Impact of monocyte differentiation and intracellular infection on processing and presentation of autoantigen

(1)

Impact of monocyte differentiation and intracellular infection on processing and presentation of autoantigen

D I S S E R T A T I O N

zur Erlangung des akademischen Grades

Doctor of Philosophy (Ph.D.)

eingereicht an der

Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin

Von

Lydon Wainaina Nyambura

Präsidentin

der Humboldt-Universität zu Berlin Prof. Dr.-Ing. Dr. Sabine Kunst

Dekan der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin

Prof. Dr. rer. nat. Bernhard Grimm

Gutachter/innen

1. Dr. rer. nat. Michal Or-Guil 2. Prof. Dr. rer. nat. Peter Walden 3. Prof. Dr. rer. nat. Paul Wrede

Tag der mündlichen Prüfung: 27^th April 2018

(2)

(3)

II

Acknowledgment

I am grateful to my PhD Supervisor Prof. Peter Walden not only for his pivotal guidance and support, but also for the opportunity to join his research group at Charité- Universitätsmedizin Berlin a few years ago, and for his input in my continuous growth in the field of research.

I am thankful to Dr. Michal Or-Guil my PhD Supervisor based at Systems Immunology Lab at the Department of Biology, Humboldt University, Berlin, for her great guidance and support.

My appreciation goes to Prof. Peter Walden research group members for the constructive discussions, support and great company.

I also appreciate Deutscher Akademischer Austauschdienst (DAAD) for the PhD Scholarship award and Charité International Welcome Center for their help in matters pertaining to Ausländerbehörde.

Last but not least, I am very grateful to my family members and friends for their encouragement, support and prayers.

(4)

III

(5)

IV

Abstract

Dendritic cells (DCs) and macrophages are specialized antigen presenting cells that process self and foreign antigens and present them to T cells via major histocompatibility complex molecules, human leukocyte antigens (HLA) in humans, for induction of tolerance or initiation of T cell-mediated immune responses. Related to differentiation state, they have specific phenotypes and functions, and varied interactions with pathogens herein exemplified by Leishmania donovani (LD) that parasitize macrophages and propagate within their phagolysosomes. The impact of the differentiation state and intracellular infection on antigen processing and presentation by HLA class I remained undefined. To gain insight, we analyzed and compared the HLA-I self peptidomes of MUTZ3 cell line-derived human immature and mature DCs, and THP1 cell line-derived LD-infected and none-infected macrophages by liquid chromatography-tandem mass spectrometry (LC-MS/MS), as well as proteasome compositions by quantitative RT-PCR, and HLA expression and cell activation states by flow cytometry. We found that the HLA I-presented self-peptidomes of the cells in the different states were heterogeneous and individualized, dominated by nonapeptides with similar HLA binding affinities and anchor residues. They were sampled from source proteins of almost all subcellular locations and from proteins involved in various cellular functions in similar proportion including tumour-associated antigens (TAAs). The persistence of LD within the macrophage, did not affect macrophage activation. However, its impact was observed in self-peptidome heterogeneity, HLA binding affinities, anchor residue preferences, source protein peptide sampling (including TAAs) and HLA and proteasome expression.

Keywords: antigen processing/presentation, dendritic cells, macrophages, Leishmania donovani, major histocompatibility complex, mass spectrometry, peptidome

(6)

V

(7)

VI

Zusammenfassung

Dendritische Zellen (DCs) und Makrophagen sind spezialisierte antigenpräsentierende Zellen, die eigene und fremde Antigene prozessieren und mittels Haupthistokompatibilitätsmoleküle, humane Leukozytenantige (HLA) im Menschen, T-Zellen präsentieren, um Toleranzen zu induzieren oder T-Zell-vermittelte Immunantworten zu initiieren. Abhängig von ihrer Differenzierung haben sie spezifische Phänotypen und Funktionen undunterschiedliche Interaktionen mit Pathogenen, in dieser Arbeit durch Leishmania donovani (LD) repräsentiert, welche in Phagolysosomen der Makrophagen propagieren. Der Einfluss der Differenzierungszustände und von intrazelluläre Infektionen auf die Antigenprozessierung und -präsentation waren weitgehend undefiniert. Um hier Einblick zu gewinnen, haben wir die HLA-I-präsentierten Selbstpeptidome von menschlichen unreifen und reifen DCs, die aus der MUTZ3-Zelllinie generiert wurden, und LD-infizierte bzw. nicht-infizierte aus der THP1- Zelllinie generierte Makrophagen mittels Flüssigchromatographie-Tandem- Massenspektrometrie (LC-MS/MS), sowie die Proteasom-Zusammensetzung per RT-PCR und die HLA-Expression und Aktivierungszustände der Zellen per Durchflusszytometrie analysiert und verglichen. Wir fanden, dass die HLA-I-Selbstpeptidome der Zellen heterogen und individualisiert waren, von Nonapeptiden dominiert wurden und ähnliche HLA- Bindungsaffinitäten und Ankerreste aufwiesen. Sie stammten aus Quellenproteinen aus fast allen subzellulären Lokalisationen und mit unterschiedlichen zellulären Funktionen in ähnlichen Anteilen und schlossen Tumor-assoziierter Antigene (TAAs) ein. Die Persistenz der LD hatte keinen Einfluß auf den Aktivierungszustand der Makrophagen, verursachte aber eine weitgehende Veränderungen des Peptidoms, der HLA-Bindungsaffinitäten und Ankerreste, der Quellproteine einschließlich TAAs und der HLA- und Proteasom-Expression.

Stichwörter: Antigenprozessierung / -präsentation, dendritische Zellen, Makrophagen, Leishmania donovani, Haupthistokompatibilitätskomplex, Massenspektrometrie, Peptidom

(8)

VII

(9)

VIII

Abbreviation

ANN Artificial neural networks APC Antigen presenting cell CD 34+ Pluripotent stem cells CD Cluster of differentiation CD4+ Cluster of differentiation 4 CD8+ Cluster of differentiation 8

CHAPS 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate CID Collision-induced dissociation

CTLs Cytotoxic T cells DC Dendritic cells

ECD Electron-capture dissociation ELISpot Enzyme-linked immunosorbent spot ER Endoplasmic reticulum

ERAAP Endoplasmic reticulum amino peptidase associated with antigen processing ESI Electrospray ionization

ETD Electron-transfer dissociation

GM-CSF Granulocyte-macrophage colony stimulating factor HLA Human leukocyte antigen

HPLC High performance liquid chromatography hTERT Human telomerase reverse transcriptase IEDB Immune epitope database

IL-4 Interleukin-4 KDa Kilo dalton

LARP1 La-related protein 1

LC- MS/MS liquid chromatography tandem mass spectrometry

(10)

IX LD Leishmania donovani

LMP2 Proteasome subunit beta type-9 LMP7 Proteasome subunit beta type-8 M/z Mass to charge ratio

MBOA7 Lysophospholipid acytransferase 7 MECL1 Proteasome subunit beta type-10 MHC Major histocompatibility complex MS Mass spectrometry

MS/MS Tandem mass spectrometry

MUTZ3 Cytokine-dependent CD34+ human acute myeloid leukaemia cell line MUTZ3 iDC MUTZ3 derived immature dendritic cells

MUTZ3 mDC MUTZ3 derived mature dendritic cells PDB Protein database

PI Propidium iodide

PININ 140 kDa nuclear and cell adhesion-related phosphoprotein PRAME Preferentially expressed antigen in melanoma

PSME3 Proteasome activator complex subunit 3

RHAMM Receptor for hyaluronic acid–mediated motility ROS1 Proto-oncogene tyrosine-protein kinase ROS RPMI Roswell park memorial institute medium TAAs Tumour associated antigens

TAP Transporter associated with antigen processing TBS Tris-buffered saline

TFA Trifluoroacetic acid

THP1 Human monocytic cell line derived from an acute monocytic leukemia patient THP1MФ THP1 derived macrophages

(11)

X

THP1MФi THP1 derived macrophages infected with Leishmania donovani

THP1MФiy THP1 derived macrophages infected with YFP transfected Leishmania donovani

TRRAP Transformation/transcription domain-associated protein UHRF1 E3 ubiquitin-protein ligase UHRF1

URP2 Femitin family homolog 3 WT1 Wilms tumor protein YFP Yellow fluorescent protein

Amino acids one and three letter code Ala A Alanine

Arg R Arginine Asn N Asparagine Asp D Aspatic acid Cys C Cysteine Gln Q Glutamine Glu E Glutamic acid

Gly G Glycine His H Histidine Ile I Isoleucine Leu L Leucine Lys K Lysine Met M Methionine Phe F Phenylalanine

Pro P Proline Ser S Serine Thr T Threonine Trp W Tryptophan Tyr Y Tyrosine Val V Valine

(12)

XI

(13)

XII

1. Introduction

I.1 The immune system

The immune system is a collection of cells, tissues and molecules within organisms that defends against invading pathogens and cancer; and consists of two arms; the innate and the adaptive immune system. The innate immune response is the first line of defense and entails; Firstly, tight junctioned epithelial cells which line the internal and external body parts such as the skin, gastrointestinal, urogenitol and respiratory tract creating a physical barrier between the internal milieu and the pathogen-containing external milieu. Secondly, mucus secretion by internal mucosa epithelia, that coat pathogens and inhibit their attachment. Thirdly, movement by epithelia cilia in respiratory tract that expulse pathogen. Fourthly, microbicidal secretions by epithelial cells such as gastric acid in the gastrointestinal tract, phospholipase A and lysozyme in tears and saliva, and beta-defensins in genitourinary tract (1,2). In addition, in case a pathogen bypasses the epithelial barrier, phagocytes are chemotactically recruited at the infection site, where they recognize, engulf and destroy invading pathogens (3-5). Two types of circulating phagocytes are recruited at the infection site; the neutrophils which are short lived and then the monocytes which differentiate into long lived tissue-resident macrophages or dendritic cells.

Neutrophils and macrophages express pathogen recognition receptors (PRRs) that recognize pathogens, infected cells, damaged cells or cancer cells via pathogen associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs). The binding of PRRs to PAMPs or DAMPs triggers transcription of pro-inflammatory cytokines, chemokines, type I interferons, antimicrobial proteins and phagocytosis (6). The neutrophils and macrophages phagocytose the pathogen, infected cell, damaged cell or cancer cells into phagosome which fuse with lysosomes to form phagolysosome. The phagocytosed contents are destroyed by enzymes such as proteases, glycosidases, and sulfatases, and leukocyte-derived toxic products such as nitric oxide, superoxide anion and hydrogen peroxide which are released in a process termed respiratory burst. While neutrophils die shortly after phagocytosis, macrophages persist

(18)

2

and serve as antigen-presenting cells activating the adaptive immune response also known as antigen-specific immune response (7,8). Immature DCs have a comparable gene expression profile with macrophages, but with a lower endo-phagocytic capacity and major histocompatibility complex (MHC) class II expression. (9-12). They can capture both self and foreign antigen in diverse tissues, migrate to secondary lymphoid organs, and present processed antigens via MHC molecules to T lymphocyte cells, linking the innate and adaptive immune response (13) (see Figure 1). In adaptive immune response, more so the cell mediated, tissue- resident immature DCs take up antigen in an inflammatory context generated by cell damage, inflammatory cytokines or microbial components and undergo a maturation process to mature DCs. The maturation process is accompanied by epithelia adhesion reduction, endo-phagocytic down regulation, costimulatory molecules (CD40, CD80 and CD86) and MHC molecules upregulation (14,15). The mature DCs migrate into draining lymph nodes or the spleen, and prime antigen-specific T-cell responses (13,16,17). Once activated, cytotoxic T cells (CTLs) also known as CD8+ T cells recognize their targets i.e. the infected cells and tumuor cells by binding to antigen-derived peptide associated with MHC class I molecule (discussed later).

Upon binding the targets cells, the CD8+ T cells destroy them by releasing membrane pore- forming proteins such as perforin and proteolytic enzymes such as granzyme (18-20). By contrast CD4+ T cells activated by binding antigen-derived peptide associated with MHC class II molecule assist other white blood cells in immunologic processes, including maturation of B cells into memory B cells and plasma cells, and activation of macrophages and cytotoxic T cells (20,21).

(19)

3

Figure 1. The central role of DCs and T cells in the adaptive immune response (from (21))

I.2 The major histocompatibility complex

The major histocompatibility complex (MHC) or human leukocyte antigens (HLA) complex in human is a gene complex located within chromosome 6 and contains more than 220 genes of diverse functions including those encoding proteins of immune system. The genes in this complex are divided into basic groups including; class I and class II. The MHC class I genes consists of HLA-A, HLA-B, and HLA-C while the MHC class II genes consists of HLA-DR, HLA-DQ and HLA-DP. The MHC I and MHC II differ in both the structure and cell type they are expressed.

The MHC I is expressed on all nucleated cells, and is a heterodimer consisting of two polypeptide chains; α chain that consists of α1, α2, and α3 domains, and the light chain (β2- microglobulin). The α chain and β2-microglobulin are linked together through the noncovalent interaction of β2-microglobulin and α3 domain, while the domains α1 and α2 form the peptide

(20)

4

binding groove which is closed on both sides allowing 8-12 amino acids peptides to bind the molecule as illustrated in Figure 2. The α1, α2 and α3 subunits are encoded by three different genes HLA-A, HLA-B and HLA-C which are mostly heterozygous and highly polymorphic resulting to high diversity of HLA class I molecules. Currently, there are 3,968 HLA-A, 4,828 HLA-B and 3,579 HLA-C alleles (http://hla.alleles.org). This diversity impacts on the nature and composition of the peptide-binding groove, and hence the peptide repertoire presented on the surface by MHC class I molecules, for CD8+ T lymphocytes.

Figure 2. Crystal structure of the human HLA-A*02:01complex as a flat-ribbon model. The α-subunit is coloured brown and the β2m is coloured blue. The human immunodeficiency virus p17 Gag-derived peptide SLYNTVATL located in the binding groove of the HLA-A*02:01 molecule is shown as red and blue balls, and sticks. The PDB file 1t20 (22) was used for the visualization and representation of the crystal structure was performed with Litemol 3D molecular viewer software (San Diego, USA).

MHC Class II molecules are expressed in all cell types, especially professional antigen- presenting cells (APCs) such as macrophages, B cells, and dendritic cells (DCs). MHC class II

(21)

5

consists of α chain (α1 and α2 domain) and β chain (β1 and β2 domain) which are anchored to cell membrane via transmembrane domains^. The peptide-binding groove formed by α1 and β1 domains is open on both ends, allowing binding of longer peptides (13-17 amino acids). MHC class II molecules are also highly polymorphic resulting to high diversity. To date, 2376 HLA- DRB1, 1,142 HLA-DQB1 and 894 HLA-DPB1 alleles have been identified (http://hla.alleles.org), that differ in the structures of their peptide binding grooves, which inturn impact the specificity of peptide bound on MHC class II molecules, for CD4+ T lymphocytes.

I.3 Peptide binding to MHC class I molecules

MHC class I molecules bind peptides with high promiscuity, and 10,000 different peptides can be bound by an MHC class I allomorph species (23-28). The MHC-bound peptides stabilise the MHC molecule, without which it is unstable (29). The peptides bind to the MHC molecules via the interaction of the peptide N-terminal amino and C-terminal carboxy group with the conserved amino acids at the ends of peptide binding groove, via hydrogen bonds (30).The vast majority of MHC I peptides are 8-12 amino acids long, but longer peptides can be accommodated by the bulging of the peptide at the central portion (31-33). Though the MHC class I molecules bind many different peptides, only a subset of all the available can bind to each allele (31,34). The MHC I binding groove consist of six binding pockets, designated by the letters A to F (35), as illustrated in Figure 3. Due to HLA polymorphism these binding pockets vary greatly in size or physicochemical properties allowing the binding of only those peptides with amino acids that are complementary to the structure and chemical properties of the binding pockets of particular HLA (36,37). For example, in HLA-A*02:01 molecule pockets there a preference of isoleucine, leucine or methionine at position 2 (P2) and a preference for large hydrophobic side chains at the carboxy terminus of the peptide (PW) (38).

The amino acids at P2 and carboxy terminus of the peptide are termed dominant anchor motifs, while the rest are termed secondary anchor motifs. The dominant anchor motifs confer

(22)

6

significant binding energy, but the total binding energy to the MHC is the sum contribution of all the residues in the binding cleft (39).

Figure 3. Surface of the HLA-A*02:01 molecule binding groove. The binding pockets A to F and the bound human immunodeficiency virus p17 Gag-derived peptide SLYNTVATL are shown. The PDB file 1t20 (22) was used for the mapping and representation of HLA-A*02:01 binding groove was carried out using LiteMol 3D molecular viewer software (San Diego, USA).

I.4 Antigen processing and presentation

The antigen processing and presentation represent a multi-step process by which an antigen either intracellular or extracellular is processed and presented at the surface of an antigen presenting cells to be exposed to the surveillance of CD4+ and/or CD8+ T cells (see Figure 4).

The antigen processing involves two distinct pathway each dedicated to the presentation of antigens by MHC class I molecules or MHC class II molecules.

(23)

7

Figure 4. Representation of MHC Class I and MHC Class II antigen processing pathways and cross presentation (from (40))

In the MHC Class I pathway, an antigen is loaded onto MHC class I molecules through a so called classical pathway, where endogenously expressed self or viral proteins in the cytosol are processed through a multicatalytic protease complex, the proteasome (constitutive and immunoproteasome) (41,42). The constitutive proteasome consists of the 20S core and two regulatory 19S subunits. The 20S core a 28-subunit barrel-like particle has three catalytically active subunits β1, β2 and β5, which hydrolyse the peptide bond (43-46). The β1, β2 and β5 subunits exhibit caspase-like, trypsin-like, and chymotrypsin-like activities; which hydrolyse after acidic, basic and hydrophobic amino acids residues, respectively (47-49). The activity of the proteasome can be altered by stimulation of the cells with inflammatory cytokines such as interferon-gamma (INF-γ) replacing the active β1, β2 and β5 subunits with their homologues (immunoproteasome); β1i (LMP2), β2i (MECL1) and β5i (LMP7), that exhibit chymotrypsin-

(24)

8

like, trypsin-like and chymotrypsin-like activities, respectively.This altered cleavage pattern by the immunoproteasome enhance the quantity and quality of the generated peptides for presentation on MHC class I molecules (50-55). The degraded products by the proteasome vary in length (2-25 amino acids) (51). In vitro studies show that more than 70% of all proteasome- generated peptides are too short to bind to MHC molecules, and only 15% has the correct length for MHC binding (56) .Others are extended at the N-terminus and are further degraded by aminopeptidases such as tripeptidyl peptidase II (TPPII) localised in the cytosol, with a preference for peptides longer than 15 amino acids (57). After processing in the cytosol, the peptides are transported into the endoplasmic reticulum (ER) via transporter-associated with antigen processing (TAP) where peptides longer than 10 amino acids are rapidly degraded by aminopeptidases such as endoplasmic reticulum amino peptidase associated with antigen processing (ERAAP) (58). The kinetics of the degradation of shorter peptides in ER proceeds much slower, as substrate detection is dependent on the sequence length (59). In the absence of the ERAAP, longer peptides are presented by MHC molecules, but such MHC-peptide complexes are unstable (60). The assembly of MHC-I heavy chain- β2m heterodimers with the peptides is coordinated by the peptide loading complex, which is composed of a disulphide-linked dimer of tapasin and thiol oxidoreductase ERp57, calreticulin and TAP molecules (60). The MHC I peptide complex is then transported to the cell surface via the Golgi apparatus for presentation to CD8+ T cells (61).

Extracellular antigens can also be presented by MHC class I molecules via an antigen processing pathway called cross-presentation (42). In this pathway, exogenous antigens that have been endocytosed are cross-presented on MHC class I molecules. The antigen is either loaded in endocytic compartments or escapes the endosomes into the cytosol, where it undergoes processing via the proteasome similarly to classical MHC I antigen processing and presentation pathway.

(25)

9

In MHC Class II pathway, exogenous particles, proteins or pathogens are taken into the cell through various pathways, including phagocytosis. These exogenous antigens are then processed in endocytic vesicles and subsequently loaded onto MHC class II molecules that have been assembled in the ER. Prior to peptide loading, the MHC class II αβ-chain dimers are assembled as a nonameric complex with the invariant chain (Ii) that protect against premature peptide or protein interactions in pre-lysosomal compartments. This complex traffics to the lysosome MHC class II compartment (MIIC), where Ii is subjected to sequential proteolysis.

The final cleavage product, a peptide known as class II-associated Ii peptide (CLIP) occupying the peptide-binding groove and is realized during peptide loading via an exchange reaction catalyzed by the chaperone-like molecule HLA-DM (62). The peptide (~10–16 amino acids) – MHC class II complexes are then moved through exocytic or recycling vesicles to the surface of the cell and presented to CD4+ T cells (62).

The collection of peptides presented by the MHC molecules at the cell surface is termed the HLA-peptidome. The HLA-peptidome has been shown to be influenced by the expression and rate of degradation of the source proteins, efficiency of peptide loading onto MHC molecules, the binding affinities of the individual peptides to the presenting MHC molecules (63-65), and the decay kinetics of specific MHC peptide complexes (66).

I.5 Leishmania, infection and cell mediated immune response

Leishmania are obligate intracellular protozoan parasites in vertebrates, of the order Kinetoplastida and the family Trypanosomatidae transmitted by the bites of infected female phlebotomine sandflies (67). Leishmania are causative agent of a spectrum of diseases collectively termed leishmaniasis endemic in 98 countries in Africa, Asia, South and Central America and Southern Europe. With 12 million people currently infected, and approximately 2 million new cases and 20 and 50 thousand deaths occurring yearly (68,69). Leishmaniasis is

(26)

10

a neglected tropical disease (https://www.cdc.gov), with no vaccine, and whose treatment includes the use of only 4 toxic compounds; sodium stibogluconate, miltefosine, Paromomycin and lipid formulations of amphotericin B. The disease is caused by about 21 of 30 Leishmania species, which include; L. donovani complex consisting of L. donovani and L. infantum (also known as L. chagasi in the New World), L. mexicana complex consisting of L. mexicana, L.

venezuelensis and L. amazonensis; L. tropica, L. aethiopica and L. major, and the subgenus Viannia consisting of L. braziliensis, L. guyanensis, L. panamensis and L. peruviana. The different species are morphologically indistinguishable and only differentiable by molecular methods and monoclonal antibodies (https://www.cdc.gov). Depending on virulence of the infecting Leishmania species, geographic region and the host immune response leishmaniasis can have different clinical manifestation in human (Table I). The main clinical forms of the disease include; visceral leishmaniasis (VL) a systemic disease characterised by fever weight loss, enlargement of the spleen and liver, and anaemia; cutaneous leishmaniasis (CL) characterised by one or several ulcer(s) or nodule(s) in the skin; mucocutaneous leishmaniasis (MCL) characterised by progressive destructive ulcerations of the mucosa, extending from the nose and mouth to the pharynx and larynx (70). Other forms include; diffuse cutaneous leishmaniasis (DCL) characteristised by numerous nonulcerating nodules with an abundant parasite load in the skin (71) and post kala-azar dermal leishmaniasis (PKDL) characterised by a macular, maculo-papular or nodular rash on the skin and is a complication of VL, frequently observed after treatment (72).

(27)

11

Table I. Leishmania species, geographic distributions and different clinical manifestation in human

Parasite Clinical forms^a Geographic distributions

L. donovani

(A)VL, PKDL China

AVL, PKDL India, Nepal, Bangladesh

CL Sri Lanka

ZVL, AVL, PKDL,

CL East Africa, Sudan, Ethiopia

L. infantum ZVL, ZCL

Southern Europe Eastern Mediterranean China

L. chagasi ZVL, ZCL Central and South America

L. major ZCL

Middle East, Southwest Asia Africa

L. tropica ACL, ZCL, LR Middle East, Southwest Asia Africa

L. aethiopica CL, (MCL), DCL East Africa

L. mexicana ZCL, DCL Central America

L. amazonensis ZCL, DCL Central and South America L.braziliensis CL, MCL Central and South America

L. panamensis CL Central and South America

L. guyanensis CL Central and South America

aAVL: anthroponotic visceral leishmaniasis; ACL: anthroponotric cutaneous leishmaniasis; DCL:

diffuse cutaneous leishmaniasis; LR: leishmaniasis recidivans; MCL: mucocutaneous leishmaniasis;

PKDL: post kala-azar dermal leishmaniasis; ZCL: zoonotic cutaneous leishmaniasis; ZVL: zoonotic visceral leishmaniasis (Adapted from (73)).

In its life cycle (see Figure 5), Leishmania exist in a dimorphic state; the flagellated, motile promastigote form (15-30 µm in length and 5 µm in breadth) found in the midgut of sandfly vectors and the non-motile amastigote form (3–6 µm in length and 1–3 µm in breadth) found within phagolysosome of the vertebrate host macrophages, and devoid of external flagellum. The life cycle begins when metacyclic promastigotes are inoculated into the host by infected female sandfly during blood meal. The promastigotes are then taken up by neutrophils and macrophages, but since neutrophils are short lived, they only serve as serve as intermediate host cells, while macrophages which are phagocytes as well as antigen presenting cells are the final host cells (74-76). The

(28)

12

promastigotes are internalized into macrophage phagolysosomes where they transform into none motile amastigotes. The amastigotes are able to survive the harsh milieu in the phagolysosome, multiply, and eventually rapture the macrophages and infect new macrophages (77). The amastigotes are then taken up by female sandfly during a blood meal from a Leishmania infected person. Within a period of 4 to 25 days, the amastigotes transform to promastigotes and multiply in the midgut gut of the infected sandfly, and are inoculated in a new host during another blood meal, thus completing the cycle (78).

Figure 5. Representation of the Leishmania life cycle (Source (73))

(29)

13

Leishmania are able survive and multiply in the harsh milleu in macrophage phagolysosome

through subversion of the host immune system and promotion of pro-parasitic host factors (79).

The infection of macrophages by Leishmania leads to production of immuno-regulatory cytokines such as IL-10 and TGF-β that are known to inhibit/deactivate macrophage functions (80-82).

Leishmania also encode arginase augmenting host cellular arginase activities thus inhibiting the production of inducible nitric oxide synthase (iNOS), an enzyme which catalyzes L-arginine to generate nitric oxide (NO) (83). NO is a toxic molecule that plays a major role in killing intracellular parasites (84,85). Leishmania also avoid exposure to oxidants, by subverting the free oxygen species (ROS) within the phagolysosome through diverse mechanisms including heme degradation and prevention of the NADPH oxidase complex assembly by inhibiting phosphorylation of cytosolic p47phox; a key event for the NADPH oxidase activation (86,87). The Leishmania infection has also been shown to down modulate MHC molecules expression on macrophages (88,89), but impact of Leishamania infection on antigen processing and presentation in macrophages, which are the primary hosts, remain undefined.

I.6 Dendritic cells and macrophage cell models

Cytokine-dependent CD34+ human acute myeloid leukemia cell line (MUTZ3) derived DCs are similar to human DCs in many respects such as; a similar expression profile both in the immature and the mature forms (90,91), antigen processing and presentation, and ability to induce specific T-cell proliferation (92). Human monocytic leukemia cell line THP1 derived macrophages (THP1MФ), on the other hand, are similar to native monocyte-derived macrophages in several aspects including differentiation and phagocytosis (93-96).

The MUTZ3-derived DCs and THP1-derived macrophages (THP1MФ), have been extensively used as models for studying human dendritic cells and macrophages immune functions and responses towards intracellular pathogens (12,15,96-98), and given their transient proliferative

(30)

14

ability of CD34+ derived precursors, they constitute an unlimited supply of human dendritic and macrophage cells. MUTZ3-derived DCs and THP1MФ represents suitable in vitro cell line model systems to study and compare the HLA peptidomes of DCs at different states and macrophages to gain insights into how different differentiations impact antigen processing and presentation, and how Leishmania (L. donovani) influences antigen processing and presentation in human macrophages.

I.7 Peptidomics in antigen processing and presentation

Peptidomics represent a novel approach to analyze naturally occurring peptides/epitopes associated to MHC molecules (see figure 6). When supported by specialized proteomics tools, peptidomics approaches are now allowing in-depth elucidation of the HLA-peptidome.

Analysis of these peptides is of pivotal importance in fundamental studies of antigen processing and presentation, and identification of T cell epitopes for vaccine design.

Figure 6: Representation of HLA-peptidome analysis process

and denatured

(31)

15

In that regards, the high-performance liquid chromatography-electrospray ionization- tandem massspectrometry (HPLC–ESI–MS/MS), which is the current state of the art technology that allows fast identification of several hundreds of MHC ligands in one experimental approach, is used (23,99). In this setup, a complex peptide sample is first separated by HPLC using a reverse phase column that separates peptides by their hydrophobicity. The eluted peptides are then directly subjected to soft ionization by an online coupled electrospray ionisation (ESI) device followed by fragmentation in a collision chamber by low energy collision induced dissociation (CID). In CID, one peptide species out of a mixture is selected in the first mass spectrometer and is then dissociated by collision with an inert gas, such as argon or helium. The resulting fragments are separated in the second part of the tandem mass spectrometer, producing the tandem mass spectrum, or MS/MS spectrum. Several bonds along the peptide backbone are fragmented forming ions types b and the y ions, which denote fragmentation at the amide bond with charge retention on the N or C terminus, respectively (see Figure 7). Ion types c and z at the N terminus and C terminus may also be obtained by fragmenting the peptide backbone by electron-capture (ECD) and electron-transfer dissociation (ETD) were peptide ions undergo non-ergodic fragmentation upon incorporating of a thermalised electron, either directly (ECD) or via transfer from an electron-donor anion (ETD)(100-102).

The obtained experimental fragmentation spectra is then matched against a calculated spectrum for all peptides in the protein databases using a number of different algorithms such as MASCOT(103), SEQUEST(104), X! TANDEM (105), MAXQUANT or OMSSA (106).

Peptides can also be sequenced denovo (i.e. sequencing without assistance of a linear sequence database) using sequit software (107), allowing for identification of mutations and peptides not listed in databases.

(32)

16

Figure 7. Nomenclature for the product ions generated in the fragmentation of peptide molecules by tandem mass spectrometry as per Roepstorff and Fohlman (108). Peptide fragment ions are indicated by a, b, or c if the charge is retained on the N-terminus and by x, y or z if the charge is maintained on the C-terminus. The subscript indicates the number of amino acid residues in the fragment. R1, R2, R3 represent the side chains of the amino acid residues. In collision induced dissociation (CID) ion type’s b and y are formed.

(33)

17 I.8 Aim of Study

Dendritic cells (DCs) and macrophages are specialized antigen presenting cells that process self and foreign antigens and present them to T cells via major histocompatibility complex molecules, human leukocyte antigens (HLA) in humans, for induction of tolerance or initiation of T cell-mediated immune responses. Related to differentiation state, they have specific phenotypes and functions, and varied interactions with pathogens herein exemplified by Leishmania donovani (LD) that parasitize macrophages and propagate within their phagolysosomes. The impact of the differentiation state and intracellular infection on antigen processing and presentation by HLA class I remained undefined. The objective of this study is to gain insight on this, through the analysis and comparison of HLA-I self peptidomes of MUTZ3 cell line-derived human immature and mature DCs, and THP1 cell line-derived LD- infected and none-infected macrophages by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Focusing on;

 Number of shared HLA-I peptides and source proteins,

 Peptide lengths, HLA allele specificity and binding affinities

 Frequency of anchor motifs on dominant anchor positions on MHC

 Subcellular locations and molecular functions of source proteins

 MHC-presented leukemia TAAs peptides

In addition, through the analysis and comparison of proteasome compositions by quantitative RT PCR and HLA expression and macrophage activation by flow cytometry methods.

(34)

18

(35)

19

2. Materials and Methods

2.1 Cell lines

The commercially acquired human myeloid leukemia-derived cell line MUTZ3 (DMSZ GmbH, Braunschweig, Germany) heterozygous for HLA-A*02:01, HLA-A3, HLA-B44 and HLA-B56 (92,109,110) was grown in α-MEM medium (Gibco, Grand Island, NY, USA), supplemented with 10% conditioned medium from bladder carcinoma cell line 5637, 20% heat-inactivated fetal calf serum (FCS) (Biochrom, Berlin, Germany), 100 µg/ml streptomycin-penicillin (Gibco, Grand Island, NY, USA) and 50 µM β-mercaptoethanol (Sigma, Steinheim, Germany) at 37°C under 8% CO2.

The acute monocytic leukemia-derived human cell line THP1 (ATCC TIB-202) homozygous for HLA-A*02:01, HLA-B*15:11 and HLA-C*03:03 (111) was grown in RPMI 1640 medium (Invitrogen, Karlsruhe, Germany) supplemented with 10% heat-inactivated FCS (Biochrom, Berlin, Germany) and 100 µg/ml streptomycin-penicillin (Gibco, Grand Island, NY, USA) at 37°C under 8% CO2.

The HeLa cell line (ATCC CCL-2) was cultured in Iscoves Basal medium (Biochrom, Berlin, Germany) supplemented with 10% heat-inactivated FCS (Biochrom, Berlin, Germany) at 37°C in a humidified atmosphere with 8% CO2. The HeLa cell line clone 33/2 (HeLa A2+/IP) that stably expresses the three inducible proteasome subunits LMP2, MECL1 and LMP7 (112);

kindly provided by Prof. P. M. Kloetzel, Charité, Berlin, Germany) were cultured in the same conditions and medium with 2 µg/ml puromycin (Roche, Mannheim, Germany) and 300 µg/ml hygromycin (Roche, Mannheim, Germany).

(36)

20

The T2 cells from Prof. Peter Cresswell (Yale, New Haven, CT, USA) were cultured in DMEM (Gibco-BRL, Karlsruhe, Germany) with 10% heat-inactivated FCS (Biochrom, Berlin, Germany) at 37°C in 8% CO2.

2.2 Parasites

The wild type LD MHOM/IN/02/BHU5 (BHU5) (113) promastigotes were established from splenic aspirates of an Indian patient and cultured in M199 culture medium (Gibco, Grand Island, NY, USA) supplemented with 20% heat-inactivated FCS (Biochrom, Berlin, Germany) at 25°C. The YFP-transfected LD (YFP-BHU5) promastigotes were cultured in the dark in the same medium with 50 µg/ml hygromycin (Roche, Mannheim, Germany).

2.3 Generation of immature and mature DC, and macrophages

To generate the MUTZ3 iDCs, MUTZ3 cells were differentiated for 7 days in the presence 20 ng/mL recombinant human IL-4 (Pep Rotech, Rock hill, NJ, USA), 100 ng/ml recombinant human GM-CSF (Genzyme, Cambridge, MA, USA), and 2.5 ng/mL recombinant human TNFα (Strathmann Biotech, Hamburg, Germany) minus the conditioned medium from 5637 bladder carcinoma cell line. The cytokines were refreshed at day 3. Further differentiation to MUTZ3 mDCs was achieved by addition of 10 ng/mL LPS (Sigma-Aldrich, Germany) at day 7 and culturing for additional 48-72 hours. To generate the THP1-derived macrophages (THP1MΦ), THP1 cells were differentiated in the presence of 50 ng/ml phorbol 12-myristate 13-acetate (PMA) (Sigma, Steinheim, Germany) for 48 hrs. Subsequently, for LC-MS/MS the MUTZ3 iDC, MUTZ3 mDC and THP1MΦ cells were harvested by 10 min centrifugation at 800 x g, shock-frozen in liquid nitrogen and stored as pellets at -80°C.

(37)

21

2.4 MUTZ3 iDC, MUTZ3 mDC and THP1MΦ phenotype analysis by flow cytometry

DC and macrophage phenotypes were assessed by flow cytometry. 1 x 10⁵ MUTZ3 iDC and MUTZ3 mDC cells were stained with fluorochrome-labeled monoclonal antibodies against CD80, CD83, CD86, HLA-ABC, HLA-DR (BD Bioscience, Heidelberg, Germany) and HLA- A2 (BioLegend, Eching, Germany). 1 x 10⁵ THP1MФ cells were stained against HLA-ABC (BD Bioscience, Heidelberg, Germany) and HLA-DR (BioLegend, Eching, Germany). The expression of these markers on the surface of the DCs and THP1MФ was determined with a FACSCalibur flow cytometer (Becton Dickinson, Heidelberg, Germany); and the data were processed and analyzed using CellQuest (Becton Dickinson, Heidelberg, Germany) and WinMDi 2.9 (Purdue University, USA) software, respectively. The macrophage phenotype was also confirmed by adherence of THP1MΦ to the T 25 cm² cell culture flask (Nunc, Wiesbaden, Germany).

2.5 THP1MФ infection with Leishmania donovani

To infect THP1MФ with the BHU5 or YFP-BHU5, parasites were harvested by centrifugation at 500 x g for 8 minutes, washed, re-suspended in RPMI 1640 medium (Invitrogen, Karlsruhe, Germany) and added to the THP1MФ refreshed cultures in the ratio parasites:THP1MФ 10:1, and cultured for 48 h at 37°C under 8% CO2. Subsequently, THP1MФ and YFP-BHU5 infected THP1MФ (THP1MΦi-y) were used immediately to access the uptake of YFP-BHU5 by THP1MФ and its effects on HLA-ABC and HLA-DR expression. THP1MФ and BHU5 infected THP1MФ (THP1MΦi) were used to access viability, HLA-ABC, HLA-A*02:01 and CD83 expression, and were harvested by 10 min centrifugation at 800 x g, shock-frozen in liquid nitrogen and stored as pellets at -80°C for isolation of HLA.

(38)

22

2.6 Parasite uptake, viability, activation and HLA expression

To determine the uptake of LD by THP1MΦ and effects on hosts viability, CD83, HLA-ABC, HLA-A*02:01 and HLA-DR expression flow cytometry was used. THP1MФ and THP1MΦiy or THP1MΦi were stained with fluorochrome-labeled monoclonal antibodies against CD11b, CD83, HLA-ABC (BD Bioscience, Heidelberg, Germany), HLA-A*02:01 and HLA-DR (BioLegend, Eching, Germany), Calcein-AM (Invitrogen, Eugene, Oregon, USA) and Propidium Iodide (PI) (Sigma-Aldrich, Steinheim, Germany). The expression of these markers on the cell surface and of calcein and PI fluorescence was determined with a FACSCalibur flow cytometer (Becton Dickinson, Heidelberg, Germany). CellQuest (Becton Dickinson, Heidelberg, Germany) and WinMDi 2.9 (Purdue University, USA) software were used to process and analyze the data, respectively. The uptake was assessed by CD11b expression against YFP fluorescence, and cell viability assessed using Calcein-AM Invitrogen, Eugene, Oregon, USA) and propidium iodide (PI) (Sigma-Aldrich, Steinheim, Germany). CD83 was used as a marker of macrophage activation.

2.7 Total RNA isolation and cDNA synthesis

Total RNA was extracted from THP1MФ, THP1MФi, HeLa cell line, and HeLa clone 33/2 (A2+/IP) using Nucleospin RNA II Purification Kit (Macherey-Nagel, Duren, Germany) as per the manufacturer’s instructions. 1 x 10⁶ cells were put in 2ml eppendorf tubes and lysed with 350 μl lysis buffer. Samples were centrifuged and the supernatant was mixed with 350µl (70%) ethanol and centrifuged through a nuceospin RNA column, to bind the RNA to the silica gel membrane. Traces of DNA were removed by DNAse treatment. DNAse and any contaminant were washed away with wash buffer and RNA was eluted in RNase-free water. RNA concentration was measured at room temperature with a UV/VIS spectrophotometer (Perkin Elmer, Germany) according to manufacturer’s instruction with 1µl of the RNA sample diluted 50 times with RNase-free water. cDNAs were synthesized from 500 ng each of the DNase-

(39)

23

treated total RNA using superscript III reverse transcriptase kit (Invitrogen, CA, USA) as per the manufacturer’s instructions. cDNA-3’ Primer (AAG CTG TGG TAA CAA CGC AGA GTC GAC TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT VN) was used in a cDNA synthesis mixture containing (20 μl) 5x First strand Buffer, (4 μl) 0.1 M DTT , 200 U superscript III reverse transcriptase enzyme, 20 pmol cDNA-3’ primer, 10 mM dNTP mix and 500 ng RNA. The cycling condition comprised of denaturation at 65°C for 5 minutes, annealing and cDNA synthesis at 50^oC for 60 minutes and termination at 72^oC for 15 minutes.

2.8 Constitutive and immunoproteasome expression in THP1MФ and THP1MФi The impact of the infection by LD on the constitutive and immunoproteasome expression of THP1MΦ was determined by semi-quantitative RT-PCR. RT-PCR was carried out with 500 ng of THP1MФ, THP1MФi, HeLa cell line, and HeLa clone 33/2 (A2+/IP) of each cDNA using the following constitutive (β1, β2 and β5) and immunoproteasome (β1i, β2i and β5i) subunits, and GADPH-sequence specific forward and reverse primers (114). β1:

GACTCCAGAACAACCACTG, CTTGGTCATGCCTTCCCG (399 bp; BC000835.2, NM_057099.2); β2: CTGAAGGGATGGTTGTTGC, CTTTCTCACACCTGTACCG (558bp;

D38048.1, NM_053532.1); β5: CCAAACTGCTTGCCAACATG,

GAGTAGGCATCTCTGTAGG (275 bp; D29011.1, XM_341314.3); Hsβ1i:

CTACTGTGCACTCTCTGG, GCCTGGCTTATATGCTGC (313 bp; U01025); Hsβ2i:

GAAGATCCACTTCATCGC, CTCCAGGGTTAGTGGCTTC (571 bp; Y13640); Hsβ5i:

GGAGAAAGGAACGTTCAG, TTGATTGGCTTCCCGGTAC (648 bp; U17496); GAPDH:

CCTTCATTGACCTCAACTAC, CACCACCCTGTTGCTGTAG (869 bp; NM_002046.2, NM_017008.2). Each RT PCR setup contained (5 µl) 10x Dream Taq green buffer (Thermoscientific, Darmstadt, Germany), (2 µl) 2.5 mM dNTP mix, (0.5 µl) of each 30 pmol/µl GADPH-sequence specific forward and reverse primers, (1 µl) of each 100 pmol/µl constitutive or immunoproteasome subunits sequence specific forward and reverse primer, 500 ng cDNA,

(40)

24

15,875 µl PCR grade water and 0.125 µl Dream Taq DNA polymerase (Thermoscientific, Darmstadt, Germany). PTC-200 Peltier Thermal Cycler (BIO-RAD, München, Germany) was used and thermo-cycling conditions were denaturation at 96°C for 2 min, 30 cycles of denaturation at 95°C for 40 sec, primer annealing at 55°C to 68°C for 1 min, primer extension at 72 °C for 40 sec and a final cycle of extension at 72°C for 10 min. The amplified DNA fragments were analyzed by electrophoresis using 1% agarose gels in 1 x TBE buffer with 0,006 % ethidium bromide (Roth, Karlsruhe, Germany). HeLa cell line, and HeLa clone 33/2 (A2⁺/IP) were used as positive controls for constitutive and immunoproteasome subunits respectively. GelAnayzer2010 (http://www.gelanalyzer.com/download.html) was use to semi- quantitatively analyze the subunit band intensities. For each subunit, the band intensity was divided by the value for the GAPDH amplified in the same reaction tube.

2.9 Statistical analyses for macrophage activation, HLA and proteasome subunits expression

Macrophage activation, HLA expression and proteasome subunits expression between THP1MФ and THP1MФi/or THP1MФiy were compared by paired 1-tailed student’s t-test and differences indicated as significant when *p < 0.05. Data are presented as the mean ± standard deviation from three independent experiments.

2.10 Isolation and purification of MHC I-presented peptides

MHC class I molecules were isolated as described in (115-117). (2.4 x 10⁹) MUTZ3 iDC, (2.1 x 10⁹) MUTZ3 mDC, (2.8 x 10⁹) THP1Mɸ and (2.3 x 10⁹)THP1Mɸi cells were lyzed each in 20 mM Tris-HCl buffer (Sigma, Steinheim, Germany), pH 7.4, 0.3% CHAPS (Roth, Karlsruhe, Germany), 0.2% NP-40 (Thermo Scientific, Bonn, Germany), 145 mM NaCl (Sigma, Steinheim, Germany), 1 mM EDTA (Merck, Darmstadt, Germany), 1mM Pefabloc (Roche, Mannheim, Germany). Lysates were ultracentrifugated for 1 hr at 100,000 x g and the supernates passaged through a column with 19-1.78 monoclonal antibody of irrelevant

(41)

25

specificity followed by a column with the monoclonal anti-human HLA-I antibody W6/32, both coupled to activated CH Sepharose (Amersham Biosciences, Uppsala, Sweden) as per manufacturer’s protocol. After adsorption of the proteins, the anti-human HLA-I column was washed with the following in descending order; 20 mM Tris, 145 mM NaCl, pH 7.4 (TBS), 0.3% CHAPS in TBS, TBS, 0.3% ß-octylglycoside (Roche, Mannheim, Germany) in TBS, TBS and finally with ultrapure water. HLA-peptide complexes were eluted from the column with 0.7 % TFA (Sigma, Steinheim, Germany) in ultrapure water. High molecular weight components were separated from peptides by centrifugal ultrafiltration using a 3 kDa molecular weight cut-off (Centricon, Millipore, Schwalbach, Germany). The filtrates were fractionated on a Smart HPLC system (Amersham Biosciences, Freiburg, Germany) using a reverse phase column µRPC C2/C18, SC2.1/10 (Amersham Biosciences, Freiburg, Germany) and an acetonitrile (Sigma-Aldrich, Steinheim, Germany) gradient of 5 - 90% of B (solvent B: 90% of acetonitrile, 0.1 % TFA; solvent A: 0.1% TFA in ultrapure water). The fractions obtained were lyophilized in vacuum centrifuge/speed vac (Thermo Savant, Sant Jose, USA) and re-dissolved in 12 µl of 0.1% TFA 2% acetonitrile for LC-MS/MS.

2.11 LC-MSMS analysis of HLA ligands

The peptides fractions were analyzed by reverse phase liquid chromatography using the Ultimate 3000 nano-HPLC system (Dionex, Darmstadt, Germany) coupled on-line to MicrOTOF-Q ESI-QTOF mass spectrometer (Bruker Daltonics, Bremen, Germany). Peptide fractions were loaded onto a C18 precolumn at a flow rate of 20 μL/min in 98% solvent A (1%

acetonitrile, 0.1% FA) for 5 minutes, and then onto a PepMap nano-HPLC column (75μm×15cm i.d.) (LC Packings, The Netherlands) at a flow rate of 220 nL/min and 2% solvent B (95% acetonitrile, 0.1% FA) and 98% solvent A. A gradient of 5-60% of B over 60 min, then 60-90% of B over 5 min and finally 90 % of B for 5 min was used to elute the peptides. The MicrOTOF-Q ESI-QTOF masspectrometer was controlled by MicrOTOF control software,

(42)

26

version 2.2 (Bruker Daltonics) and operated in a data-dependent mode. Fragmentation of peptides was done on the five most intensive signals using optimized collision energy. A dynamic exclusion time of 1 min was used to avoid repeated fragmentation of the most abundant precursors.

2.12 LC-MS/MS data processing and analysis

The processing of the MS and MS/MS spectra was done using Data Analysis 3.4 and Biotools 3.1 software (Bruker Daltonics). The peptides were identified by a local MASCOT server (version 2.2), using the Swissprot databank version 56.3 for human proteins (20,408 entries), a precursor mass tolerance of 50 ppm, and 100 ppm for MS/MS, and oxidation of methionine as possible modification. For each peptide-spectrum match, candidate sequences were validated using a statistical evaluation -10logP, where logP is the logarithm to the base 10 of P (P<0.05) as the absolute probability. Further validation of the identified peptides on the basis of de novo sequencing was done using the Sequit software (107), and by manual inspection of the peptide- spectrum. The protein sequence, protein ID and gene symbol for proteomic data analyses were extracted from Uniprot database (118). The human protein reference database (119) was used to classify proteins according to their subcellular localizations and biological function. HLA assignment of the peptides was done on the basis of canonical binding motifs, using SYFPEITHI (120) and immune epitope database IEDB (121,122).Visualization of the binding motifs for HLA-A*02:01, HLA A3, HLA B44 molecules for the nonapeptides derived from the MUTZ3 iDC and MUTZ3 mDC, and HLA-A*02:01, HLA-C*03:03 and HLA-B*15:11 from THP1MΦ and THP1MΦi was done using sequence logos (123,124). Artificial neural networks (ANN) or netMHCpan in IEDB (121,122,125,126) was used to assign the HLA binding affinities to the peptides.

(43)

27 2.13 Peptides

Published clinically validated leukemia tumour associated antigens (TAAs) HLA-A*02:01 epitopes (Table 2), and HLA-A*02:01 peptides identified from MUTZ3 DCs and THP1MФ HLA class I–peptidomes from potential leukemia TAAs (TAAs that have been described in other solid and hematological malignancies); and HIV polymerase peptide (Table 3) were synthesized by EMC microcollections GmbH (Tubingen, Germany) with a purity >95%.

Lyophilized peptides were dissolved in DMSO (Pierce, Rockford, Illinois, USA) and stored at -20°C. The binding affinity of these peptides was determined using T2 cell line HLA-A*02:01 binding assay, and by prediction using ANN in IEDB (121,122).

Table 2. Published clinically validated leukemia TAAs HLA-A*02:01 epitopes.

Protein Peptide Sequence Immunogenicity and clinical relevance

(Reference)

hTERT P540_hTERT ILAKFLHWL (127,128) PRAME P300_PRAME ALYVDSLFFL (129-133)

WT1 P187_WT1 SLGEQQYSV (134,135)

RHAMM P165_RHAMM ILSLELMKL (132,136-138) PROTEINASE 3 P169_PROTEINASE 3 VLQELNVTV (139,140)

(44)

28

Table 3: Potential Leukemia TAAs HLA-A*02:01 epitopes derived from MUTZ3 DCs & THP1MФ HLA-I peptidome; and HIV polymerase peptide

Protein Peptide Sequence Peptide

Source

Protein role in cancer (Reference) MBOA7 P141_MBOA7 GLLPDVPSL MUTZ3 iDC (141-143)

LARP1 P130_LARP1 ALPPVLTTV MUTZ3 mDC (144,145) TRRAP P378_TRRAP TLADLVHHV MUTZ3 mDC (146-148) PININ P207_PININ RLLEQKVEL THP1MФ (149-151) ROS1 P308_ROS1 HLVDEAHCLRL THP1MФ (152-156)

PSME3 P114_PSME3 QLVDIIEKV THP1MФ (157) URP2 P326_URP2 ALSNLEVKL THP1MФ (158,159) UHRF1 P57_UHRF1 TLFDYEVRL THP1MФ (160,161) HIV Polymerase* P564_HIVPol LLFGXPVYV

*Used as positive control for T2 cell line HLA-A*02:01 binding assay

2.14 T2 cell line HLA-A*02:01 binding assay

To determine the HLA-A*02:01 binding affinity of each peptide in Table 2 and 3, TAP- deficient HLA-A*02:01-positive T2 lymphoma cell line was used as previously described (162) with slight modifications. 2 x 10⁵/ml of TAP-deficient HLA-A*02:01 -positive T2 lymphoma cell line were seeded in DMEM (Gibco-BRL, Karlsruhe, Germany) with 2 µg/ml β2- microglobulin (Sigma-Aldrich, Steinheim, Germany) and incubated with 100 µM sequence specific peptides for 18hrs at 37°C and 8% CO2. After incubation, cells were harvested by centrifugation at 400 x g for 7 min, washed with PBS (Gibco, Grand Island, NY,USA) re- suspended in 200 µl PBS (Gibco, Grand Island, NY,USA) and incubated with anti- human HLA-A2 FITC clone BB7.2 mAb (BioLegend, Eching, Germany) for 45 min at 4°C. Cells were

(45)

29

then washed with 500 µl PBS (Gibco, Grand Island, NY, USA) and re-suspended in 400 µl PBS (Gibco, Grand Island, NY, USA). Fluorescence intensity was measured using FACSCalibur flow cytometer (Becton Dickinson, Heidelberg, Germany), and the data were processed and analyzed using CellQuest (Becton Dickinson, Heidelberg, Germany) and WinMDi 2.9 (Purdue University, USA) softwares. The P564_HIVpol peptide in Table 3 was used as positive control and T2 cells without peptide as a negative control.

2.15 PBMCs from Healthy Volunteers

The clinical material was used with approval by Charite’ ethics committee (Approval No.

EA1/222/14 and EA1/026/14) and written informed consent by Volunteers. HLA typing was carried out by the HLA typing laboratory, Charite’ University, Berlin. PBMCs were isolated from peripheral blood of 4 HLA- A*02:01 positive Healthy Volunteers by density centrifugation using Ficoll Paque (density 1.077 g/ml) (Biochrom, Berlin, Germany). To isolate the PBMCs, blood was diluted with an equal volume of PBS (Gibco, Grand Island, NY,USA) and layered on top of 15 ml Ficoll solution (Biochrom, Berlin, Germany) using a 50 ml falcon tube. A ficoll gradient was created by centrifuging for 20 minutes at 1000 x g at room temperature, with the brake off. PBMCs were collected from the Ficoll: plasma interface, washed twice with PBS (Gibco, Grand Island, NY, USA) and cryopreserved in FCS (Biochrom, Berlin, Germany) with 10% DMSO (Pierce, Illinois, USA) at -140°C. For in vitro priming, thawed PBMCs from the 4 healthy donors were pulsed individually with 10 µg/ml of each peptide in ExVivo 15 serum-free medium (Biowhitaker, Belgium) at 37°C and 8% CO2. 50 U/ml of recombinant human IL-2 (Chiron, München, Germany) was added to the cultures on day 1, and day 3. On day 8 the primed PBMCs were harvested, washed with PBS (Gibco, Grand Island, NY, USA) and counted before analysis using INFγ ELISpot assay.

(46)

30 2.16 IFNγ ELISpot Assay

2.5 x 10⁵ primed PBMCs from 4 healthy donors were pulsed individually with 10 µg/ml of each peptide in ExVivo 15 serum-free medium (Biowhitaker, Belgium) in 96 well multiscreen plates (Milipore, Darmstadt, Germany) coated overnight at 4°C with 100 µl (1:1000) of anti-human INFγ capture monoclonal antibody (Endogene, Pierce Biotechnology, Inc). PBMCs pulsed with Phytohaemagglutinin (PHA) (2.5 μg/ml) (Sigma-Aldrich, Steinheim, Germany) and PBMCs with culture medium only were used as positive and negative control respectively. ELISpot plates were incubated for 18 hrs hours at 37°C and 8% CO2. Plates were then washed twice with PBS (Sigma-Aldrich, Steinheim, Germany) and incubated with 50 µl (1:500) biotinylated anti-human IFN-γ antibody (Endogene, Pierce Biotechnology) for 2 hrs at room temperature (RT). Following washing twice with PBS (Gibco, Grand Island, NY, USA), plates were incubated with 50 µl streptavidin-conjugated with alkaline phosphatase (1:2000) (Roche, Mannheim, Germany) for 1 hr at RT and washed 3 times with 100 µl PBS (Gibco, Grand Island, NY,USA) followed by 50 µl BCIP/NBT (5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium) substrate for 30 min as per manufacturer’s instructions (Moss Inc., Pasadena, CA, USA). ELISpot plates were dried overnight at 4 °C and thereafter scanned and counted using Bioreader 3000 (BioSys, Karben, Germany).

(47)

31

3. Results

3.1 MUTZ3-derived immature and mature DCs and THP1-derived macrophages phenotypes

After differentiation of MUTZ3 cell line to MUTZ3 iDC and MUTZ3 mDC their phenotypic status was determined by measuring the expression of DCs maturation markers CD83, CD80, CD86, HLA DR, HLA ABC, and HLA-A*02:01 by flow cytometry. The maturation markers were expressed in both MUTZ3 iDC and MUTZ3 mDC, to a slightly greater extent in the mature DC phenotype (Figure 8A). The expression of these maturation markers in both DC phenotypes was in agreement to previous reports (92,163). The differentiation of THP1 to macrophages was ascertained by the adherence of THP1MΦ to the surface of the cell culture Flask (Figure 8B) and expression of HLA DR and HLA ABC (Figure 8C)

Figure 8: DC and macrophage differentiations. A) A representative of analysis of MUTZ3 iDC and MUTZ3 mDC phenotypes. MUTZ3 iDCs were generated by culturing the MUTZ3 cells as detailed in

(48)

32

material and methods, after which the MUTZ3 mDC were generated by addition of LPS. Expression levels of CD80, CD86, CD83, HLA ABC, HLA-A*02:01, and HLA-DR on the surface of both MUTZ3 iDC and MUTZ3 mDC were analyzed by flow cytometry. B) Acquisition of an adherent phenotype by THP1 upon differentiated to THP1MΦ after exposure to PMA. C) Expression levels of HLA-DR and HLA ABC in THP1MΦ

3.2 Naturally presented HLA I ligands in MUTZ3 DCs and THP1MФ

MUTZ3 iDC, MUTZ3 mDC and THP1MΦ cells were lysed, and MHC class I molecules isolated by affinity chromatography, and peptides extracted from the MHC molecules analyzed by LC-MS/MS. The sequences of a total of 327, 301 and 347 HLA class I-bound peptides were identified from 297, 273 and 282 source proteins in MUTZ3 iDC, MUTZ3 mDC and THP1MΦ respectively (Supplementary table 1). Though the MUTZ3 iDC and MUTZ3 mDC are derived from the same cell line and have the same HLA-I alleles, only 59 and 74 HLA I peptides sequences were found to be shared between them based only on peptide sequences, and precursor peptide masses signals and retention times respectively. MUTZ3 iDC and MUTZ3 mDC express HLA-A*02:01, HLA-A3, HLA-B44 and HLA-B56, THP1MΦ HLA-A*02:01, HLA-C*03:03 and HLA-B*15:11 (92,109-111). In reference to HLA-A*02:01, a total of 77, 99 and 122 HLA-A*02:01 restricted peptides were identified from MUTZ3 iDC, MUTZ3 mDC and THP1MΦ respectively. Only 12 and 18 of these peptides were found to be shared between MUTZ3 iDC and MUTZ3 mDC, 8 and 13 between THP1MΦ and MUTZ3 iDC, 8 and 11 between THP1MΦ and MUTZ3 mDC, and 2 among MUTZ3 iDC, MUTZ3 mDC and THP1MΦ, based on peptide sequences, and precursor peptide masses signals and retention times respectively. In reference to the source proteins of the identified peptides, 64 source proteins were found to be shared between the MUTZ3 iDC and MUTZ3 mDC, 10 between THP1MΦ, MUTZ3 iDC and MUTZ3 mDC, 15 between THP1MΦ and MUTZ3 iDC, and 15 between THP1MΦ and MUTZ3 mDC (Figure 9)

(49)

33

Figure 9. Overlap in HLA-I peptides and source proteins in MUTZ3 iDC, MUTZ3 mDC and THP1MФ

3.3MHC I-bound peptide lengths in MUTZ3 DCs and THP1MФ

The MHC I-bound peptide lengths in both DCs and the macrophage phenotypes were dominated by nanopeptides with 55 to 57% of all the identified peptides. The dominance of nanopeptides was also observed in the shared peptides between MUTZ3 iDC and MUTZ3 mDC, and in the HLA-A*02:01-bound peptides shared among the MUTZ3 DCs and THP1MΦ.

This dominance of nanopeptides has also been observed in other cell lines, and patient tumor samples (117,164-166), and indicates that nine amino acids is the optimum length for MHC I- binding peptides. Decapeptides were the second dominant, and constituted 22% and 25% for MUTZ3 iDC and MUTZ3 mDC, and 12% for THP1. Undecapeptides and above, on the other hand were less than 2% in both MUTZ3 iDC and MUTZ3 mDC, and 6% in THP1MΦ (Figure

(50)

34

10). The percentages of undecapeptides were very similar between the MUTZ3 DCs, as compared to those of THP1MΦ whereas the share of decapeptides among all HLA I-bound peptides from THP1MΦ it is only half of what was found for the MUTZ3 DCs.

Figure 10: MHC Class I -peptide lengths in MUTZ3 iDC, MUTZ3 mDC and THP1MΦ.

(51)

35

3.4 HLA allomorph assignment and binding affinities of peptides in MUTZ3 DCs and THP1MФ

We utilized canonical peptide binding motifs listed in the SYFPEITHI database (120) and ANN in IEDB (121,122) for the respective HLA class I to identify the MHC restriction of the peptides. For MUTZ3 iDC 70%, 23%, 4%, and 1% of the peptides were assigned to HLA-B44, HLA-A*02:01, HLA-A3, and HLA-B56, respectively, and 48%, 32%, 13%, and 5% to MUTZ3 mDC. Approximately 2% of the peptides in both DC phenotypes were unassigned (Figure 11A). In THP1MΦ 40%, 37% and 23% of the peptides were assigned to HLA-A*02:01, HLA- C*03:03 and HLA-B*15:11, respectively. In both MUTZ3 DC phenotypes, the percentages of peptides assigned were in the order HLA-B44≥ HLA-A*02:01 ≥ HLA-A3≥ HLA-B56. To determine what percentage of the identified MHC-1 peptides (8-14mers) had biological significant binding affinity, we used ANN in IEDB (121,122) and applied a binding affinity IC50 threshold of 500 nM, which was established previously for known T cells epitopes, and had been shown to correlate with immunogenicity (167). In MUTZ3 DCs, the percentage of peptides that were within this threshold was relatively the same across all the alleles, and the difference was only seen in HLA-A*02:01 peptides, where the percentages were higher in MUTZ3 iDC (82%) as compared to MUTZ3 mDC (60%). No peptides were within this threshold for HLA-B56. In THP1MΦ the highest percentage of peptides was seen in HLA- A*02:01 (52%) (Figure 11B). The cumulative percentage frequencies for HLA-A*02:01 and HLA-B44 peptides in MUTZ3 DCs were the same, but there was a shift towards higher affinity peptides for HLA-A3 in MUTZ3 mDCs. In reference to the HLA-A*02:01-bound peptides in MUTZ3 DCs and THP1MΦ, at IC50 threshold of 100nM the cumulative percentage frequencies were similar, and all above 82% (Figure 11C).

Impact of monocyte differentiation and intracellular infection on processing and presentation of autoantigen