PGN (76, 77, 115). Recent studies demonstrated that upon chlamydial infection epithelial and endothelial cells are activated in a NOD1- and NOD2-dependent fashion (200, 253) suggesting the involvement of PGN precursors in the immune recognition of C. pneumoniae. The existence of PGN in Chlamydia has been debated for a long time.
Although Chlamydia are sensitive to ß-lactam antibiotics that target PGN synthesis as well as encode penicillin-binding proteins which are involved in the assembly of PGN, numerous attempts to detect PGN remained unsuccessful (45, 73). This paradox has been described as the “Chlamydia anomaly” (183). In the light of the available genome sequences that revealed a nearly complete set of genes for biosynthesis of PGN of which some were shown to be functional (106, 168, 169) the “chlamydial anomaly” is still being debated.
Beside the existence of Chlamydia PGN by itself several other points, such as when, where and why is PGN synthesized, remain to be elucidated. It was proposed that, unlike for prototypical bacteria, the Chlamydia PGN is not primarily involved in maintaining the integrity of the cell wall, but has an important role in the cell division (167) which is achieved by the formation of a septum between dividing RB (33). In addition, the fact that Chlamydia-infected cells were activated via cytosolic NOD proteins suggesting that chlamydial muropeptides can cross the inclusion membrane, led to a further intriguing hypothesis: It was suggested that these muropeptides were actively transported into the host cell cytosol to manipulate the immune response, possibly to induce persistence by activating the cells (155).
INTRODUCTION
1.4 Generation of T-cell memory and recall responses
Immunological memory represents the basis of the protective immunity that in general is acquired after the first encounter with a pathogen. It results from the clonal expansion and differentiation of antigen-specific B- and T-lymphocytes and may persist lifelong. In the B-cell system protection is mediated by long-lived antibody-secreting plasma cells and memory B-cells that proliferate and differentiate into plasma cells in response to secondary antigenic stimulation (163, 195, 233). In the T-cell system protection results also from two distinct cell populations, the effector memory T-cells (TEM) and central memory T-cells (TCM). Whereas TEM mediate rapid effector functions, such as production of TH1 or TH2 cytokines or cytotoxic effector functions, TCM readily proliferate and differentiate into TEM after antigenic stimulation (139, 224).
1.4.1 Generation of antigen-specific memory T-cells
The generation of antigen-specific memory T-cells is initiated in the peripheral lymphoid organs when mature naïve T-cells encounter their specific antigen. To become activated, naïve T-cells need to interact with dendritic cells (DCs) that are specialized for antigen presentation via major histocombatibility complex (MHC) class I and II. The T-cell activation depends mainly on cytokines and the signal strength of interaction with the DC, which can vary widely, depending on the antigen load of DCs, expression of costimulatory molecules or the duration of interaction. It has been proposed that the strength of the signal initially determines the differentiation program of the naïve T-cells that in consequence leads to different memory T-cell populations (140, 223). Strong signals promote the development of effector T-cells of which a small portion will gain memory characteristics (TEM) after successful elimination or control of the pathogen. In contrast, weak signals result in the generation of non-effector T-cells, which develop into TCM following a contraction phase post infection. The phenotype of the functionally distinct TCM and TEM populations can be differentiated according to their expression of homing receptors, such as CCR7 and CD62L. While TCM constitutively express CCR7 and CD62L allowing migration to secondary lymphoid organs (165, 215, 224), TEM lack the expression of CCR7 and are heterogeneous for CD62L (223). Despite TCM express lymphocyte homing molecules they are also present in non-lymphoid compartments. In the blood, TCM cells are even the dominant population among CD4+ T-cells (95, 223).
Unlike in mice, where TEM might represent a part of a linear differentiation pathway into T (254), in humans T and T represent stable populations of memory T-cells (15,
INTRODUCTION
217). Nevertheless, TCM can develop into TEM after secondary antigenic stimulation. TEM
and TCM can both rapidly produce cytokines after antigenic stimulation, a process termed recall response. Following T-cell receptor trigger, TEM produce IFN-γ or IL-4 and IL-5. In contrast, TCM produce mainly IL-2, but after differentiation into TEM they also efficiently produce IFN-γ or IL-4. Recently, it was demonstrated that the transition from TCM to TEM leads to an intermediate population of T-cells (TIM) expressing both, IFN-γ and IL-2 (94, 95). Interestingly, the investigators found that under different conditions of antigen exposure, including pathogen persistence, three distinct patterns of antigen- specific memory CD4+ T-cells could be distinguished, which can be attributed to the presence of the three memory T-cell populations, TCM, TEM and TIM. While a dominant population of single IL-2 producing T-cells (TCM) was associated with antigen clearance, single IFN-γ producing T-cells (TEM) were rather found in models with high level antigen persistence or acute infections. In addition, in protracted antigen persistence, which is found in many persistent viral infections, a third dominant population was found producing IL-2 and IFN-γ (TIM).
1.4.2 Antigen-specific recall responses
The rapid production of cytokines upon stimulation with specific antigens (recall responses) is characteristic for memory T-cells. Antigen-specific recall responses can be analyzed by flow-cytometric multiparameter analysis after ex vivo stimulation of PBMC with recombinant proteins, peptides or lysate from pathogens (208, 248). In cytomegalovirus (CMV) and EBV infections, it was shown that the proportion of virus- specific T-cells increases with age and may comprise a substantial proportion of the total T-lymphocyte pool in the elderly (124, 199, 249). Monitoring pathogen-specific memory T-cells represents a helpful diagnostic tool, especially for infections that lack a reliable and fast diagnosis based on other criteria, such as detection of antibodies. The rational behind this is that the prolonged antigenic stimulation found during persistent infections efficiently triggers the proliferation of memory T-cells leading to an expansion of these population. As an example, the T-cell response against mycobacterial ESAT-6 can be used for the diagnosis of present or past infections with Mycobacterium tuberculosis (111, 204, 242).
AIMS OF THE STUDY
2 Aims of the study
Two of the most common persistent bacterial infections in Europe do not yet offer adequate serology, which appears to be linked to unique immune responses due to immune evasion strategies of these bacteria. This thesis aims to understand the respective immune responses and to identify relevant antigens for diagnosis.
Infections with Borrelia burgdorferi sensu lato, the etiological agent of LB, are diagnosed based on clinical manifestations and confirmation by serological tests that have shortcomings with regard to sensitivity and specificity. The use of new specific and highly immunogenic antigens might overcome these limitations.
• The aim of the first part of this thesis was to identify novel B. burgdorferi antigens by employing phage surface display technology
Infections with Chlamydia pneumoniae are very common and persistent infections, established after dissemination from the respiratory tract, have been associated with chronic inflammatory diseases, such as atherosclerosis. Serology is commonly used as a marker for infection, but a reliable diagnosis remains difficult because of the lack of standardized commercially available tests and the limited knowledge about C. pneumoniae antigens. Importantly, Chlamydia serology cannot discriminate between past and persistent infection, a prerequisite to study the role of C. pneumoniae in chronic diseases. The identification of C. pneumoniae antigens as well as persistence-associated antigens might provide the basis for a more reliable serodiagnosis able to discriminate past from persistent identions.
• In the second part of this thesis we aimed to identify immunodominant antigens of C. pneumoniae and to analyze whether donors with evidence for persisting infections hava a characteristic antibody response pattern, by using a proteomic approach combined with immunoblotting.
• The aim of the third part was to investigate whether C. pneumoniae-induced T-cell responses in PBMC determined by flow-cytometric analysis can be used as a marker for persistent infections
Recent findings suggested that the innate immune recognition of PGN has a key role in the onset of antigen-specific T-cell responses and subsequent production of antibodies.
However, the existence of PGN in Chlamydia is still being debated.
• The aim of the fourth part of this thesis was to analyze whether and when the C. pneumoniae enzymes proposed to be involved in chlamydial PGN biosynthesis were transcribed during the infection cycle.
IDENTIFICATION OF BORRELIA BURGDORFERI ANTIGENS
3 Identification of Borrelia burgdorferi ribosomal protein L25 by the phage surface display method and evaluation of the
protein’s value for serodiagnosis
Sebastian Bunk 1, Markus Mueller 1, Isabel Diterich 1,Michael Weichel 2, Carolin Rauter 1, Dieter Hassler 3, Corinna Hermann 1, Reto Crameri 2 and Thomas Hartung 1,4
1University of Konstanz, Biochemical Pharmacology, Germany
2Swiss Institute of Allergy and Asthma Research, Switzerland
3Private Practice, Kraichtal, Germany
4ECVAM, EU Joint Research Centre, IHCP, Ispra, Italy
Journal of Clinical Microbiology
3.1 Abstract
The phage surface display technique was used to identify Borrelia burgdorferi antigens.
By affinity selection with immunoglobulin G from pooled sera of six Lyme borreliosis (LB) patients, the ribosomal protein L25 was identified. The diagnostic value of L25 was investigated by an enzyme-linked immunosorbent assay using sera from 80 LB patients and 75 controls, the use of the protein resulted in a specificity of 99% and a 23%
sensitivity, which qualify L25 as a useful antigen when combined with others.
3.2 Results and Discussion
Lyme borreliosis (LB) is increasingly recognized to cause chronic manifestations such as arthritis, neurological disorders, skin manifestations and arrhythmia (235, 236).
Commonly, LB diagnosis is based on clinical signs and is confirmed by serological findings. For serodiagnosis a two step process, including an enzyme-linked immunosorbent assay (ELISA) followed by Western immunoblot analysis, is recommended in Europe and the United States. Serological tests are widely used, despite several shortcomings, such as heterogeneity of antigen preparation and lack of
IDENTIFICATION OF BORRELIA BURGDORFERI ANTIGENS
standardization causing interlaboratory variations (32, 214). Furthermore, serological tests show insensitivity in the early stages of LB (9, 136). It is well established that Borrelia species express different surface components depending on temperature (211, 237), pH (42, 211) and cell density (261). Through differential gene expression, the pathogen is able to adapt to different hosts and to evade immune responses (145, 146).
Therefore, assays using antigens derived from Borrelia cultures might not represent antigens, which are selectively expressed in the human host. Recent studies with the recombinant proteins BBK32 and VlsE as well as two synthetic peptides have proven to be superior to assays, currently used for LB serodiagnosis (9, 136, 227).
In the present study, we used pJuFo phage surface display method (51) to identify Borrelia antigens with affinity for immunoglobulin G (IgG) from Borrelia-infected patients.
This technology has previously been applied successfully to identify allergens from cDNA libraries of Aspergillus fumigatus (49), Cladosporium herbarum (251), peanuts (127) and mites (60) by employing IgE antibodies from patients. Genomic phage surface display libraries of three different Borrelia strains and one mixed library consisting of all three strains were constructed by helper phage superinfection according to a published protocol (11). The strains (Borrelia burgdorferi N40, Borrelia afzelii VS461 and Borrelia garinii PSTH), which were kindly provided by T. Kamradt (Berlin, Germany) were grown in BSK-H medium (Sigma-Aldrich, Deisendorf, Germany) as described previously (56), and the genomic DNA were purified (QiaAmp tissue kit;
QIAGEN, Hilden, Germany). The DNAs were partially digested with MboI, ligated into BglII-restricted pJuFo vector (51), and electrotransformed into Escherichia coli XL1- Blue. Recombinant phage were enriched by five cycles of affinity selection with a pool of sera from six LB-patients (table 1). Microtiter plates were coated with anti-human-IgG monoclonal antibodies (Zymed Laboratories Inc., San Francisco, USA), blocked with 3% non-fat dry milk, and incubated with LB sera (20 µl/well in 80 µl Tris-buffered saline) overnight at 4°C. After washing of the plates, 1,8 x 1011 - 1,6 x 1012 CFU of each library were separately added and incubated for 2h at 37°C. After 10 (cycle one to three) or 20 (cycle four and five) consecutive washing steps, adherent phage were eluted by pH-shift (100 mM glycine/HCl, pH 2,2), and E. coli were reinfected for further cycles of affinity enrichment. The phage enrichment was monitored by titration of ampicillin resistant CFU.
After five cycles of selection, the phagemid DNAs from 124 randomly picked E. coli clones were analyzed by restriction with PstI and sequencing. Fifty clones contained
IDENTIFICATION OF BORRELIA BURGDORFERI ANTIGENS
Borrelia sequences with incorrect orientation in the pJuFo vector, and three clones could not be correlated with any published Borrelia sequence. Among the remaining clones with Borrelia specific sequences, 10, 14, 4 and 43 were derived from the B. burgdorferi, B. garinii, B. afzelii and the mixed library, respectively. These clones carried inserts of 16 different sizes, which could be matched with nine genomic sequences of B. burgdorferi B31, namely BB0182, BB0272, BB0335, BB0371, BB0713, BB0786, BBA26, BBK32 and BBL38. One sequence encoded the fibronectin binding protein BBK32, a well established immunogenic protein (65) with high potential as a target for serodiagnosis of human LB (101, 136). Another sequence identified from the B. burgdorferi and the mixed libraries encoded the ribosomal protein L25. This protein is part of the 50S ribosomal subunit that binds to a specific portion of the 5S rRNA called loop E (238). Although L25 has conserved regions involved in RNA binding (238) the amino acid residues interacting with the 5S rRNA show no conservation among different eubacterial species (153). Among Borrelia species, the deduced amino acid sequence of L25 from B. burgdorferi N40 is 98% and 90% identical with those from B. burgdorferi B31 and B. garinii PBi, respectively.
Patient Age Tick bite
recall Erythema
migrans ELISA-titer IgG Western blot reactivity
to bands LB-symptom
1 61 + + 1:320 39,41,58,66,75,100 Lyme arthritis (knee) myocarditis
2 35 - - 1:80 30,41,58,100 Lyme arthritis (knee,
elbow), arthralgia
3 58 - - 1:640 17,30,35,41,58,75,100 Lyme arthritis
4 35 - - 1:40 58 Lyme arthritis, ACA
5 59 + - 1:160 30,58,75,100 Lyme arthritis (knee,
fingers), neuropathy 6 28 - - 1:80 25,30,39,41,58,66,75,100 Lyme arthritis (knee),
palpitationen
Table 1 Clinical data for six panning pool sera from LB patients
Six patients with LB were selected by an experienced general practitioner (D. Hassler). The clinical diagnosis was confirmed by ELISA and Western blot analysis.
In order to investigate the diagnostic value of L25, the protein was expressed as six-histidine-tagged recombinant protein in E. coli M15 (QIAGEN). As a control the antigenic protein OspC was expressed in E. coli BL21 (Stratagene, La Jolla, USA). The full length coding sequence of L25 was amplified from the genomic DNA of B. burgdorferi N40 by polymerase chain reaction (PCR) with primers including a BamHI
IDENTIFICATION OF BORRELIA BURGDORFERI ANTIGENS
and KpnI site (forward primer, CGGGATCCGGACGTCGACAAGTGGTAAG; reverse primer GGGGTACCAAATCACTTTATAATAACAACTTCC) and then ligated into pQE30 expression plasmid (QIAGEN). The sequence of OspC was amplified with the primers (CCGGAATTCATGAAAAAGAATACATTAAGTGC;
CCGCTCGAGCTTATAATATTGATCTTAATTAAGG) including an EcoRI and a XhoI site and then ligated into the pTYB12 plasmid (New England Biolabs, Ipswich, USA). Protein expression of L25 and OspC was induced for 20h at 16°C. Recombinant L25 (rL25) was purified by Ni2+ chelate affinity chromatography in the presence of 8M urea and rOspC was purified according to the manufacturer’s instructions (NEB) with an elution buffer containing 8M urea. For serological analysis 80 serum samples from patients with late stage LB, i.e., Lyme arthritis, neuroborreliosis, or acrodermatis chronica atrophicans (ACA), were collected in the southwest of Germany by an experienced physician. The diagnosis of LB was based on characteristic clinical findings, a history of exposure and an antibody response, which was further confirmed by IgG ELISA based on a C6 peptide antigen of the VlsE protein (147). The peptide with the sequence CMKKDDQIAAAMVLRGMAKDGQFALK was synthesized in the Department of Analytical Chemistry (Prof. M. Przybyslki, University of Konstanz, Germany). Control serum samples from 75 healthy donors without any signs of LB and no serum reactivity against the C6 peptide were collected in the same area of Germany.
For the determination of anti-rL25 and anti-rOspC antibodies, specific ELISA were established and optimized. In brief, the wells of a microtiter plate (Nunc) were coated with 0.5 µg recombinant protein overnight at 4°C. After being washed with PBST (10 mM sodium phosphate, 140 mM NaCl, 0,1% Tween 20), the wells were blocked with 5% non-fat dry milk for 2h. Human serum samples were diluted 1:200 in blocking solution, and 100 µl was added to the wells for 3h. After four washing steps, the wells were incubated with 100 µl horseradish peroxidase-conjugated rabbit anti-human IgG antibody (Dako, Denmark) diluted 1:5000 in blocking solution for 45 min. The substrate (3,3’,5,5’-tetramethylbenzidine, Sigma-Aldrich) was added after eight washing steps.
The reaction was stopped with 50 µl 1 M H2SO4 and the optical density (OD) was measured at 450 nm. To determine the specific reactivities of rL25 and rOspC, each OD value for serum samples added to wells coated with the negative control (chromatography elution fractions of lysates from E. coli M15 or BL21 transformed with pQE30 or pTYP12) was subtracted from OD values for serum samples added to wells coated with the respective protein of interest. The cutoff value for each protein
IDENTIFICATION OF BORRELIA BURGDORFERI ANTIGENS
evaluated by ELISA was defined as the mean OD plus three standard deviations of all control sera. As shown in Figure 1, rL25 specifically bound IgG antibodies in serum samples from LB patients. For the LB patients, 18 of 80 of serum samples were positive when rL25 was used as antigen and 54 of 80 were positive for rOspC, resulting in a sensitivity of 23% and 68%, respectively. Of the 75 control serum samples, only one reacted with rL25 and another reacted with rOspC, corresponding to a specificity of 99%
for both antigens. Even though a substantial number of patient sera showed only reactivity with the more sensitive rOspC antigen, 7 of 80 samples reacted exclusively with rL25, which might be of potential value for the serodiagnosis of late-stage LB.
Figure 1 Evaluation of the diagnostic value of recombinant L25 and OspC
IgG ELISA OD values for reactivities of rL25 (BB0786) and rOspC from B. burgdorferi N40 with serum samples from 80 patients with different phases of LB and 75 control (CO) serum samples from healthy blood donors. The cutoff value (mean for control serum samples plus 3 standard deviations) is indicated by a horizontal line.
The observed sensitivity of 68% for rOspC in IgG serology was higher than those reported for other European seroepidemiological studies (99, 203) but was in agreement with results from North American studies (160, 161), where an OspC protein with a sequence 99% to ours was used. To our knowledge, the diagnostic value of L25 has not been recognized so far. It can be assumed that our patients acquired LB in Europe. For the southwest region of Germany, we have recently shown that the predominant genospecies in ticks were B. burgdoferi (11%), B. garinii (18%) and B. afzelii (53%), while mixed infections (18%) also occur (213). Although the available sequence data indicate that L25 is rather conserved among species, we cannot exclude that the use of B. garinii or B. afzelii L25 would lead to increased sensitivity. However, the low sensitivity of L25 limits its ability as a stand-alone diagnostic antigen, while its
IDENTIFICATION OF BORRELIA BURGDORFERI ANTIGENS
high specificity qualifies the protein as a useful antigen for LB serodiagnosis when combined with other antigens. The nucleotide sequence of L25 from B. burgdorferi N40 has been submitted to GenBank database with the accession number DQ400710.
3.3 Acknowledgments
We thank Claudio Rhyner and Sabine Flückiger for helpful discussions and laboratory/technical support. We thank Sonja von Aulock for a critical reading of the manuscript. Work at SIAF was supported by the Swiss National Science Foundation Grant no. 3100.063381.00.
IDENTIFICATION OF CHLAMYDIA PNEUMONIAE ANTIGENS
4 Immunoproteomic identification of novel Chlamydia pneumoniae antigens enables serological determination of persistent
Chlamydia pneumoniae infections
Sebastian Bunk 1, Iuliana Susnea 2, Jan Rupp 3, James T. Summersgill 4, Matthias Maass 5, Werner Stegmann 6, André Schrattenholz 6, Albrecht Wendel 1,
Michael Przybylski 2 and Corinna Hermann 1
1Department of Biochemical Pharmacology and 2Analytical Chemistry, University of Konstanz, D-78457 Konstanz, Germany; 3Institute of Medical Microbiology and Hygiene, University of Luebeck, D-23538 Luebeck, Germany; 4Division of Infectious Diseases, Department of Medicine, University of Louisville, Kentucky, USA; 5Institute of
Medical Microbiology, Hygiene and Infectious Diseases, Paracelsus Private Medical University and University Hospital Salzburg, A-5020 Salzburg, Austria; 6ProteoSys AG,
D-55129 Mainz, Germany
Submitted for publication
4.1 Abstract
The controversial discussion about the role of Chlamydia pneumoniae in chronic inflammatory diseases cannot be solved without a reliable diagnosis, which allows discrimination between past and persistent infections. Using a proteomic approach and immunoblotting we identified 31 major C. pneumoniae antigens, originating from 27 different C. pneumoniae proteins. About half of the proteins represent Chlamydia antigens not described before. Using a comparative analysis of spot reactivity Pmp6, OMP2, GroEL, DnaK, RpoA, EF-Tu as well as CpB0704 and CpB0837 were found to be immunodominant. Comparison of antibody response patterns of sera from subjects with and without evidence for persisting C. pneumoniae, determined by PCR analysis of PBMC and vasculatory samples, resulted in differential reactivity for twelve proteins, which is not reflected by reactivity of the sera in the microimmunofluorescence test, the current gold standard for serodiagnosis. While reactivity of sera from PCR-positive donors was increased for RpoA, MOMP, YscC, Pmp10, PorB, Pmp21, GroEL, and
IDENTIFICATION OF CHLAMYDIA PNEUMONIAE ANTIGENS
Cpaf, reactivity was decreased for YscL, Rho, LCrE, and CpB0837, which reflects the altered protein expression of in vitro models of C. pneumoniae persistence. These data provide first evidence for serological differences associated with the status of C. pneumoniae infection which is a prerequisite for the identification of persistently infected patients.
4.2 Introduction
The respiratory pathogen Chlamydia pneumoniae (Chlamydophila pneumoniae) occurs worldwide with a seroprevalence up to 70% (80). After primary infection, this obligate intracellular bacterium can persist in the host (90, 107). Persisting C. pneumoniae are frequently found in the respiratory tract (164, 173, 259) or in atherosclerotic blood vessels (121, 123, 157, 194, 212), and their presence is therefore a potential risk factor for chronic inflammatory lung diseases (26, 88, 141) as well as for atherosclerosis (40).
To date, it is assumed that C. pneumoniae disseminate from the respiratory tract via infected phagocytes (75, 176), which are found to contain C. pneumoniae even in healthy volunteers (8, 29, 74).
While the direct detection of the pathogen in atherosclerotic plaques, as well as animal models, and in vitro data support the hypothesis that C. pneumoniae is involved in atherogenesis at some stages (40), confusing results stem from seroepidemiological studies and treatment trials, where the stratification of donors was based only on serologic criteria. The first study of Saikku et. al. showing a link between coronary artery disease and serological evidence for a past infection with C. pneumoniae (222) was followed by many others, and today the number of reports showing a positive association is similar to the number of reports that show the opposite. These inconsistencies can likely be attributed to the poor validity of current C. pneumoniae serodiagnosis (6, 28, 104, 112). Although the microimmunofluorescence (MIF) assay, which is based on whole C. pneumoniae elementary body (EB), is considered as the
“gold standard” for C. pneumoniae serology (58) the test suffers from subjective interpretation, cross-reactivity between different Chlamydia species and high intra- as well as interlaboratory variations (6, 28, 104, 112, 205). Moreover, it does not correlate with the presence of C. pneumoniae in the host (16, 24, 25, 158, 212) and obviously cannot discriminate past from persistent infections. A way to overcome these diagnostic shortcomings is opened by using a more standardized and non-subjective test based on
IDENTIFICATION OF CHLAMYDIA PNEUMONIAE ANTIGENS
individual specific antigens of C. pneumoniae. Furthermore, the use of antigens that are differentially expressed during acute versus persistent infection might allow the diagnosis of persistently infected individuals which is an important prerequisite for clinical studies investigating the role of C. pneumoniae infections.
Although the C. pneumoniae-specific antibody response has been characterized by immunoblotting (41, 61, 113, 120) only a few major antigens (i.e. MOMP, OMP2 and CrpA) have been identified so far (128, 187, 258). The antigenic properties of MOMP, which are controversial (41, 113, 120), were shown to be conformation-dependent (61, 258), hampering its use as recombinant antigen. Furthermore, C. pneumoniae OMP2 and CrpA, which were found to be highly immunogenic, displayed strong cross-reactivity with C. trachomatis-positive sera (128). Taken together, very little information is available regarding C. pneumoniae antigens that could be of use for serodiagnosis.
We have chosen a proteomic approach, combined with immunoblotting to analyze the antibody response pattern of different donors whose C. pneumoniae infection status was defined by MIF assay and by the detection of C. pneumoniae-DNA by PCR. This work, in which numerous new C. pneumoniae antigens were identified, also provides new evidence for a characteristic antibody response pattern found in donors persistently infected with C. pneumoniae.
4.3 Results
4.3.1 Immunoblot analysis
In order to identify and analyze C. pneumoniae antigens, 2-D gel electrophoresis was performed in combination with immunoblotting and peptide mass fingerprinting. The 2-D gels were prepared in parallel under identical conditions using equal amounts of protein extracted from the same batch of C. pneumoniae EB. In each run three 2-D gels were used for immunoblotting and one gel was stained with colloidal Coomassie. In Figure 2, a representative 2-D gel of separated C. pneumoniae proteins is shown. Using non-linear pH 3 to pH 10 IPG strips about 500-600 protein spots were resolved in a molecular mass range from 15 to 130 kDa, which is in agreement with other studies (177, 243). Immunoblots were prepared using 38 sera with different C. pneumoniae antibody titers that were tested negative for C. trachomatis and C. psittaci antibodies by MIF. The reproducibility of the blots was confirmed in independent experiments.
IDENTIFICATION OF CHLAMYDIA PNEUMONIAE ANTIGENS
Figure 2 Two dimensional electrophoretic map of C. pneumoniae proteins
C. pneumoniae proteins were separated by 2-D gel electrophoresis and stained with colloidal Coomassie. The protein spots marked with a number where identified by mass spectrometry analysis (see Table 2).
For blot analysis, the maximal intensity of each spot was determined using a Luminescent Image Analyzer and spots with an intensity of ≥ 500 were considered as immunoreactive. Of the 38 sera tested, a total of 75 reactive spots or spot series were detected. In case of spot series, first, the signal intensity of the main spot was determined. Then, for each detected spot, the reactivity which corresponds to the frequency and intensity of recognition by different donors was calculated. The analysis of the 38 immunoblots revealed 43 spots that exhibited a reactivity of more than 2%.
From these 43 prominent antigenic spots, 42 could be correlated with proteins in the respective 2-D gels and selected proteins are marked with corresponding spot numbers
IDENTIFICATION OF CHLAMYDIA PNEUMONIAE ANTIGENS
in Figure 2. One antigenic spot could not be detected in the 2-D gel, which is likely due to the lower detection limit for proteins in the immunoblots, as compared to Coomassie staining.
Functional class Protein (short)
ORF CpB
Spot Nr.
Protein C.p. TW183 SL. Freq.
n=38
React.
[%]
Cell envelope OMP2 0579 1 60 KDa cysteine-rich OMP + 27 25.6
MOMP 0722 38 MOMP, pI 4.5 – 4.7 + 10 9.4
MOMP 0722 17 MOMP, pI 6.0 – 7.5 + 13 9.0
PorB 0883 53 Outer membrane protein B* + 7 5.3
Pmp’s Pmp2 0015 18 Outer membrane protein 7* 7 5.6
Pmp6 0460 45 Outer membrane protein 11* + 23 18.0 Pmp10 0467 23 Outer membrane protein 5* + 12 8.3 Pmp21-n 1000 36 OMP11, ~70kDa n-terminus + 6 3.8 Pmp21-m 1000 9 OMP11, ~55kDa middle part* + 13 9.4 Pmp21-c 1000 10 Omp11, ~45kDa c-terminus* + 10 8.3
Transport related LcrE 0334 12 Low calcium response E (CopN)* + 10 9.4 YscL 0855 24 Type III translocation protein L* 9 4.9 YscC 0729 57 Outer membrane secr. protein Q* 7 4.9
Chaperones GroEL 0135 4 Chaperonin GroEL 23 19.5
DnaK 0523 6 Molecular chaperone (HSP70) + 15 11.3
Transcription Rho 0634 28 Transcription termination factor 7 4.9 RpoA 0652 14 RNA polymerase alpha chain 13 10.9
Translation EF-Tu 0074 13 Translation Elongation Factor Tu 28 25.2
RplL 0080 51 ribosomal protein L7/L12 3 4.9
RpsA 0325 5 ribosomal protein S1 7 4.9
Rs2 0723 59 ribosomal protein S2* 3 2.3
Energy metabolism DhnA 0289 39 Fructose bisphosphate aldolase 5 2.3 PdhC 0315 11 Dihydrolipoamide acetyltransfer*. 3 3.4
Mixed PepA 0397 65 Leucyl aminopeptidase* + 3 2.6
PyrH 0725 56 Uridylate kinase 3 2.3
RecA 0790 31 Recombinase A 7 6.0
Cpaf-n 1054 44 CPAF, ~25kDa n-terminus 4 2.3
Cpaf-c 1054 26 CPAF, ~40kDa c-terminus* 7 7.9
Hypothetic proteins CpB0546 0546 37 Hypothetical protein* + 10 7.1 CpB0704 0704 30 Hypothetical protein (YwbM) 27 30.1 CpB0837 0837 33 Hypothetical protein (CopD)* 18 13.9
Table 2 List of identified C. pneumoniae antigens and their antigenic potential.
Identified proteins are listed according their functional class; short protein name; gene number;
spot number and protein name in C. pneumoniae TW183. The nomenclature was carried out according to published databases (NCBI, TIGR). For all identified antigens the surface- localization on C. pneumoniae-EB (SL) according to Montigiani et. al. (179), the number of reactive sera (Freq.) and the reactivity (React.) is shown. The reactivity [in %] was calculated as the sum of the intensity classes of each serum (0-7) divided by the maximal reachable value for 38 donors (38 x 7). Proteins identified by ProteoSys AG are marked with an asterisk.
