Physiological and molecular comparison of susceptible and anthelmintic-resistant isolates of cattle parasitic nematodes

(1)

Aus dem Institut für Parasitologie der Tierärztlichen Hochschule Hannover

___________________________________________________________________________

Physiological and molecular comparison of susceptible and anthelmintic-resistant isolates of cattle parasitic nematodes

THESE

Zur Erlangung des Grades eines

DOCTOR OF PHILOSOPHY (PhD) durch die Tierärztliche Hochschule Hannover

vorgelegt von Dr. Janina Demeler

aus Hamburg

Hannover 2009

(2)

Supervisor : Prof. Dr. Georg von Samson-Himmelstjerna

Advisory committee: Prof. Dr. Georg von Samson-Himmelstjerna Prof. Dr. Christoph Grevelding

Prof. Dr. Manfred Kietzmann

1st Evaluation : Prof. Dr. Georg von Samson-Himmelstjerna Prof. Dr. Manfred Kietzmann

(Institut für Parasitologie, Tierärztliche Hochschule Hannover) Prof. Dr. Christoph Grevelding

(Institut für Parasitologie, Justus-Liebig Universität Giessen)

2nd Evaluation: PD. Dr. Peter-Henning Clausen (Institut für Parasitologie und Tropenveterinärmedizin, Freie Universität Berlin)

Date of oral exam : 23.11.2009

PhD Projekt wurde gefördert durch:

EU-Project, Framework 6, PARASOL (FOOD-CT-2005-022851)

(3)

dedicated to my family

(4)

______________________________________________________________________________

Introduction

The occurrence of gastro intestinal nematodes in ruminants is one of the greatest threats to animal livestock production worldwide. Clinical and subclinical parasitism leads to poor animal welfare, poor production and profitability and also to poor food quality. Therefore, control of parasite infections is of major importance. In the past, most of the livestock industries in the world relied heavily on chemically based parasite control, changing from the class of benzimidazoles to levamisole (sixties to seventies) and the macrocyclic lactones (early eighties).

Despite the aim of implementing alternative methods into control schemes, worm control in most countries involves repeated dosing of whole herds/flocks with synthetic anthelmintics, dominated by the use of macrocyclic lactones, typified by ivermectin.

However, this strategy is not believed to be sustainable in the short to medium term as it is known to cause a number of problems such as development and spread of anthelmintic resistance and building up of environmental and food residues. The intensive use of anthelmintics has lead to selection for resistance in target populations in the field and therefore might limit the continued use of these drugs in the future. When resistance in the field has reached the level of therapeutic failure, it is often too late to successfully prevent the spread of resistance, particularly if drug combinations have been used. Resistance against the most commonly used drug classes is an emerging problem, jeopardizing control of parasites in livestock industries, particularly in small ruminants (Echevarria et al., 1996; Gopal et al., 1999; Vickers et al., 2001). Therefore, monitoring anthelmintic resistance is an important tool for sustainable parasite control in livestock industries.

Recent surveys indicate widespread resistance to one or more of the broad spectrum anthelmintics (Kaplan, 2004). In cattle, resistance to anthelmintics has not been reported as frequently as in small ruminants in the past, but more recently an increasing number of cases have been reported in New Zealand and South America (Anziani et al., 2004; Anziani et al., 2001; Coles, 2002; Fiel et al., 2001; Jackson et al., 2006; Mejía et al., 2003; Soutello et al., 2007;

Suarez and Cristel, 2007; Waghorn et al., 2006) and occasionally in the United Kingdom (Coles, 2004; Coles et al., 2001; Stafford et al., 2007). The latter were the first reports of anthelmintic

(6)

______________________________________________________________________________

2

resistance in cattle nematodes in Europe. The apparent lack of such data in other countries is probably due to a variety of reasons. The management systems used in the cattle industries are different to these used in the sheep industries. They often include different grazing schemes, a larger percentage of larvae in refugia and also less frequent treatment regimes (Coles, 2002).

These factors may account for the reason, why anthelmintic resistance in cattle occurred later and less profound than in sheep. In order to prevent a situation similar to the one in the sheep industries, tests are urgently needed to determine which drugs are still effective against a particular parasite population at low levels of resistance and as early as possible, to enable the choice of an anthelmintic for therapeutic use in the field. A number of in vitro and in vivo techniques have been developed for the detection of resistance in the past 30 years (Taylor et al., 2002). However, the detection of resistance in cattle nematodes in the field is complicated by the absence of resistance surveys undertaken in Europe and the lack of sensitivity of the currently available detection methods.

At current, the faecal egg count reduction test remains the only practicable method of detecting resistance in the field in vivo. Briefly, it relies on the assumption that the number of eggs in the faeces reflects adult worm burden in the host, comparing faecal egg counts pre and post treatment. In most field survey publications, only Cooperia spp. was reported to be an increasing problem. The fact that this parasite is considerably less pathogenic than Ostertagia ostertagi possibly contributes to less interest in studies aiming on the detection of anthelmintic resistance in cattle nematodes. Therefore the current status of anthelmintic efficacy in cattle nematodes in Europe remains largely unknown. One of the aims of this study was to investigate the current situation of anthelmintic resistance in cattle in Europe by using the faecal egg count reduction test (Demeler et al., 2009).

In comparison to the in vivo tests, in vitro tests are often the more cost effective and less time consuming alternative. They are often cheaper, relatively quick and usually have greater sensitivity than in vivo techniques (Lacey et al., 1990). Generally, these tests involve the incubation of one of the free living stages of the parasites in a range of drug concentrations, followed by the measurement of vitality in form of development, motility or migration pattern.

(7)

______________________________________________________________________________

3

The Larval Development Test is a widely used in vitro system for the detection of resistance to benzimidazoles, levamisole and macrocyclic lactones, and a variety of methods has been published (Coles et al., 1988; Gill and Lacey, 1998; Gill et al., 1995; Giordano et al., 1988;

Taylor, 1990). Effects measured in this test are thought to be related to the inhibition of feeding, which is essential for larval development. Eggs are incubated in the presence of drug for 6-7 days, followed by the calculation of the proportion of third stage larvae to the total of all stages and generating of dose response curves. At current, all methods published are for the use with gastro intestinal nematodes of sheep.

Migration and motility tests using third stage larvae, instead, are thought to measure effects related to paralysis of the body muscles, as third stage larvae do not feed and proper body movement is required, for example to pass through a sieve. These tests rely on the principle, that incubation of third stage larvae in a range of drug concentrations results in decreased motility, which can be measured by observation (Geerts et al., 1989; Gill et al., 1991; Martin and Le Jambre, 1979), electronic detectors (Folz et al., 1987) or migration through a sieve (Sangster et al., 1988). A number of different tests measuring migration have since been published (Douch and Morum, 1994; Gatongi et al., 2003; Kimambo and MacRae, 1988; Rabel et al., 1994;

Wagland et al., 1992), mostly for sheep parasitic nematodes. For cattle parasitic nematodes only limited information is available. In comparison to nematodes of sheep, nematodes of cattle seem to be more difficult to culture, being more sensitive in terms of temperature, storage times and general handling procedures.

The aim of this study was the adaptation, evaluation and standardisation of a larval development test and a larval migration inhibition test for the analysis of IVM, TBZ and/or LEV efficacy in the cattle parasitic nematodes C. oncophora and O. ostertagi. Furthermore, a Micromotility Meter, similar to the one described by Folz et al. (1987), was evaluated for its use detecting resistance to IVM in adult C. oncophora (Demeler et al., accepted).

In comparison to in vitro tests, which are generally assessing the phenotype of resistant parasites, molecular tests aim at the detection of the resistance genotype of parasites. Compared to molecular tests, the sensitivity of in vitro tests is considered to be relatively poor. It has been

(8)

______________________________________________________________________________

4

estimated, that the percentage of resistant individuals in the population needs to be at least 25% in order detect it as resistant in in vitro tests (Martin et al., 1989). Molecular tests which are based on the analysis of resistance-associated target genes are usually highly sensitive. The key requirement for the development of molecular tests is the understanding of the molecular basis of resistance. The molecular mechanism of resistance to benzimidazoles is relatively well characterized (Prichard, 2001). In various nematode species, benzimidazole resistance is caused by single nucleotide polymorphisms in the benzimidazole target, the -tubulin gene. This has allowed the development of PCR-based detection methods for resistance-associated polymorphisms. The heterogeneity in these resistance-associated polymorphisms makes it difficult to design a simple molecular test for the reliable detection of parasites resistant to benzimidazoles. However, a number of methods have been described to identify individual parasites resistant to benzimidazoles and more recently frequencies of resistance associated alleles in pools of larvae (Alvarez-Sanchez et al., 2005; Silvestre and Humbert, 2000; von Samson-Himmelstjerna et al., 2007; Von Samson-Himmelstjerna et al., 2003; von Samson- Himmelstjerna et al., 2009), but no such tests are available for the detection of resistance to macrocyclic lactones at current.

In order to identify emerging resistance to macrocyclic lactones in parasites, molecular markers would be helpful. Since the underlying molecular mechanisms of resistance to macrocyclic lactones are still not completely understood, there are no validated markers for the detection of resistance to macrocyclic lactone available yet (Wolstenholme et al., 2004). In contrast to specific resistance mechansisms, e.g. those affecting the drug target directly such as the -tubulin for the benzimidazoles, non specific mechanisms leading to increased metabolism or decreased drug accumulation have been predominantly implicated in resistance to macrocyclic lactones. In particular, the P-glycoproteins have been described to be involved in resistance in parasitic nematodes of sheep and humans (Ardelli and Prichard, 2004; Kerboeuf et al., 2003; Xu et al., 1998). For cattle parasitic nematodes, no data regarding P-glycoproteins and their contribution to resistance are published.

(9)

______________________________________________________________________________

5

The aim of this study was to evaluate the potential role of Pgps in ML resistance in C. oncophora and to furthermore identify candidate Pgps which might be involved in macrocyclic lactone resistance.

The work presented here was mostly performed within the PARASOL project (FOOD-CT- 2005-022851), funded by the Framework six Program of the European Union. The major aims of this project were (i) to create sustainable control programs with an low-input of anthelmintics by monitoring the current situation in Europe and, based on the results, developing strategies such as Targeted Selective Treatment, (ii) to develop in vitro methods for the detection of anthelmintic resistance, particularly to the macrocyclic lactones in cattle mainly and (iii) to investigate the molecular bases of resistance.

For cattle gastro intestinal nematodes, the data presented in the publications of this thesis contributed to all three points addressed in the PARASOL project.

(10)

___________________________________________________________________________

Monitoring the efficacy of ivermectin and albendazole against gastro intestinal nematodes of cattle in Northern Europe

J. Demeler â,*, A.M.J. Van Zeveren ^b, N. Kleinschmidt ^d, J. Vercruysse ^b, J. Höglund ^c, R. Koopmann ^d, J. Cabaret ê, E. Claerebout ^b, M. Areskog ^c, G. von Samson-Himmelstjerna â

a Institute for Parasitology, University of Veterinary Medicine, Buenteweg 17, 30559 Hannover, Germany b Department of Virology, Parasitology and Immunology, Faculty of Veterinary Medicine, Ghent University, Belgium

c Department of Parasitology (SWEPAR), National Veterinary Institute, Swedish University of Agricultural, Sciences, Uppsala, Sweden

d Johann Heinrich von Thuenen Institute, Federal Research Institute for Rural Areas, Forestry and Fisheries, Institute of Organic Farming, Trenthorst, Germany

e Inra, UR, 1282, IASP 213, 37380 Nouzilly, Franc

ABSTRACT

Faecal egg count reduction tests (FECRT) using ivermectin (IVM) and benzimidazole (BZ) were conducted to investigate the prevalence of anthelmintic resistance in gastro-intestinal nematodes on cattle farms in Germany, Belgium and Sweden in 2006 and 2007. Based on sufficient numbers of eggs prior to the study, between three and ten farms per country were selected. 10-15 animals were randomly selected per farm and subcutaneously treated with 0.2mg IVM/kg bodyweight (Ivomec®, Merial). Faecal samples were collected individually from every animal at day 0 (treatment), day 7 (Belgium & Sweden) or 14 (Germany), and day 21 (Germany, Belgium and Sweden). Faecal egg counts (FEC) were performed at each sampling occasion to estimate the eggs per gram of faeces (EPG) and the reduction of eggs after treatment. The FECRT using IVM in 2006 revealed mean reduction of egg counts between 69-100% on day 7/14 (95% confidence interval (CI) 19-102) and 35-96% (95% CI 0- 102) on day 21. Farms with a suggested problem of anthelmintic resistance have been re- visited in 2007 and except for one case all results obtained in 2006 were confirmed in 2007.

Larvae obtained from faecal cultures were identified using microscopic identification keys or genus-specific real time PCR. Cooperia oncophora was the predominant species detected after treatment, but Ostertagia ostertagi was found in samples on 3 farms in Germany and 3 farms in Sweden post treatment.

(11)

___________________________________________________________________________

In 2007 additionally a FECRT using benzimidazoles was conducted in Germany and Sweden.

In Germany oral Valbazen® (albendazole, 10%, Pfizer) was used at a concentration of 7.5 mg albendazole/kg bodyweight; in Sweden Valbazen Vet® (albendazole, 10%, Orion Pharma) at a dose of 8mg/kg was used. For benzimidazoles an efficacy of 100% was obtained on all tested farms in both countries. This is the first report of a multinational anthelmintic efficacy investigation in cattle in Europe. The results suggest that testing of anthelmintic efficacy should be performed more intensively due to possible insufficient efficacy of current drugs.

The full text is available online: Demeler et al., 2009, Veterinary Parasitology 160, 109-115

Adaptation and evaluation of three different in vitro tests for the detection of resistance to anthelmintics in gastro intestinal nematodes of cattle

J. Demeler,*, U. Küttler, G. von Samson-Himmelstjerna

Institute for Parasitology, University of Veterinary Medicine, Buenteweg 17, 30559 Hannover, Germany

(12)

___________________________________________________________________________

ABSTRACT

Three different in vitro methods, the Larval Development Test (LDT), the Larval Migration Inhibition Test (LMIT) and the Micromotility Meter Test (MMT) have been adapted to detect anthelmintic resistance in cattle nematodes. Nematode eggs and third stage larvae of different Ostertagia ostertagi and Cooperia oncophora isolates were obtained from faecal cultures of experimentally infected calves. Additionally, adult C. oncophora were evaluated in the MMT for the detection of resistance to ivermectin (IVM).

For all three in vitro tests standard operating procedures (SOP) were established and successfully used for the detection of responses of non-parasitic and parasitic stages to different anthelmintic substances and the description of dose response curves. In the LDT ivermectin (IVM) and thiabendazole (TBZ) were tested, in the LMIT IVM and levamisole (LEV) and in the MMT only IVM was evaluated. Susceptible isolates of C. oncophora and O. ostertagi, an IVM-resistant isolate of C. oncophora and a TBZ-selected isolate of O. ostertagi were used in all (C. oncophora) or only some of these tests (O. ostertagi). For all isolates sigmoidal dose response curves and EC50 values for the tested substances were obtained using a fourparameter logistic model.

For the LDT, the previously reported problem in development of larvae was successfully overcome with mean development rates between 80 87% in negative controls. Following optimization of incubation times, temperatures, mesh sizes (LMIT only), nutritive medium (LDT only) and group size (MMT only) all three test systems reliably detected significant differences in the response to IVM between the susceptible and IVM-resistant isolate of C. oncophora (p<0.0001), resulting in an RR value of approximately 5 for IVM and 2.8 for LEV in C. oncophora. The LDT also detected differences in the response to TBZ between the susceptible and BZselected O. ostertagi isolates (p<0.001) with an RR of 2 for TBZ. With the standardization of the described tests we report reproducible and reliable in vitro methods for the detection of resistance to IVM (LDT, LMIT & MMT) and TBZ (LDT) for cattle parasitic nematodes.

The full text is available online: Demeler et al., 2010, Veterinary Parasitology XXX (paper was accepted in November 2009, no DOI-number had been assigned at the time of printing of this thesis).

(13)

Molecular characterization of P-glycoproteins in the cattle parasitic nematode Cooperia oncophora

Janina Demeler^*, Jürgen Krücken, Salha Al Gusbi, Georg von Samson-Himmelstjerna

Institute for Parasitology, Centre for Infectious Diseases, University of Veterinary Medicine, Hannover, Germany

Keywords: anthelmintic, resistance, nematodes, P-glycoproteins, Cooperia

* Corresponding author: Tel: +49 511 9538714; fax: +49 511 9538552, e-mail address:

Janina.demeler@tiho-hannover.de (J. Demeler)

(14)

ABSTRACT

Resistance against macrocyclic lactones such as ivermectin is widespread among parasitic gastrointestinal nematodes of small ruminants and is rapidly increasing in cattle parasites.

ABC transporters of the subfamily B, the so-called P glycoproteins (Pgps) have been frequently implicated in ivermectin resistance and are a major cause of multi-drug resistance in protozoa and helminths. The Pgp inhibitor verapamil (but not the cytochrome P450 inhibitor piperonyl butoxide) dramatically enhanced susceptibility of the cattle parasitic nematode Cooperia oncophora to ivermectin in vitro as measured in a larval developmental test and a larval migration inhibition test using third stage larvae. Moreover, verapamil completely restored susceptibility to ivermectin in a resistant isolate resulting in virtually identical dose response curves of susceptible and resistant isolates in the presence of verapamil. Further characterization of the molecular mechanisms resulting in Pgp-mediated ivermectin resistance is still hampered by the lack of sequence information for Pgps of parasitic nematodes. Using PCR with degenerated primers, fragments of four different C. oncophora Pgps could be amplified and the ConPgp-2 and ConPgp-3 full-length cDNAs were obtained by RACE PCR. Real-time RT-PCR, however, did not detect significant differences in ConPgp-2 expression between susceptible and resistant isolates. The Pgp sequences presented here contribute important data required to systematically screen resistant C. oncophora isolates for upregulation of Pgps and for the detection of single nucleotide polymorphisms in Pgps to detect selection of specific Pgp alleles by anthelmintics as early as possible.

(15)

1. Introduction

Resistance against the macrocyclic lactone anthelmintics is of major concern, jeopardizing current strategies of parasitic control in livestock industries throughout the world. Despite the aim of implementing alternative methods into control schemes, the macrocyclic lactone anthelmintics (MLs), typified by ivermectin (IVM), have become the mainstay of control of parasites of cattle and other production animals.

The intensive use of anthelmintics in the field has lead to selection for resistance in target populations and limited the continued use of the drugs. Resistance of nematodes to IVM and other anthelmintics such as benzimidazoles has been reported for a range of livestock industries in several countries. In the past decade reports of anthelmintic resistance in cattle parasitic nematodes are increasing [1-11]. In order to measure the spread of resistance in parasite populations, in vitro assays which are cheap, relatively quick and usually have greater sensitivity than in vivo techniques have been used to study this in more detail.

For benzimidazole-resistance, three different single nucleotide polymorphism (SNPs) markers in the beta-tubulin gene have been identified in sheep parasitic nematodes [12, 13]

and are currently also under investigation for their use in diagnosing anthelmintic resistance in cattle parasitic nematodes. Currently there are no validated molecular markers for ML resistance. Specific and unspecific mechanisms are known to be involved in the process of development of anthelmintic resistance. The glutamate gated chloride channels (GluCls) have been identified as possible specific receptors for MLs [14-18]. Although variance in the GluCl 3 channel has been implicated in IVM resistance in C. oncophora [19, 20], these findings have not been confirmed for other isolates of this parasite yet. The P-glycoproteins (Pgp), members of the ABC transporter family (subfamily B), are thought to be involved as unspecific mechanisms of anthelmintic resistance against the MLs in parasitic nematodes

(16)

such as Haemonchus contortus and Onchocerca volvulus [21-27]. At current no data regarding Pgps in C. oncophora are published.

The aim of this study was to evaluate the potential role of Pgps in ML resistance in C. oncophora by studying the effects of IVM in presence of the Pgp inhibitor verapamil (VPL) in two in vitro tests, and to furthermore identify candidate Pgps which might be involved in ML resistance.

(17)

2. Material and methods

2.1 Parasites

The susceptible C. oncophora isolate (C. o. sus.) used in this study was a Weybridge- isolate obtained from BAYER Animal Health in 2002 with no history of exposure to MLs.

The IVM-resistant C. oncophora isolate (C. o. res.) was obtained from a UK farm [28] and found to be resistant against IVM in vivo. For this isolate, no further resistance to other anthelmintics is known.

Both isolates were individually and regularly passaged in 3-6 month old calves of different breed. The C. o. res. isolate was additionally challenged with the recommended therapeutic dose of IVM (Ivomec®, 0.2mg IVM/kg bodyweight) in regular intervals.

2.2 Chemicals

IVM (Sigma, I8898) and VPL (Sigma, V4629) stock solutions were made in 100%

dimethyl sulfoxide (DMSO). Further dilutions were made with distilled water, always maintaining a final concentration of 0.5% DMSO in the tests. Stock solutions of IVM were stored in aliquots at a temperature of -20 °C for the maximum of 3 months.

For the LDT, IVM concentrations ranged from 10^-11 to 5×10^-7 M. For negative controls distilled water containing 0.5% DMSO, for the positive controls stock solutions were used.

For the LMIT concentration of drugs used were generally higher, with IVM ranging from from 10^-10 to 10^-5M. VPL was used in a steady concentration of 12.5 µM in both tests.

Appropriate concentration ranges for all drugs used were determined in preliminary studies (data not shown).

(18)

2.3 Larval Development Test (LDT)

The sensitivity of the isolates to IVM was determined in a LDT as described by Demeler et al. (accepted). In the LDT the potency of anthelmintics as inhibitors of the development of trichostrongyloid nematodes from eggs through to L3 infective larvae was measured.

Helminth naïve calves (3-6 months old) were infected with approximately 35.000 larvae of a single isolate and nematode eggs, recovered from faeces 4-6 weeks post infection, were purified using a standard sugar gradient and concentrated to ~50 eggs/10µl water. Each well of a 48-well plate finally contained 180 µl of distilled water, 30 µl of the prepared drug solutions, 50 µl growth medium and 20 µl VPL (3.75 mM) (if tested in combination) or 20 µl destilled water (IVM alone), respectively. Growth medium contained (i) sterile yeast/Earle’s extract (1% in 0.9% NaCl, diluted 1:10 in Earles solution (Sigma E7510)), (ii) Amphotericin B (Sigma A2942, 0.5 mg/ml) and (iii) 1.5 mg/ml lyophilized Escherichia coli K12 (in distilled water, autoclaved) in the mixture of 2:2:1 (v/v/v). After preparation of the plates, 20 µl of egg suspension was added. All plates were sealed with disposable plastic foil and incubated at 25-27 °C for 7 days. Duplicates of the susceptible and the IVM-resistant isolate were always run in parallel.

Toxicity tests with VPL were performed using concentrations ranging from 0.39 - 50 µM (data not shown). The concentration of 12.5 µM VPL was the highest concentration with no inhibitory effect on larval development. For the combination of both substances, a steady concentration of 12.5 µM VPL was maintained with increasing concentrations of IVM ranging from 10^-11 to 5×10^-7 M.

Incomplete developed larval stages [1] (L1, L2 and eggs) and the total stages [2] (all larvae + eggs) present in each well were counted and the percentage of [1] was calculated. Data were corrected for the mean number of larvae not developing in the negative control wells.

(19)

GraphPad Prism® software was used to fit logistic curves to the dose-response data and for statistical analysis. A four parameter logistic sigmoidal dose response model with variable slope was chosen to allow fitting of the Hill slope. TOP and BOTTOM values were defined as 0 and 100 to allow exact calculation of EC50 and the 95% confidence intervals (CI).

Additionally the R² which quantifies the goodness of fit was calculated. For the test of statistical differences between the mean values for the EC50 of the populations, the p-value for the EC50 was calculated to compare the means of both populations.

For final statistics a minimum of 5 to 8 data points, derived from independent experiments, was used for each concentration.

2.4 Larval Migration Inhibition Test (LMIT)

This test was carried out as described by Demeler [29]. During evaluation, sheathed L3 were incubated in different concentrations of drugs and then allowed to migrate through sieves. Sieves were made following the methods described by Demeler et al. (accepted). L3 larvae were recovered from faecal cultures and separated from faecal debris by passage through a Baerman funnel system and stored in ventilated cell culture flasks at 10 °C. For the test, 90-100 larvae were then incubated in each well (total volume 1.8 ml) in the presence of IVM (or IVM+VPL) for 24 h in the dark at 28 °C. A second set of plates (migration plates) was prepared with 400 µl agar (1.5%) in each well and the whole content of the incubation wells (liquid plus larvae) was carefully transferred onto the top of the sieves. These sieves were suspended above the agar in rows A and C of the migration plate and the larvae were allowed to migrate for further 24 h at 28 °C. Sieves were lifted out of the plate and the outside contents carefully rinsed back into the wells. The remaining, non-migrated larvae on the sieves were flushed into the corresponding well of the next row (rows B and D, respectively).

(20)

Each test was carried out in duplicates on the same day. All tests were run following a standard operating procedure (SOP).

Toxicity tests with VPL were carried out in the same manner as for the LDT and a final concentration of 12.5 µM was used in combination with IVM. For combination tests, the original concentration range for IVM was used.

In the LMIT, for each concentration migrated and non-migrated larvae were counted and a percentage of non-migrated larvae/total larvae × 100 was calculated. These data were then analysed using GraphPad Prism® software as described for the LDT.

2.5 Amplification of ConPgp-2 and ConPgp-16 fragments using degenerated primers

RNA was isolated from 50000-60000 third stage larvae (L3) using Trizol reagent. For cDNA synthesis, the BD SMART^TM RACE cDNA amplification kit (BD Bioscience) was used according to the manufacturer’s instructions. After denaturation of RNA and primers at 70 °C, 1 µg total RNA was reversed transcribed in 1×First-Strand Buffer containing 1.2 µM 5'CDS primer (5'-(T)26VN-3') and BD SMARTII A oligo (5'-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3'), 2 mM DTT, 1 mM dNTPs, and 1 µl BD PowerScript Reverse Transcriptase for 90 min at 42 °C. For amplification of Pgp fragments using degenerated primers, 1 µl of this cDNA was used as template.

PCR reactions contained 1.5 mM MgCl2, 0.4 µM dNTPs, 0.2 µM each forward

(5'-GGTGCAAGTGGATGTGGNAARWSNAC-3') and reverse

(5'-CGTGCAATTGCGATTCGTTGTTTYTGNCCNCC-3') primer, and 1 U Taq DNA polymerase (Qiagen). After 2 min denaturation at 94 °C, 35 cycles consisting of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min followed.

(21)

2.6 Full-length amplification of ConPgp-2

In order to obtain the ConPgp-2 5'-end, three consecutive rounds of 5'-RACE were performed since the first two rounds resulted in the identification of additional cDNA fragments that did not yet contain the ATG start codon. In the first two rounds, cDNA obtained with the BD SMART^TM RACE kit (see section 2.5) was used as template. Reactions contained 0.2 mM dNTPs, 0.2 µM of a ConPgp-2-specific primer, 2.5 µl cDNA, 5 µl of the Universal Primer A Mix (BD Biosciences), and 1 µl Advantage 2 Polymerase (BD Biosciences) in 50 µl 1×Advantage 2 Polymerase Buffer. As ConPgp-2-specific primers the oligonucleotides 5'-CACGCGAGTACCGTAACCATCAGGAAG-3' and 5'- ATGGTGTTGAGATGAGGAAGACAAGT-3' were used for the first and second RACE PCR, respectively. The PCR protocol consisted of 2 min denaturation at 94 °C, followed by 35 cycles 94 °C for 30 s, 55 °C for 30 s and 72 °C for 4 min.

A third round of RACE PCR was performed using the 5'/3'-RACE kit (Roche) as described previously [30]. Briefly, cDNA synthesis and purification were performed according to the manufacturer’s instructions using the ConPgp-2 specific primer 5'- ATGATAGTTTATCGCCTAGACCTTC-3'. After tailing of cDNA with dATP, 20% (5 µl) of the cDNA was used as template in a first 5'-RACE PCR. PCR was performed using 50 µl 1×AccuPrime Buffer II containing nucleotides and MgCl2, 0.2 µM ConPgp-2 specific primer 5'-GAATGGCTTTCAGGTAGATTTG-3', 0.75 µM oligo dT-anchor primer 5'- GACCACGCGTATCGATGTCGAC(T)16V-3' and 1 µl AccuPrime Polymerase (Invitrogen).

After 3 min denaturation at 94 °C, 42 cycles consisting of 94 °C for 15 s, 58 °C for 30 s, 72 °C for 1 min were performed followed by an final extension at 72 °C for 7 min.

The 3'-end of the ConPgp-2 cDNA was obtained by 3'-RACE PCR using the BD SMART^TM RACE kit. PCR reactions were performed as described for 5'-RACE but with 5'- GTCGACGACGAAAACATCAAGAATATGA-3' as ConPgp-2-specific primer.

(22)

The full length open reading frame (ORF) was amplified using AccuPrime Polymerase

with 0.4 µM of the sequence specific forward 5'-

GAGGTCCTCTTGAACTACTCAAATGTT-3' and reverse 5'-

TTATGTTAATGAAGACCATTCACAGATCA-3' primers. PCR was performed using a protocol of 95 °C for 3 min, followed by 35 cycles consisting of 95 °C for 15 s, 58 °C for 30 s and 68 °C for 5 min.

2.7 Amplification of ConPgp-3 and ConPgp-12 fragments using degenerated primers

cDNA synthesis was performed using the cDNA synthesis kit (Fermentas) containing random hexamer primers according to the manufacturers instructions. For Pgp-3, PCR was performed using 50 µl 1×AccuPrime Buffer II containing nucleotides and MgCl2, 10 µM

ConPgp-3 specific degenerated forward primer 5'-

CCNYTNAAYWSNYTNRTWTTYNAAGGAAT-3', and degenerated reverse primer 5'- GTYCKNATNCCRGCRATYACTTCRTT-3', 0.5 µl AccuPrime Polymerase (Invitrogen) and 1 µl cDNA. A second pair of primers was used to obtain a fragment at the opposite site of the expected Pgp-3, with the degenerated forward primer 5'- ATGASYGTKATGWTRGCNGCNTCNTAYTTCCC-3' and the degenerated reverse primer 5'-TCRAYNARYTGWATMRNNGTRCTYTTTCCRCA-3'.

For Pgp-12, the same PCR protocol was applied using the ConPgp-12 specific forward

primer 5'-CARAAYGCNGGNTGGTTTGA-3' and reverse primer 5'-

ACCATYTCYTCYTGWCC-3' instead.

The PCR protocol used for both Pgps started with 94 °C for 2 min, followed by 35 cycles of 94 °C for 15 s, 53 °C for 30 s and 72 °C for 90 s.

(23)

2.8 Full-length amplification of ConPgp-3

In order to obtain the ConPgp-3 5'-end, a 5'-RACE PCR was performed using the 5'/3'- RACE kit (Roche) as described for Pgp-2 (2.6). For cDNA synthesis the ConPgp-3 specific primer 5'-CACATAGTGTATAAGCTCGCATTCGAA-3' was used. After tailing of cDNA with dATP, 20% (5 µl) of the cDNA was used as template in the RACE PCR. This PCR was performed using 50 µl 1×AccuPrime Buffer II containing nucleotides and MgCl2, 0.2 µM ConPgp-2 specific primer 5'-CCAGAAGGGCCATGCCGAGAGCAAG-3', 0.75 µM oligo dT-anchor primer 5'-GACCACGCGTATCGATGTCGAC(T)16V-3' and 0.5 µl AccuPrime Polymerase (Invitrogen). The protocol consisted of 94 °C for 2 min, 40 cycles of 94 °C for 15 s, 55 °C for 30 s, and 72 °C for 7 min. A nested PCR was performed using a second specific forward primer 5'-AAGACCTCCATATCGAGCTCATTCCTCGAA-3', following the same procedures as described above.

The 3'-end of the ConPgp-3 cDNA was obtained by 3'-RACE PCR using the same kit.

cDNA synthesis was primed using the oligo dT-anchor primer 5'- GACCACGCGTATCGATGTCGAC(T)16V-3' (Roche). PCR reactions were performed as described for 5'-RACE but with 5'- GTATATTCGTGCCCGAATCTCGGCCGGTGTTAT-3'

as the first ConPgp-3-specific primer and 5'-

GCCGGCACTAAAAGGCGATATATCGCTAAGGAA-3' for the nested PCR.

The full length ORF of ConPgp-3 was amplified using 2 µl cDNA, 1 µl AccuPrime Polymerase with 0.3 µM of the sequence specific forward 5'-

TCGCGATTCACTATCATACTAGGCAGCCGTTA-3' and reverse 5'-

ATTTGTACTGTATGAACAACTTGTCTGTCTCT-3' primers. PCR was performed using a protocol of 94 °C for 2 min, followed by 40 cycles consisting of 94 °C for 15 s, 55 °C for 30 s and 68 °C for 4 min.

(24)

2.9 Cloning and sequencing of PCR products

PCR fragments were purified from agarose gels and cloned into pCR2.1 or pCR4.0 TOPO vectors (Invitrogen) and transformed into chemically competent TOP10 cells. Inserts were sequenced by GATC Biotech (Konstanz) or Seqlab (Göttingen) using vector specific and custom-synthesized primers.

2.10 Bioinformatic and phylogenetic analysis

Sequences were compared to the Caenorhabditis NCBI protein database using the “blastx”

algorithm [31]. Sequences corresponding to Pgps were aligned and put together using the Sci Ed Central software packages Clone Manager 7 and Align Plus 5.

Deduced protein sequences were aligned with nematode Pgp sequences from the NCBI database using ClustalW2 [32]. MRP-1 sequences from C. elegans and C. briggsae were included as outgroup. Maximum likelihood analysis using PhyML software [33] was performed as described recently in Krücken et al. [34]. Protein domains and sequence motifs were identified using CD-Blast [35, 36]. Prediction of transmembrane helices was performed with HMMTOP software [37, 38], using human and Cooperia Pgps and human Abcb1a (Pgp) as homologeous input sequences.

2.11 Cell culture and transfection

HELA cells (DSMZ ACC 57) were cultured in MEM medium containing Earl’s salts and 7.5 % fetal calf serum (PAA Laboratories) in humidified atmosphere with 5 % CO2 at 37 °C.

The ORF of ConPgp-2 was amplified and cloned in frame with the autofluorescent markers in the vectors pEYFP-N1 and pHcRed-N1 to be expressed as fusion proteins in mammalian

(25)

cells. Transfections were performed with the Nucleofector (Lonza) using 5 × 10⁴ cell, 2 µg plasmid DNA, nucleofector solution R and the electroporation program A-028. Cells were analyzed for fluorescence using an inverse fluorescence microscope 24 and 48 h after transfection.

2.11 Quantitative real-time RT-PCR

Total RNA was isolated following the TRIZOL protocol according to the manufacturer’s manual, using six different pools of fresh larvae (50000-60000 L3) of each, the IVM- susceptible and the IVM-resistant C. oncophora isolate. The larvae were ex-sheathed by incubation in 0.5 % sodiumhypochloride solution for 7-10 min and ex-sheathed larvae were ground with the TissueRuptor^TM (QIAGEN). RNA (1 µg) was incubated with 1 U DNase (Fermentas) for 30 min at 37 °C followed by enzyme inactivation in the presence of 2.3 mM EDTA at 65 °C for 10 min. cDNA synthesis was performed for each pool of larvae separately using 0.5 µg RNA as described in section 2.7 including an parallel preparation without reverse transcriptase (-RT control).

Annealing temperature for the PCR was optimized through conventional gradient PCR between 45 °C and 60 °C. Real-time amplification was performed in an Mx3005P using the Stratagene Brilliant^®II SYBR^®GreenQPCR Master Mix Kit (STRATAGENE) according to the manual. In absence of validated house keeping genes and due to the sparse sequence information available for C. oncophora, normalization was not done relative to house keeping genes but to the amount of total RNA [39]. After an initial denaturation at 95 °C for 10 min, 40 cycles consisting of 95 °C for 30 s, 53 °C for 1 min and 72 °C for 30 s followed.

Fluorescence was detected throughout annealing and extension. After the amplification a denaturation curve was recorded. Primers used for ConPgp-2 quantification were 5'- GGACTCAAAACCTTCCTA-3' and 5'-GTGTCGTAACCCTCTGGTA-3'. For every cDNA

(26)

preparation, 1 µl of at least four different dilutions (1:5-1:625) was used as template. Using a dilution series of one cDNA preparation of the susceptible C. oncophora isolate to draw a standard curve (cT-value vs. dilution), relative abundance of ConPgp-2 cDNAs in the different cDNA preparations was calculated. Mean relative expression in the different cDNA preparations were compared via Student’s t test and Mann Whitney Rank Sum test.

(27)

3. Results

3.1 Larval Development Test

For C. oncophora development rates with a mean of 89.3 % (87.2-94.6) were reached in the absence of IVM. Between the two tested isolates no statistically significant differences in development rates were obtained.

The final concentration of 12.5 µM VPL was chosen as it did not decrease development or migration while showing effects in combination with IVM in both assays.

For C. oncophora, the dose-response-curve obtained for IVM (Fig. 1) showed a higher EC50 (528.7 pM) and a significant (p<0.0001) shift to the right for the IVM-resistant isolate.

In the presence of VPL, the dose response curves of both isolates for IVM shifted far to the left, falling below the EC50 value for the susceptible isolate (149.7 pM) by up to 80 fold (0.849 and 0.959 pM for the susceptible and resistant isolate, respectively). The obtained EC50

values for IVM+VPL for the IVM-resistant isolate were slightly higher than for the susceptible isolate, but this difference was not significant (p<0.12). The EC50 values for both isolates including the confidence limits, the R², p values and the resistance ratios (RR) are shown in Table 1.

3.2 Larval Migration Inhibition Test

In the LMIT a mesh size of 28 µm allowed >95% of the sheathed L3 to migrate in the negative controls and hindered paralysed/dead larvae (positive control) from falling through.

In addition no differences between the two isolates with respect to migration rates were noted.

VPL was used in the same concentration as for the LDT (12.5 µM), which had no effect on the migration of larvae.

(28)

For both isolates of C. oncophora dose response curves were obtained for IVM in the LMIT (Fig. 2). Compared to the susceptible isolate (EC50=120 nM), the IVM-resistant isolate showed a reduced susceptibility (p<0.0001) to IVM (EC50=649 nM). As shown for the LDT, both dose response curves for IVM shifted far to the left in the presence of VPL. The differences were approximately 10 and 50 fold, in the susceptible (EC50=11 nM) and resistant isolate (EC50=13 nM), respectively. All IVM and IVM+VPL results obtained for the C. oncophora isolates are presented in Table 2.

3.3 Pgp cloning and sequence analysis

Amplicification with degenerated primers resulted in 6 fragments showing high similarity to C. elegans Pgps in Blastx analysis. For both, C. oncophora Pgp-2 and Pgp-3, two fragments corresponding to more 5'- and more 3'-located regions of the gene were obtained.

At the 5'-end of ConPgp-2 but not of the ConPgp-3 a spliced leader 1 (SL-1) sequence could be identified. Full length cDNA of both genes was obtained by 5'- and 3'-RACE PCR.

Deduced amino acid sequences of ConPgp-2 and ConPgp-3 were aligned with CelPgp-2, CelPgp-3 and HcoPgp-2 (identical to HcPgpA in [40] (Fig. 3).

For ConPgp-2, two full-length cDNAs from the susceptible and two from the resistant isolate were sequenced. Although some sequence polymorphisms were identified, there was no variant present in both clones from the same isolate and absent from both clones of the other isolate. This initial comparison of ConPgp-2 sequences from susceptible and resistant isolates did therefore not provide any hints for SNPs correlating with resistance although the number of sequenced clones is far too small to allow any statistical evaluation.

In addition, one fragment corresponding to C. elegans Pgp-12 (CelPgp-12) and one fragment with high similarity to the C. briggsae database entry CBG12969, an orthologue of

(29)

the unpublished H. contortus Pgp-D [40] were obtained. These fragments were designated ConPgp-12 and ConPgp-16.

Partial alignments of the deduced amino acid sequences of ConPgp-12 with the very similar Pgp-12 and Pgp-14 from C. elegans and C.briggsae and of ConPgp-16 with C.

briggsae CBG12969 are shown in Fig. 4. A schematic drawing showing cDNA and domain architecture of the cloned Pgps is presented in Fig. 5.

For phylogenetic analysis these Pgp sequences from C. oncophora were aligned with the complete Pgp repertoire of C. elegans and C. briggsae and the available Pgp sequences from Pristionchus pacificus, Bruggia malayi and O. volvulus using CelMrp-1 and CelMrp-2 as outgroup to provide a root for the Pgp tree. A phylogram was constructed using maximum likelihood analysis (Fig. 6), confirming orthology for ConPgp-2 with CelPgp-2, CbrPgp-2, and HcoPgp-2 (PgpA). For ConPgp-3, no unambiguous Caenorhabditis ortholog was identified. The tree topology suggests that the duplication leading to Pgp-3 and Pgp-4 genes in Caenorhabditis took place after the separation of the genus Caenorhabditis from the trichostrongylids but before separation of C. elegans from C. briggsae. Since the Pgp described here is slightly more similar to CelPgp-3 than to CelPgp-4, its preferable designation is ConPgp-3. The small fragment here designated ConPgp-12 clusters within the Pgp-12/13/14 group. Although our maximum likelihood analysis places this sequence as a sister operational taxonomic unit to the Caenorhabdithis Pgp-13 and Pgp-14 group, there is only marginal statistical support favouring this tree topology. Until the full-length sequence of this C. oncophora Pgp has been obtained and the questions whether multiple Pgp-12/13/14- related Pgps are present in trichostrongylids has been addressed experimentally, we would therefore prefer to use ConPgp-12 as a kind of provisional designation since CelPgp-12 shows the highest similarity in BLAST searches (Fig. 4A).

(30)

Finally, the fragment showing high similarity to the CbrPgp CBG12969 (and to HcoPgpD) should be designated as ConPgp-16, since this Pgp subfamily is apparently absent from C.

elegans and Pgp-16 is the name with the lowest free number available.

3.4 Heterologous expression of Pgp-2 in HELA cells

Although transfection of HELA cells with a control GFP expression vector worked well resulting in high expression levels in approximately one third of all cells 24 h after transfection (data not shown), only a very small number of cells could be identified that apparently expressed a ConPgp-2/EYFP fusion protein and no expression of a ConPgp- 2/HcRed fusion protein was obtained. Attempts to select stably transfected lines were not successful yet.

3.5 Comparison of Pgp-2 expression in susceptible and IVM-resistant C. oncophora.

Expression of ConPgp-2 was compared between L3 stages of the IVM-susceptible and – resistant isolate using real-time RT-PCR with a SYBR Green detection system. For quantification, a standard-curve method was chosen. Fivefold serial dilutions of cDNAs were amplified using ConPgp-2 specific primers and maximal fluorescence in each cycle was plotted against cycle number (Fig. 7A). Identical dilutions of different cDNAs showed very similar exponential accumulation of product, while the NTC was always completely negative and the –RT control showed cT-values at least six cycles higher than that of the probes (Fig.

7B). Standard curves for cDNA preparations from the susceptible and the resistant isolate were similar (compare Fig. 7C and D) and in particular showed virtually identical amplification efficiencies close to 100% excluding the presence of any inhibitory contaminations in the RNA/cDNA preparations.

(31)

Dissociation curve analysis confirmed the presence of a single amplification product (Fig.

7E) having the expected size in agarose gel electrophoresis (data not shown). Relative expression of ConPgp-2 in the different cDNAs (susceptible vs. resistant) was calculated using a standard curve obtained by diluting from a cDNA preparation from susceptible C.

oncophora. Mean ConPgp-2 levels in cDNAs prepared from L3 stages of the IVM-resistant isolate were approximately 48% lower than in cDNA of the IVM-susceptible isolate (Fig. 7F), however this difference was not statistically significantly.

(32)

4. Discussion

Resistance against currently available classes of anthelmintics is widespread in gastrointestinal nematodes of small ruminants [41-43] and it is rapidly increasing in those of cattle [6, 9, 10] and horses [44-46]. Solutions how to manage emerging and spreading resistance are urgently needed. In order to identify resistance to MLs in field isolates, molecular markers would be helpful, but unfortunately there has been little success in the identification of resistance mechanisms at the molecular level. Currently, specific mechanisms of anthelmintic resistance, i.e. selection for altered drug targets, have only been described for resistance against the benzimidazoles [12, 13] and the newly introduced AADs [48]. Although MLs are long known to act via GABA or glycin-gated chloride channels, there has been only a single report describing a functionally altered chloride channel in an IVM- resistant C. oncophora isolate [20]. The corresponding amino acid change in H. contortus GluCla3 has recently been shown to reduce sensitivity of the channel to l-glutamate [48].

Unspecific resistance mechanism involving relatively broad-spectrum drug/xenobiotic detoxification systems of the parasites have been frequently implicated in development of drug resistance and in particular multi-drug resistance. For anthelmintic drugs, interest in unspecific drug resistance mechanisms has mainly focused on Pgps and related ABC transporters [24, 40, 49]. However, despite a large body of correlative support, no single Pgp has been shown be responsible for resistance to an anthelmintic drug yet.

Using an IVM-resistant C. oncophora isolate, we show here that ML resistance can be completely reversed in in vitro tests using the Pgp inhibitor VPL. Indeed, VPL even lowered the EC50 of the susceptible isolate in both LDT and LMIT suggesting that basal expression of Pgps is already a factor determining responsiveness of susceptible C. oncophora to ML without any history of selection for resistance. These data also suggest that pharmacological

(33)

interference with Pgp function might be a feasible way to enhance the potency of MLs and to overcome IVM resistance.

In contrast to VPL, the cytochrome P450 inhibitor piperonyl butoxide has no effect on EC50 values for IVM in the LDT and LMIT (Al Gusbi, unpublished results). It has previously been shown, that MLs are metabolized by mammalian cytochrome P450 enzymes [50], but there is some evidence, that there is no involvement of cytochrome P450 in resistance to MLs in parasites [51, 52]. Contrary to this work, data published by Alvinerie et al. [53] suggests a role for nematode cytochrome P450 in the metabolism of MLs. However, our data suggests that oxidation of IVM by monooxygenases of the cytochome type does not play a major role in IVM detoxification, at least not in the C. oncophora isolates analyzed here.

In order to counteract the development of drug and multi-drug resistance, detailed knowledge of resistance mechanisms is required including identification of the transporters mediating extrusion of IVM, their developmental and tissue-specific expression pattern and their substrate spectrum. In contrast to mammals, the Pgp repertoire of nematodes is extraordinarily diverse. Whereas mammals encode only a single Pgp in their genome, there are for instance 14 functional Pgps and one pseudogene in the C. elegans genome database. In addition, there are multidrug-resistance protein-related proteins (Mrps) and several half transporters that might be able to diversify the substrate spectrum further by heterodimerisation [54, 55]. This diversity of broad-spectrum xenobiotic transmembrane transporters suggests that many transporters have overlapping substrate spectra and that many substrates can be pumped by several different ABC transporters. This complexity hampers elucidation of anthelmintic resistance mechanisms in detail in particular since the complete Pgp repertoire is not yet known for any of the parasitic nematodes.

The present study describes two complete Pgps and two small Pgp fragments from C. oncophora. Since Pgp-2 has previously been implicated in development of ML resistance in H. contortus [21, 24], ConPgp-2 was chosen to start further characterization by expression

(34)

analysis and heterologeous expression. Unexpectedly, ConPgp-2 was not found to be up- regulated but slightly, though not significantly, down-regulated, excluding that increased levels of ConPgp-2 contribute to IVM resistance in this C. oncophora isolate as described for some H. contortus isolates. In the future, comparison of expression between resistant and susceptible isolates for additional individual Pgps will help to identify those candidates that are most likely responsible for ML resistance in the field.

Additional to increased expression, selection for certain Pgp alleles with increased affinity for IVM can be considered as a possible mechanism for development of resistance. Though it cannot yet be excluded that selection of SNPs within the ConPgp-2 ORF might result in a more efficient extrusion of IVM, the initial sequencing of full-length cDNAs from the susceptible and the resistant isolate did not provide any hints for such a mechanism. In order to completely exclude selection for certain Pgp alleles, however, further sequencing of ConPgp-2 RT-PCR fragments followed by identification and quantification of SNPs will be necessary. The same kind of investigation should also be performed for ConPgp-3 as well as for additional family members as soon as full-length sequence data have been obtained.

For the long-term goal to characterize the substrate spectrum of individual Pgps and to analyse possible drug interactions, heterologeous expression will be necessary. Our initial attempts with ConPgp-2 showed that expression in mammalian cells is possible though very inefficient. The use of untagged Pgps or of different vector systems might be a solution to the current problems but also non-mammalian eukaryotic systems such as yeast or Leishmania tarentolae might be useful alternatives.

The described in vitro tests for analysing involvement of Pgps in drug resistance of cattle parasitic nematodes and the characterization of the first Cooperia Pgps provide the necessary framework for further detailed analysis of drug and multi-drug resistance. Such molecular data are required to make systematic comparisons of different susceptible and resistant

(35)

isolates possible in the future in order to identify the spectrum of different resistance mechanisms exploited by these parasites.

Acknowledgements:

We gratefully acknowledge Roger Prichard and colleagues for the access to unpublished H. contortus Pgp sequences which were used to design degenerated primers.

We thank Drs. Blackhall and Pachnicke for substantial help with sequencing.

(36)

References

[1] Anziani OS, Suarez VH, Guglielmone AA et al. Resistance to benzimidazole and macrocyclic lactone anthelmintics in cattle nematodes in Argentina. Vet Parasitol 2004; 122:303-6.

[2] Anziani OS, Zimmerman GL, Guglielmone AA, Vazquez R, Suarez VH. Avermectin resistance in Cooperia pectinata in cattle in Argentina. Vet Rec 2001; 149:58-9.

[3] Coles GC. Cattle nematodes resistant to anthelmintics: why so few cases ? Vet Res 2002; 33:481-189.

[4] Familton AS, Mason P, Coles GC. Anthelmintic-resistant Cooperia species in cattle.

Vet Rec 2001; 149:719-20.

[5] Fiel CA, Saumell CA, Steffan PE, Rodriguez EM. Resistance of Cooperia to ivermectin treatments in grazing cattle of the Humid Pampa, Argentina. Vet Parasitol 2001; 97:211-7.

[6] Jackson R, Rhodes AP, Pomroy WE et al. Anthelmintic resistance and management of nematode parasites on beef cattle-rearing farms in the North Island of New Zealand. N Z Vet J 2006; 54:289-96.

[7] Mejía ME, Fernandez Igartúa BM, Schmidt EE, Cabaret J. Multispecies and multiple anthelmintic resistance on cattle nematodes in a farm in Argentina: the beginning of high resistance. Vet Res 2003; 34:461-7.

[8] Soutello RVG, Seno MCZ, Amarante AFT. Anthelmintic resistance in cattle nematodes in northwestern São Paulo State, Brazil. Vet Parasitol 2007; 148:360-4.

[9] Suarez VH, Cristel SL. Anthelmintic resistance in cattle nematode in the western Pampeana Region of Argentina. Vet Parasitol 2007; 144:111-7.

(37)

[10] Waghorn TS, Leathwick DM, Rhodes AP et al. Prevalence of anthelmintic resistance in 62 beef cattle farms in the North Island of New Zealand. N Z Vet J 2006; 54:278- 82.

[11] Demeler J, van Zeveren AMJ, Kleinschmidt N et al. Monitoring the efficacy of ivermectin and albendazole against gastro intestinal nematodes of cattle in Northern Europe. Vet Parasitol 2009; 109:109-15.

[12] von Samson-Himmelstjerna G, Walsh TK, Donnan AA et al. Molecular detection of benzimidazole resistance in Haemonchus contortus using real-time PCR and pyrosequencing. Parasitology 2009; 136:349-58.

[13] von Samson-Himmelstjerna G, Blackhall WJ, McCarthy JS, Skuce PJ. Single nucleotide polymorphism (SNP) markers for benzimidazole resistance in veterinary nematodes. Parasitology 2007; 134:1077-86.

[14] Cully DF, Paress PS, Liu KK, Schaeffer JM, Arena JP. Identification of a Drosophila melanogaster glutamate-gated chloride channel sensitive to the antiparasitic agent avermectin. J Biol Chem 1996; 271:20187-91.

[15] Cully DF, Vassilatis DK, Liu KK et al. Cloning of an avermectin-sensitive glutamate- gated chloride channel from Caenorhabditis elegans. Nature 1994; 371:707-10.

[16] Dent JA, Davis MW, Avery L. avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans. The EMBO Journal 1997; 16:5867-79.

[17] Dent JA, Smith MM, Vassilatis DK, Avery L. The genetics of ivermectin resistance in Caenorhabditis elegans. Proc Nat Academy Sci USA 2000; 97:2674-9.

[18] Vassilatis DK, Arena JP, Plasterk RHA et al. Genetic and biochemical evidence for a novel avermectin-sensitive chloride channel in Caenorhabditis elegans. J Biol Chem 1997; 272:33167-74.

(38)

[19] Njue AI, Prichard RK. Genetic variability of glutamate-gated chloride channel genes in ivermectin-susceptible and -resistant strains of Cooperia oncophora. Parasitology 2004; 129:741-51.

[20] Njue AI, Hayashi J, Kinne L, Feng XP, Prichard RK. Mutations in the extracellular domains of glutamate-gated chloride channel alpha3 and beta subunits from ivermectin-resistant Cooperia oncophora affect agonist sensitivity. J Neurochem 2004;

89:1137-47.

[21] Blackhall WJ, Liu HY, Xu M, Prichard RK, Beech RN. Selection at a P-glycoprotein gene in ivermectin- and moxidectin-selected strains of Haemonchus contortus. Mol Biochem Parasitol 1998; 95:193-201.

[22] Pouliot J-F, L'Heureux F, Liu Z, Prichard RK, Georges E. Reversal of P-glycoprotein- associated multidrug resistance by ivermectin. Biochem Pharmacol 1997; 53:17-25.

[23] Sangster NC, Bannan SC, Weiss AS et al. Haemonchus contortus: sequence heterogeneity of internucleotide binding domains from P-glycoproteins and an association with avermectin resistance. Exp Parasitol 1999; 91:250-7.

[24] Xu M, Molento M, Blackhall W et al. Ivermectin resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol Biochem Parasitol 1998; 91:327- 35.

[25] Ardelli BF, Prichard RK. Identification of variant ABC-transporter genes among Onchocerca volvulus collected from ivermectin-treated and untreated patients in Ghana, West Africa. Ann Trop Med Parasitol 2004; 98:371-84.

[26] Jagannathan S, Laughton DL, Critten CL et al. Ligand-gated chloride channel subunits encoded by the Haemonchus contortus and Ascaris suum orthologues of the Caenorhabditis elegans gbr-2 (avr-14) gene. Mol Biochem Parasitol 1999; 103:129- 40.

(39)

[27] Huang YJ, Prichard RK. Identification and stage-specific expression of two putative P-glycoprotein coding genes in Onchocerca volvulus. Mol Biochem Parasitol 1999;

102:273-81.

[28] Coles GC, Stafford KA, MacKay PHS. Ivermectin-resistant Cooperia species from calves on a farm in Somerset. Vet Rec 1998; 142:255-6.

[29] Demeler J: The physiological site of action and the site of resistance to the macrocyclic lactone anthelmintics in sheep parasitic trichostrongyloid nematodes.

Hannover: University of Veterinary Medicine; 2005.

[30] Krücken J, Hosse R, Mouafo A et al. Excystation of Eimeria tenella sporozoites impaired by antibody recognizing gametocyte/oocyst antigens GAM22 and GAM56.

Eukaryotic Cell 2008; 7:202-11.

[31] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215:403-10.

[32] Larkin MA, Blackshields G, Brown NP et al. Clustal W and Clustal X version 2.0.

Bioinformatics 2007; 23:2947-8.

[33] Guindon S, Gascuel O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 2003; 52:696-704.

[34] Krucken J, Greif G, von Samson-Himmelstjerna G. In silico analysis of the cyclophilin repertoire of apicomplexan parasites. Parasit Vectors 2009; 2:27.

[35] Marchler-Bauer A, Anderson JB, Chitsaz F et al. CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res 2009; 37:D205-10.

[36] Marchler-Bauer A, Bryant SH. CD-Search: protein domain annotations on the fly.

Nucleic Acids Res 2004; 32:W327-31.

[37] Tusnady GE, Simon I. Principles governing amino acid composition of integral membrane proteins: application to topology prediction. J Mol Biol 1998; 283:489-506.

(40)

[38] Tusnady GE, Simon I. The HMMTOP transmembrane topology prediction server.

Bioinformatics 2001; 17:849-50.

[39] Huggett J, Dheda K, Bustin S, Zumla A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun 2005; 6:279-84.

[40] Prichard RK, Roulet A. ABC transporters and beta-tubulin in macrocyclic lactone resistance: prospects for marker development. Parasitology 2007; 134:1123-32.

[41] Echevarria F, Borba MFS, Pinheiro AC, Waller PJ, Hansen JW. The prevalence of anthelmintic resistance in nematode parasites of sheep in Southern Latin America:

Brazil. Vet Parasitol 1996; 62:199-206.

[42] Gopal RM, Pomroy WE, West DM. Resistance of field isolates of Trichostrongylus colubriformis and Ostertagia circumcincta to ivermectin. Int J Parasitol 1999; 29:781- 6.

[43] Vickers M, Venning M, McKenna PB, Mariadass B. Resistance to macrocyclic lactone anthelmintics by Haemonchus contortus and Ostertagia circumcincta in sheep in New Zealand. N Z Vet J 2001; 49:101-5.

[44] Molento MB, Antunes J, Bentes RN, Coles GC. Anthelmintic resistant nematodes in Brazilian horses. Vet Rec 2008; 162:384-5.

[45] Kaplan J. Drug resistance in nematodes of veterinary importance: a status report.

Trends Parasitol 2004; 20:477-81.

[46] Traversa D, von Samson-Himmelstjerna G, Demeler J et al. Anthelmintic resistance in cyathostomin populations from horse yards in Italy, United Kingdom and Germany.

Parasit Vectors 2009; 2:S4.

[47] Rufener L, Maser P, Roditi I, Kaminsky R. Haemonchus contortus acetylcholine receptors of the DEG-3 subfamily and their role in sensitivity to monepantel. PLoS Path 2009; 5:e1000380.

(41)

[48] McCavera S, Rogers AT, Yates DM, Woods DJ, Wolstenholme AJ. An ivermectin- sensitive glutamate-gated chloride channel from the parasitic nematode Haemonchus contortus. Mol Pharmacol 2009; 75:1347-55.

[49] Jones PM, George AM. Multidrug resistance in parasites: ABC transporters, P- glycoproteins and molecular modelling. Int J Parasitol 2005; 35:555-66.

[50] Chiu SL, Lu AYH: Metablism and tissue residues. In: Ivermectin and Abamectin.

Edited by Campbell WC. New York: Springer Verlag New York; 1989: 131-43.

[51] Kotze AC. Effects of macrocyclic lactones on ingestion in susceptible and resistant Haemonchus contortus larvae. J Parasitol 1998; 84:631-5.

[52] Kotze AC. Oxidase activities in macrocyclic-resistant and -susceptible Haemonchus contortus. J Parasitol 2000; 86:873-6.

[53] Alvinerie M, Dupuy J, Eeckhoutte C, Sutra JF, Kerboeuf D. In vitro metabolism of moxidectin in Haemonchus contortus adult stages. Parasitol Res 2001; 87:702-4 [54] Graf GA, Li WP, Gerard RD et al. Coexpression of ATP-binding cassette proteins

ABCG5 and ABCG8 permits their transport to the apical surface. J Clin Invest 2002;

110:659-69.

[55] Bates SE, Robey R, Miyake K et al. The role of half-transporters in multidrug resistance. J Bioenerg Biomembr 2001; 33:503-11.

Physiological and molecular comparison of susceptible and anthelmintic-resistant isolates of cattle parasitic nematodes

Aus dem Institut für Parasitologie der Tierärztlichen Hochschule Hannover