or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier’s permissions site at:

(1)

non-commercial research and educational use including without limitation use in instruction at your institution, sending it to specific colleagues that you know, and providing a copy to your institution’s

administrator.

All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access,

or posting on open internet sites, your personal or institution’s website or repository, are prohibited. For exceptions, permission may be sought for such use through Elsevier’s permissions site at:

http://www.elsevier.com/locate/permissionusematerial

(2)

Rapid identification of potato virus Y strains by one-step triplex RT-PCR

Stefania Rigotti, Paul Gugerli

^∗

Agroscope Changins-W¨adenswil Research Station ACW, Department of Virology, CH-1260 Nyon 1, Switzerland Received 14 August 2006; received in revised form 26 October 2006; accepted 2 November 2006

Available online 8 December 2006

Abstract

A one-step triplex RT-PCR method was characterised that allows rapid, strain-specific detection of potato virus Y (PVY) occurring on potato:

PVY^N, PVY^O, PVY^NTN(recombinant isolates), PVY^NWi and PVY^C. Three specific primer pairs were designed on aligned PVY sequences available from genomic data banks. The specificity of the selected primers was first examined by simplex RT-PCR with a large number of PVY reference isolates. Two fragments of 0.44 and 1.11 kb were amplified for PVY^Nand non-recombinant PVY^NTNisolates, two fragments of 0.53 and 0.66 kb for PVY^Oisolates, a single fragment of 0.44 kb for recombinant PVY^NTNisolates, a 0.66 kb fragment for PVY^Cisolates and a 0.53 kb fragment for PVY^NWi isolate. The primers were then combined in a one-step triplex RT-PCR reaction, optimised stepwise and validated with the reference isolates. The great similarity between the genomes of PVY^Nand non-recombinant PVY^NTNprevented their differentiation using this method. No fragments were amplified with samples infected by non-related potato viruses, as well as with samples from healthy tobacco and potato plants. The one-step triplex RT-PCR described here fastens specific detection of PVY strains that are otherwise only distinguishable by combined serological and biological assays.

Keywords: PVY; One-step triplex RT-PCR; Detection; Differentiation

1. Introduction

Potato virus Y (PVY) is the type species of the Potyvirus genus of the Potyviridae, the largest recognized plant virus family (Hollings and Brunt, 1981). Members of this family consist of non-enveloped filamentous particles 680–900 nm long, encap- sulating a single-stranded positive RNA genome [(+) ssRNA]

of 9.7 kb (Astier et al., 2001). PVY is transmitted in the non- persistent way, by aphids, such asMyzus persicae(Radtke and Rieckmann, 1991). PVY affects potato worldwide, as well as other crops, including pepper, tobacco and tomato (Banttari et al., 1993; Shukla et al., 1994).

In the past, PVY has been classified in strain groups according to the symptoms they induce on potato and tobacco (de Bokx and Huttinga, 1981). Common strains (PVY^O) induce severe systemic mosaic, crinkle, leaf and stem necrosis in potato, but generally mild systemic mottling in tobacco. Tobacco veinal necrosis strains (PVY^N) induce mottling and characteristic vein necrosis in tobacco, but mild mottling in almost all potato culti-

∗Corresponding author. Tel.: +41 22 363 43 70; fax: +41 22 363 43 94.

E-mail address:paul.gugerli@acw.admin.ch(P. Gugerli).

vars. Two subgroups belonging to the PVY^Nstrain group were identified in potatoes more recently: PVY^NTN and PVY^NWi.

The former was first described in Hungary (Beczner et al., 1984). The virus causes the potato tuber necrotic ringspot disease (PTNRD) (Le Romancer et al., 1994). The latter was first isolated from the Polish cultivar Wilga (Chrzanowska, 1991). It induces on tobacco vein necrosis as PVY^N, but fails to react with PVY^Nspecific monoclonal antibodies. Thus, it may be a recombinant isolate between PVY^Oand PVY^N(Blanco-Urgoiti et al., 1998; Kerlan et al., 1999; Glais et al., 2002). The recombination phenomenon was also identified in the PVY^NTNgenome (Glais et al., 2002). However, the identification of non-recombinant PVY^NTNinducing PTNRD revealed that the recombinant structure of the genome is not a necessary prerequisite for the PTNRD phenotype (Glais et al., 2003; Nie and Singh, 2003a).

Strain or pathotype specific virus detection would be benefi- cial in certification programs of seed potatoes. Enzyme-linked immunoassays (ELISA) based on specific monoclonal antibodies (Gugerli and Gehriger, 1980; Gugerli and Fries, 1983) do not allow the distinction between PVY^Nand PVY^NTNor PVY^O and PVY^NWi. RT-PCR has therefore been proposed as a powerful alternative tool (Singh, 1998; Weilguny and Singh, 1998;

Lorenzen et al., 2006). The P1 protein gene that is considered

doi:10.1016/j.jviromet.2006.11.002

(3)

of strain-specific primers (Glais et al., 1996; Weidemann and Maiss, 1996; Rosner and Maslenin, 1999; Nie and Singh, 2002).

The construction of specific primers was also realised within the coat protein (Boonham et al., 2002a; Moravec et al., 2003) and in the whole genome (Nie and Singh, 2003b). Further specificity and simple handling is however needed for routine virus testing.

Expensive and time-consuming analysis, such as restriction fragment polymorphism analysis (RLFP), should also be replaced.

We aimed therefore to design more specific primers and to real- ize first strand cDNA synthesis and PCR in the same reaction tube, making virus detection and differentiation not only faster and more specific, but also less exposed to cross-contamination (one-step RT-PCR).

2. Materials and methods 2.1. Virus isolates and culture

The 26 PVY isolates used in this study are listed inTable 1.

Most of them were from the collection at Agroscope RAC and

tained onNicotiana tabacumcv.Xanthiiin a greenhouse at 20^◦C (18^◦C at night) with a 16 h photoperiod. Infected leaf samples were collected and stored in plastic bags at−20^◦C until use.

2.2. Total RNA extraction

Total viral RNA was extracted from 500 mg of fresh or frozen leaf tissue ofN. tabacumcv.Xanthiiaccording toMacKenzie et al. (1997).

2.3. Oligonucleotide primer design

The alignment of the partial or complete genome sequences of eight PVY isolates was performed using Vector NTI Program (Vector NTI Suite v. 6.0, InforMax, Inc.): PVY^N-605 (Jakab et al., 1997; accession number X97895), PVY^NTN-H (Thole et al., 1993; accession number M95491), PVY^N-Fr (Robaglia et al., 1989; accession number D00441), PVY^O-803 (Jakab et al., 1998, unpublished data; accession number AJ223594) and PVY^O-139 (Singh and Singh, 1996; accession number U09509),

Table 1

Origin of 26 PVY and 7 non-related potato virus isolates

Isolate no. (code) Isolate Host plant (cultivar) Country Source

605 PVY^N Potato (Bintje) Switzerland Agroscope RAC Nyon

779 PVY^N Potato (Sirtema) Switzerland Agroscope RAC Nyon

810 PVY^N Potato (unknown) Switzerland Agroscope RAC Nyon

1099 PVY^N Potato (Amigo) Belgium Agroscope RAC Nyon

1206 (v951156-1) PVY^N Potato (unknown) UK Boonham

1208 (v951218) PVY^N Potato (unknown) UK Boonham

1209 (PVY-N-RB) PVY^N Potato (unknown) UK Boonham

768 PVY^O Pepper (unknown) Italy Agroscope RAC Nyon

803 PVY^O Potato (Bintje) Switzerland Agroscope RAC Nyon

1205 (O-Gov) PVY^O Potato (unknown) UK Boonham

1207 (O-Des) PVY^O Potato (unknown) UK Boonham

1033 PVY^NTNa Potato (Nicola) Switzerland Agroscope RAC Nyon

1074 PVY^NTNa Potato (Erntestolz) Switzerland Agroscope RAC Nyon

1108 PVY^NTNa Potato (Nicola) Belgium Agroscope RAC Nyon

1148 PVY^NTNa Potato (Sirtema) Switzerland Agroscope RAC Nyon

1156 PVY^NTNa Potato (Priamo) Switzerland Agroscope RAC Nyon

1211 (v942490) PVY^NTNa Potato (unknown) UK Boonham

1214 (N-Pet) PVY^NTNa Petunia (unknown) UK Boonham

1212 (53-49) PVY^NTNb Potato (unknown) Denmark Boonham

1213 (PVY-C-CM) PVY^C Potato (unknown) UK Boonham

1204 (O-Tom) PVY^C Tomato (unknown) Portugal Boonham

1122 PVY^NWi Potato (D´esir´ee) Switzerland Agroscope RAC Nyon

775 PVA Potato (unknown) Switzerland Agroscope RAC Nyon

1103 PVA Potato (unknown) Canada Agroscope RAC Nyon

PVX Potato (unknown) Switzerland Agroscope RAC Nyon

1026 PVM Tomato (President) Switzerland Agroscope RAC Nyon

994 PVS Potato (Pepo) Switzerland Agroscope RAC Nyon

624 PVV Potato (Gladblaadje) The Netherlands De Bokx

PLRV Potato (unknown) Switzerland Agroscope RAC Nyon

aRecombinant PVY^NTN.

b Non-recombinant PVY^NTN.

(4)

Fig. 1. Schematic map established byGlais et al. (2002)using IC-RT-PCR/RFLP and genomic location of the oligonucleotide primers. A mosaic structure is present in the PVY^NTNand PVY^NWigenome, which contains sequences identical or similar to PVY^N(in grey) and PVY^O(in black).

PVY^NN242 (Glais et al., 2000, unpublished data; accession number AF248499), PVY^NWi-P (Glais et al., 2000, unpublished data; accession number AF248500) and PVY^NWi (Chachul- ska et al., 1996, unpublished data; accession number Z70238).

According tovan der Vlugt et al. (1993), the PVY^N-Fr isolate was considered as PVY^O. The selection of the primer sequences was done manually. Primers included mismatches in their 3-end, a 40–60% G/C content and nearly identical melting points.

2.4. One-step RT-PCR

One-step RT-PCR were done in a 50␮l reaction containing 2␮l of RNA extract (about 200 ng of total RNA), 2% (w/v) of sucrose, 0.1 mM of cresol red, 3.5 mM MgCl2, 0.8 mM of each dNTP, 0.4␮M of each primer, 12 units (U) of RNasin ribonucle- ase inhibitor (Promega), 3 U AMV RT (Promega) and 2.5 U of Tthpolymerase in 10×reaction buffer (Promega). Amplifica- tions were carried out in a thermocycler (Biometra TGradient) programmed for 1 cycle at 42^◦C for 1 h, 1 cycle at 94^◦C for 2 min, followed by 35 cycles at 94^◦C for 30 s, 57^◦C for 1 min and 72^◦C for 1 min. RT-PCR products were separated on a 1.5%

agarose gel in TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM EDTA) and observed by UV illumination after staining with ethidium bromide.

3. Results

3.1. Oligonucleotide primer design

The three primer pairs selected for the detection of the main PVY strains are represented inFig. 1and listed inTable 2. The

Table 2

Sequences and genomic location of the oligonucleotide primers

Primer Sequence 5–3 Genomic

location^a

PVYc3 CAACGCAAAAACACTCA(CT)AAA(AC)GC 34–57

PVYf TAAGTG(AG)ACAGACCCTCT(CT)TTCTC 667–690

PVY3+ TGTAACGAAAGGGACTAGTGCAAAG 4530–4554

PVY3− CCGCTATGAGTAAGTCCTGCACA 5622–5644

CP2+ CCAGTCAAACCCGAACAAAGG 8637–8657

CP1− GGCATAGCGTGCTAAACCCA 9149–9168

aNumbered in PVY^NTN-H (Thole et al., 1993; accession number M95491).

primers PVYc3 (forward) and PVYf (reverse), designed on the PVY^O-139 genome, are, respectively, located in the 5NTR and P1 genomic regions. These primers were selected to be able to anneal with PVY^O. The sequence of the PVY^N-605 genome was used to design two other primers, PVY3+ (forward) and PVY3−(reverse), which are, respectively, located in the CI and 6K2 genes. These primers were selected to be able to anneal specifically with PVY^N. The primers CP2+ (forward) and CP1−

(reverse), designed on the PVY^O-803 CP gene, were selected to be able to anneal with PVY^Oand PVY^NWi.

According to the published genome sequences, we expected to obtain a 1.11 kb band with primers PVY3+/3−from PVY^N strains, two bands of 0.66 and 0.53 kb with primers PVYc3/f and CP2+/1−from PVY^Oand finally a unique band of 0.53 kb with primers CP2+/1−from PVY^NWi. No fragments were expected to be amplified from PVY^NTN with either of these three pairs of primers but, as shown below, an unexpected shorter fragment was nonetheless obtained from all PVY^Nand PVY^NTNisolates.

3.2. Speciﬁcity of the simplex RT-PCR

To examine the specificity of the three newly designed primer pairs, about 200 ng of total RNA from tobacco plants infected by either of the virus isolates listed inTable 1, as well as from healthy tobacco and potato plants as negative controls, were ana- lyzed by RT-PCR. The sizes of the amplified RT-PCR fragments are listed inTable 3. With the PVYc3/f primers, the expected 0.66 kb fragment was amplified for all PVY^Oisolates as well as for PVY^C(results not shown). Surprisingly, a less intense band of 0.44 kb was also obtained for all PVY^Nand PVY^NTNisolates, while no fragment was amplified for the PVY^NWi isolate. Thus,

Table 3

Amplified bands by one-step triplex RT-PCR using the primers PVYc3/f, PVY3+/3−, CP2+/1−for the detection of different PVY strains

PVYc3/f [kb] PVY3+/3−[kb] CP2+/1−[kb]

PVY^N 0.44 1.11 –

Non-recombinant PVY^NTN 0.44 1.11 –

Recombinant PVY^NTN 0.44 – –

PVY^O 0.66 – 0.53

PVY^NWi (PVY^NWi-P) – – 0.53

PVY^NWi (PVY^NN242) 0.44 – 0.53

PVY^C 0.66 – –

(5)

and the RT-PCR product was sent out for direct sequencing (Fas- teris Life Sciences, Plan-les Ouates, Switzerland). The sequence data revealed an internal priming of the PVYf primer at genomic position 449–472 for the isolates belonging to the PVY^N and PVY^NTN. With the PVY3+/3−primer pair, the expected 1.11 kb fragment was amplified for all the PVY^Nisolates, as well as for the non-recombinant PVY^NTN isolate, while no fragment was amplified for any other PVY isolate. With the CP2+/1−primer pair, the expected 0.53 kb fragment was exclusively amplified for all PVY^O and PVY^NWi isolates. No bands were obtained for the commonly occurring potato viruses PVA, PVM, PVS, PVX, PVV and PLRV, as well as for healthy potato and tobacco plants, thus confirming the specificity of all the new primers.

3.3. Triplex RT-PCR

In order to simplify the procedure, the three primer pairs were combined together in the same RT-PCR mix (triplex RT- PCR). Identical concentration of reagents and PCR parameters as for the simplex RT-PCR were applied first. At equal primer concentration (0.4␮M of each primer), the PVY3+/3− and CP2+/1−primer pairs performed better than the degenerated PVYc3/f primer pair, producing more intense bands. Some arte- facts were generated too. Subsequently, the conditions were optimised according toChamberlain and Chamberlain (1994) andSingh et al. (2000). The three primer pairs were tested in various amounts, in order to enhance the fragment amplified by the primer pair PVYc3/f. Thus, the concentration of PVYc3/f was maintained at 0.4␮M, whereas the concentrations of PVY3+/3−

and CP2+/1−primers were lowered to 0.3, 0.25, 0.2, 0.15 and 0.1␮M. The optimal ratio of PVYc3/f:PVY3+/3−:CP2+/1−

primer concentration was found to be 0.4␮M:0.15␮M:0.2␮M, yielding bands of comparable intensity. Modified concentration of MgCl2, dNTP andTthpolymerase and altered PCR parameters (annealing temperature, elongation time and number of cycles) did not lead to significant improvements.Fig. 2shows

Fig. 2. Triplex RT-PCR amplifications by using the primers PVYc3/f, PVY3+/3−and CP2+/1−on total RNA ofN. tabacumcv.Xanthiiinfected with PVY^N-605 (lane 1), PVY^N-810 (lane 2), PVY^O-803 (lane 3), PVY^O-1207 (lane 4), recombinant PVY^NTN-1074 (lane 5), recombinant PVY^NTN-1156 (lane 6), non-recombinant PVY^NTN-1212 (lane 7), PVY^C-1204 (lane 8), PVY^C-1213 (lane 9), PVY^NWi-1122 (lane 10), PVA 775 (lane 11), PVX (lane 12), PVM 1026 (lane 13) and PVS 994 (lane 14). Lane 15: total RNA from healthy tobacco. Lane 16: negative control (no RNA). Lane M: molecular mass marker (100 bp DNA ladder).

and 1.11 kb were amplified for all PVY^Nand non-recombinant PVY^NTNisolates, two bands of 0.53 and 0.66 kb for all PVY^O isolates, a single band of 0.44 kb for all recombinant PVY^NTN isolates, a 0.66 kb band for both PVY^Cisolates and a 0.53 kb band for the PVY^NWi isolate. No fragments amplified from any other potato virus, nor from healthy tobacco and potato plants.

4. Discussion

Characterization of PVY is currently done by a combination of ELISA and inoculation of tobacco and potato indicator plants.

Strain differentiation is however not extensive and the bioassay is time consuming. Molecular techniques, such as RT-PCR, offer further specificity and sensitivity.

In the present study, a one-step triplex RT-PCR was designed to allow fast and strain-specific detection of PVY in field samples while diminishing the risk of carry-over contamination since tubes are not opened between cDNA synthesis and PCR amplification. Three new primer pairs were designed on aligned known PVY genomic sequences and individually validated by one-step simplex RT-PCR with a large number of PVY reference isolates. The three primer pairs were then combined together in the same reaction mix, in order to get simultaneously a strain group specific pattern of one or two bands on analytical agarose gels:

two bands of 0.44 and 1.11 kb for PVY^Nand non-recombinant PVY^NTNstrains, two bands of 0.53 and 0.66 kb band for PVY^O strain, a single band of 0.44 kb for recombinant PVY^NTNstrain, a single band of 0.53 kb for PVY^NWi strain and a unique band of 0.66 kb for PVY^Cstrain. As described byGlais et al. (2002), in silico RT-PCR, by using the three primers pairs, would allow to differentiate two subgroups inside the PVY^NWilga group: a single band of 0.53 kb for PVY^NWi strain (PVY^NWi-P type) and two bands of 0.44 and 0.53 kb for PVY^NWi strain (PVY^NN242 type). The unique PVY^NWi tested in this study belonged to the PVY^NWi-P type. Primers and reaction conditions were optimised stepwise for efficient cDNA synthesis and balanced PCR amplification of all expected fragments. The latent misprim- ing and amplification of non-specific products, due to the fact that the RT reaction was primed at lower temperature with the same primers as the PCR reaction, was not a major obstacle and was finally well controlled. Thus, the proposed procedure improves the two-step RT-PCR method described byNie and Singh (2003b). Unfortunately, PVY^Nand non-recombinant PVY^NTN still remain undistinguishable, due to their closely related genomic sequences. Considering the fact that the latter is less widespread than recombinant PVY^NTN (Boonham et al., 2002b), the new one-step triplex RT-PCR is nevertheless a powerful tool for rapid and sensitive PVY detection and differentiation. The genetics of potato tuber necrosis forming property needs indeed further investigations as well as the fact that it is not strictly limited to PVY isolates from the N strain group and that the Swiss reference isolate PVY^N-605 induces variable degrees of potato tuber ring necrosis in different European laboratories (Browning et al., 2004; Glais and Gugerli, unpublished results).

(6)

Acknowledgements

The authors thank Dr. N. Boonham (Central Science Labora- tory, Sand Hutton, York, UK) who kindly provided PVY isolates and Dr. R.P. Singh and Dr. I. Browning for helpful advices and correction of the manuscript. The study was partially funded by Bioreba AG.

References

Astier, S., Albouy, J., Maury, Y., Lecoq, H., 2001. Principes de Virologie Végétale: Génome, Pouvoir Pathogène, écologie des Virus. INRA éditions, Paris, 444 pp.

Banttari, E.E., Ellis, P.J., Khurana, S.M.P., 1993. Management of diseases caused by virus and viruslike pathogens. In: Rowe, R.C. (Ed.), Potato Health Man- agement. Plant Health Management Series. APS Press, St. Paul, MN, pp.

127–133.

Beczner, L., Horv´ath, J., Romhany, I., F¨orster, H., 1984. Studies on the etiology of tuber necrosis ringspot disease in potato. Potato Res. 27, 339–352.

Blanco-Urgoiti, B., Tribodet, M., Leclere, S., Ponz, F., P´erez de San Rom´an, C., Legorburu, F.J., Kerlan, C., 1998. Characterization of potato potyvirus Y (PVY) isolates from seed potato batches. Situation of the NTN, Wilga and Z isolates. Eur. J. Plant Pathol. 104, 811–819.

Boonham, N., Walsh, K., Preston, S., North, J., Smith, P., Barker, I., 2002a.

The detection of tuber necrotic isolates of Potato virus Y, and the accurate discrimination of PVY^O, PVY^Nand PVY^Cstrains using RT-PCR. J. Virol.

Methods 102, 103–112.

Boonham, N., Walsh, K., Hims, M., Preston, S., North, J., Barker, I., 2002b.

Biological and sequence comparisons of Potato virus Y isolates associated with potato tuber necrotic ringspot disease. Plant Pathol. 51, 117–126.

Browning, I., Charlet, K., Chrzanowska, M., Dedic, P., Kerlan, C., Kryszcuk, A., Schubert, J., Varveri, C., Werkman, A., Wolf, I., 2004. What is PVY^NTN? The reaction of potato cultivars to inoculation with a range of PVY isolates. In:

Kerlan, C. (Ed.), Abstracts 12th EAPR Virology Section Meeting, Rennes.

INRA Rennes, France, pp. 51–53.

Chamberlain, J.S., Chamberlain, J.R., 1994. Optimization of multiplex PCRs. In:

Mullis, K.B., Ferre, F., Gibbs, R.A. (Eds.), The Polymerase Chain Reaction.

Birkhauser, Boston, pp. 38–46.

Chrzanowska, M., 1991. New isolates of the necrotic strain of potato virus Y (PVY^N) found recently in Poland. Potato Res. 34, 179–182.

De Bokx, J.A., Huttinga, H., 1981. Potato virus Y. In: Descriptions of Plant Viruses, No. 242. CMI/AAB, Kew, England.

Glais, L., Kerlan, C., Tribodet, M., Marie-Jeanne Tordo, V., Robaglia, C., Astier-Manifacier, S., 1996. Molecular characterization of potato virus Y(N) isolates by PCR-RFLP. Eur. J. Plant Pathol. 102, 655–662.

Glais, L., Tribodet, M., Kerlan, C., 2002. Genomic variability in Potato potyvirus Y (PVY): evidence that PVY^NW and PVY^NTNvariants are single to multiple recombinants between PVY^Oand PVY^Nisolates. Arch. Virol. 147, 363–378.

Glais, L., Cohan, J.-P., Tribodet, M., Kerlan, C., 2003. Le phénomène de recom- binaison n’est pas une caractéristique de tous les variants PVYNTN du virus Y de la pomme de terre (PVY). Neuvièmes Rencontres de Virologie Végétale, Aussois.

Gugerli, P., Gehriger, W., 1980. Enzyme-linked immunosorbent assay (ELISA) for the detection of potato leafroll virus and potato virus Y in potato tubers after artificial break of dormancy. Potato Res. 23, 353–359.

Gugerli, P., Fries, P., 1983. Characterization of monoclonal antibodies to potato virus Y and their use for virus detection. J. Gen. Virol. 64, 2471–2477.

Hollings, M., Brunt, A.A., 1981. Potyvirus group. In: Descriptions of Plant Viruses, No. 245. CMI/AAB, Kew, England.

Jakab, G., Droz, E., Brigneti, G., Baulcombe, D., Malnoe, P., 1997. Infectious in vivo and in vitro transcripts from a full-length cDNA clone of PVY-N605, a Swiss necrotic isolate of potato virus Y. J. Gen. Virol. 78, 3141–3145.

Kerlan, C., Tribodet, M., Glais, L., Guillet, M., 1999. Variability of potato virus Y in potato crops in France. J. Phytopathol. 147, 643–651.

Le Romancer, M., Kerlan, C., Nedellec, M., 1994. Biological characterization of various geographical isolates of potato virus Y inducing superficial necrosis on potato tubers. Plant Pathol. 43, 138–144.

Lorenzen, J.H., Piche, L.M., Gudmestad, N.C., Meacham, T., Shiel, P., 2006. A multiplex PCR assay to characterize Potato virus Y isolates. Plant Dis. 90, 935–940.

MacKenzie, D.J., McLean, M.A., Mukerji, S., Green, M., 1997. Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription-polymerase chain reaction. Plant Dis. 81, 222–226.

Moravec, T., Cerovska, N., Boonham, N., 2003. The detection of recombinant, tuber necrosing isolates of Potato virus Y (PVY(NTN)) using a three-primer PCR based in the coat protein gene. J. Virol. Methods 109, 63–68.

Nie, X., Singh, R.P., 2002. A new approach for the simultaneous differentiation of biological and geographical strains of Potato virus Y by uniplex and multiplex RT-PCR. J. Virol. Methods 104, 41–54.

Nie, X., Singh, R.P., 2003a. Evolution of North American PVY(NTN) strain Tu 660 from local PVY(N) by mutation rather than recombination. Virus Genes 26, 39–47.

Nie, X., Singh, R.P., 2003b. Specific differentiation of recombinant PVY^N:Oand PVY^NTNisolates by multiplex RT-PCR. J. Virol. Methods 113, 69–77.

Radtke, W., Rieckmann, W., 1991. Maladies et Ravageurs de la Pomme de Terre.

Editions Th. Mann, Gelsenkirchen-Buer, 168 pp.

Robaglia, C., Durand-Tardif, M., Tronchet, M., Boudazin, G., Astier-Manifacier, S., Casse-Delbart, F., 1989. Nucleotide sequence of potato virus Y (N strain) genomic RNA. J. Gen. Virol. 70, 935–947.

Rosner, A., Maslenin, L., 1999. Differentiating PVY(NTN) by unique single- restriction cleavage of PCR products. Potato Res. 42, 215–221.

Shukla, D.D., Frenkel, M.J., Ward, C.W., 1991. Structure and function of the potyvirus genome with special reference to the coat protein coding region.

Can. J. Plant Pathol. 13, 178–191.

Shukla, D.D., Ward, C.W., Brunt, A.A., 1994. The Potyviridae. CAB Interna- tional, Wallingford, 516 pp.

Singh, M., Singh, R.P., 1996. Nucleotide sequence and genome organization of a Canadian isolate of the common strain of potato virus Y (PVY^O). Can. J.

Plant Pathol. 18, 209–224.

Singh, R.P., 1998. Reverse-transcription polymerase chain reaction for the detection of viruses from plants and aphids. J. Virol. Methods 74, 125–138.

Singh, R.P., Nie, X., Singh, M., 2000. Duplex RT-PCR: reagent concentrations at reverse transcription stage affect the PCR performance. J. Virol. Methods 86, 121–129.

Thole, V., Dalmay, T., Burgyan, J., Balazs, E., 1993. Cloning and sequencing of potato virus Y (Hungarian isolate) genomic RNA. Gene 123, 149–156.

Van der Vlugt, R.A.A., Leunissen, J., Goldbach, R., 1993. Taxonomic relation- ships between distinct potato virus Y isolates based on detailed comparisons of the viral coat proteins and 3-nontranslated regions. Arch. Virol. 131, 361–375.

Weidemann, H.L., Maiss, E., 1996. Detection of the potato tuber necrotic ringspot strain of potato virus Y (PVY^NTN) by reverse transcription and immunocapture polymerase chain reaction. J. Plant Dis. Prot. 103, 337–345.

Weilguny, H., Singh, R.P., 1998. Separation of Slovenian isolates of PVY(NTN) from the North American isolates of PVY(N) by a 3-primer PCR. J. Virol.

Methods 71, 57–68.