Development of a vector construct for the transformation of the coccolithophore Emiliania huxleyi

(1)

Master Thesis

Development of a vector construct for the transformation of the coccolithophore Emiliania huxleyi

Heike Gruber

Bremerhaven, November 2009

(2)

A thesis submitted for the degree of Master of Science in Bioanalytics

to Bremerhaven University of Applied Sciences, Germany

1^st Evaluator: Prof. Dr. rer. nat. Stephan Frickenhaus

Hochschule Bremerhaven – Bioanalytic, FB 1 An der Karlstadt 8, 27568 Bremerhaven

2^nd Evaluator: Dr. rer. nat. Klaus-Ulrich Valentin

Alfred-Wegener-Institute for Polar- and Marine Research Am Handelshafen 12, 27570 Bremerhaven

(3)

With courage greater than your fear, jump into the unknown and you will fly!

a valuable gift from Michi Ware, Buffalo 1996

(4)

Abstract

Genetic transformation of eukaryotic cells is a powerful tool to get an insight into gene functions of the studied organisms. The cosmopolitan coccolithophore Emiliania huxleyi is an important contributor to climate regulation and therefore a significant object to study. In this work, a transformation vector for the transformation of E. huxleyi was designed. It contains a putative promoter region of an endogenous fcp gene amplified from genomic DNA, and the resistance gene, neo, amplified from a commercially available plasmid, expressing resistance against the antibiotic G418. These two fragments were integrated into the MCS of the basic vector pUC18 creating the novel transformation vector PnpUC of which one clone was used for preliminary transformation experiments. A PDS1000/He microparticle bombardment system served for the delivery of the DNA into the cells. Conducted PCRs of isolated genomic DNA from bombarded cultures that were kept under selective conditions showed dissimilarities compared to genomic DNA from untreated E. huxleyi cultures. Investigations of the PCR revealing differences between the WT and modified cultures remain pending.

Keywords: Emiliania huxleyi, genetic transformation, fcp promoter, neo resistance gene, microparticle bombardment,

(5)

Declaration

I hereby certify that this thesis has been composed by me and is based on my own work, unless stated otherwise. Material from the published or unpublished work of others, which is referred to in the thesis, is credited to the author in the text.

This work has not been submitted for any other degree.

Name: Heike Gruber

Signature:

Date:

(6)

Symbols and Abbreviations

2N diploid

°C degree celcius

Ω ohm (electrical resistance)

µ growth rate

µ L microlitre

A adenine

ad fill up to

ANT-F/2 Antarctic seawater supplemented with half strengthened Guillard’s f-solution

approx. approximately

bp basepair

BLAST basic local alignment search tool

BSA bovine serum albumin

C Cytosine

CCMP culture collection for marine phytoplankton

d day

DMS dimethyl sulphide

DMSO dimethylsulphoxide

DMSP dimethyl sulphonio propionate

dNTP deoxy nucleotide triphosphate

DNA deoxyribonucleic acid

ds double stranded

e.g. exempli gratiā (for example)

egfp gene coding for enhanced green fluorescent

protein

EST expressed sequence tag

et al. et alii/aliae (and others)

f femto

µF micro Farad (unit for electrical capacitance)

fcp gene coding for fucoxanthin, chlorophyll

a/c-binding protein

FCP fucoxanthin, chlorophyll a/c-binding protein

Fig. figure

(10)

g gram

G Guanine

gfp gene coding for green fluorescent protein

GFP green fluorescent protein

h hour

He helium

HSP heat shock protein

ID identification number

i.e. id est (that means)

k kilo

kb kilo base pair

V voltage

L litre

LB Luria Bertani broth

ln natural logarithm

m metre

M molar (mols/litre)

MCS multi cloning site

min minute

mL millilitre

mRNA messenger ribonucleic acid

n nano

N number of cells

NCBI National Centre for Biotechnology Information neo gene coding for neomycin phosphotransferase II

OD optical density

ori origin of replication

PCR polymerase chain reaction

rpm rounds per minute

RT room temperature

s second

SEM scanning electron microscope

siRNA small interfering RNA

T Thymine

(11)

Tab. table

X-Gal 5-bromo-4-chloro-3-indolyl- beta-D-

galactopyranoside (substrate for β- galactosidase) WT wild type i.e. reference strain (CCMP 1516) used in

this work

(12)

List of Figures

Figure 1: Scanning electron microscope image of the coccolithophore Emiliania huxleyi...4 Figure 2: E. huxleyi summer bloom off the coast of Cornwall...5 Figure 3: pUC18 vector (2686 bp) as a basic vector to be modified for later

transformation of E. huxleyi. ...13 Figure 4: Assembly of single cloning fragments ...23 Figure 5: Growth curve of E. huxleyi in selective and unselective liquid media

with an initial cell count of 10*10³ cells/mL ...30 Figure 6: Seven single E. huxleyi cells under light microscope with a

magnification of 4000...32 Figure 7: pPha-T1 vector (4095 bp) for the transformation of P. tricornutum,

showing remaining restriction sites in desired positions ...33 Figure 8: Gel scan of a temperature gradient PCR for the amplification of the fcp

promoter region...34 Figure 9: Temperature gradient PCR for the amplification of the resistance gene

neo from 200 ng of the commercially available plasmid pSELECT ...35 Figure 10: Concentration gel of purified egfp product, showing roughly 200

ng/µL PCR product...36 Figure 11: Fast screening of PnpUC clones for plasmids with insert ...36 Figure 12: PpUC vector after treatment with EcoRI and SacI showing the desired

promoter as insert (494 bp) ...37 Figure 13: Light microscopical illustration of E. huxleyi culture approx. 2 weeks

after biolistic bombardment with PnpUC (7) in ANT-F/2 + G418 with a magnification of 4000...38 Figure 14: Sequence recovery PCR using resistance gene primers G418f and

G418r...39 Figure 15: Sequence recovery PCR using resistance gene primers G418f and

G418r...51

(13)

List of Tables

Table 1: Used antibiotics and their applied concentrations...11

Table 2: Designed primers containing suitable restriction sites for the amplification of the promoter region, resistance gene neo, and marker gene egfp...15

Table 3: Final PCR setup for the amplification of the E. huxleyi promoter region from genomic DNA ...18

Table 4: PCR program for the amplification of the E. huxleyi promoter region from genomic DNA ...19

Table 5: PCR setup for the amplification of the resistance gene neo from plasmid DNA. ...19

Table 6: PCR program for the amplification of the resistance gene neo from plasmid DNA. ...20

Table 7: PCR setup for the amplification of the egfp gene from plasmid DNA. ...20

Table 8: PCR program for the amplification of the egfp gene from plasmid DNA. ...21

Table 9: Reaction setup for restriction digestions...24

Table 10: Reaction setup for ligation. ...24

Table 11: Sequences of M13 primers used for sequencing. ...25

Table 12: Reaction setup of a sequencing PCR using M13 primers. ...26

Table 13: PCR temperature program used for sequencing PCRs...26

Table 14: PCR setup for PnpUC (7) sequence recovery. ...27

Table 15: PCR temperature programs for PnpUC (7) sequence recovery with M13¹ and G418² primer pairs using High Fidelity Phusion DNA Polymerase. ...27

(14)

1. Introduction

Algae play a major part in climate regulation, since they are accountable for the net primary production of ~52,000,000,000 tons of organic carbon per year, which is about half of the total organic carbon produced on earth each year (Field et al., 1998). However, this is not the only reason why algae are of enormous biological importance. They constitute a heterogeneous group of ~40,000 species, describing a life-form, not a systematic unit, which is one reason why a broad spectrum of phenotypes exists in this group. Algae are very diverse, showing different sizes and shapes and they not only occupy all aquatic ecosystems but also occur in almost all other habitats, some of which are extreme (Hallmann, 2007).

Transgenesis in algae is a complex and fast-growing technology and a powerful tool for the manipulation of these organisms. The introduction of genes into a cell by means of genetic transformation enables us to investigate biochemical processes, either to gain knowledge of cellular biochemistry and get insights of metabolic pathways, or to produce a commercially valuable compound (Dunahay et al., 1995). Selectable marker genes, promoters, reporter genes, transformation techniques, and other genetic tools and methods are already available for various algal species and currently, there are ~25 species accessible to genetic transformation(Hallmann, 2007).

The careful selection of an appropriate target organism stands at the beginning of every algal transformation project. The global impact of the chosen organism is portrayed and outlined in this introduction. Furthermore, a number of possible research subjects that could become objective for the application of a functioning transformation system are introduced.

1.1 The global impact of phytoplankton

The climate of the ocean-atmosphere systems is sensitive to variations of the solar constant and the orbital characteristics of the earth. The seas and oceans effect physical atmospheric processes through the global solar radiation budget (reflection) and meridional heat transport (ocean currents, e.g. Gulfstream), and through the trace gas composition of the atmosphere (Holligan, 1992).

(15)

However, the properties of oceans surface waters and that of the marine atmosphere are modified also by the optical and biochemical properties of marine organisms, in particular, the phytoplankton (Brierley & Kingsford, 2009).

Biological processes such as phytoplankton photosynthesis contribute to the absorption of atmospheric CO2 in the ocean which lowers the partial pressure of CO2 in the upper ocean. The absorption of CO2 from the atmosphere is thereby promoted, which keeps atmospheric CO2 concentrations significantly lower than they would be if all the phytoplankton in the ocean were to die (Falkowski et al., 2000).

CO2 is incorporated into organic matter by phytoplankton of which much is rapidly re-oxidized within the euphotic zone. However, a small proportion (~10%

of net primary production) is transferred to deep water and the sediments, so that an atmosphere-to-deep water gradient in CO2 concentration is maintained, which represents the organic carbon pump (Holligan, 1992).

In addition to the organic carbon pump, several phytoplankton and zooplankton species form CaCO₃ shells that sink into the interior of the ocean, where it is partly dissolved and partly stored in the geological archive (Westbroek et al., 1993). This inorganic carbon cycle leads to a reduction in surface ocean dissolved inorganic carbon (DIC) relative to the deep ocean and is therefore sometimes called the “carbonate pump”. However, it can be predicted that the sink strength will almost certainly weaken (Falkowski et al., 2000) due to increasing anthropogenic release of CO2 in the atmosphere.

Lovelock et al. (1972) first suggested, that DMS is the natural sulphur compound that transfers sulphur from the seas through the air to land surfaces and is therefore considerable important in the global sulphur cycle. The major precursor of DMS is dimethylsulphoniopropionate (DMSP), a compatible solute found in various groups of marine algae (Steinke et al., 2002). Enzymatic cleavage by DMSP lyase (dimethylpropiothetin dethiomethylase) is thought to be the major process for DMS production in marine environments. DMSP lyase isozymes have been found in various marine organisms (Wolfe, 2000, Steinke et al., 2002, Steinke et al., 1998). DMS excreted by most species of phytoplankton escapes to the air where it reacts to form a sulphate and methane sulphonate aerosol (Shaw,

(16)

1983). These aerosol particles act as cloud-condensation nuclei (CCN) in the marine atmosphere (Charlson et al., 1987).

The term “phytoplankton”, coined in 1897, describes a diverse, polyphyletic group of mostly single-celled photosynthetic organisms that drift with the currents in marine and fresh waters. Although accounting for less than 1% of earth’s photosynthetic biomass, these microscopic organisms are responsible for more than 45% of our planet’s annual net primary production. Whereas on land, photosynthesis is dominated by a single clade (the Embryophyta) containing nearly 275,000 species, there are fewer than ~25,000 morphologically defined forms of phytoplankton; they are distributed among at least eight major divisions or phyla (Falkowski et al., 2004, Field et al., 1998).

1.1.1 The coccolithophore Emiliania huxleyi

The major taxonomic groups of phytoplankton, such as diatoms and colonial algae (e.g. Phaeocystis), are prevailed by coccolithophores, the dominant calcifying group of phytoplankton (Holligan, 1992). The coccolithophores belong to the division Haptophyta (also known as prymnesiophytes) (Jordan & Green, 1994), a group of biflagellates, generally found in marine habitats, with a yellow-brown pigmentation (Westbroek et al., 1993). Haptophyte cells are usually covered with organic scales which are formed intracellularly. These calcified scales, called

"coccoliths", have highly elaborate shapes, and the "coccosphere" surrounding a single cell may harbour types with different morphologies. Coccolithophores are most abundant in the open ocean, where they sometimes outnumber all other types of phytoplankton (Castro et al., 1997). In the present ocean about 150 coccolithophore species are known (Westbroek et al., 1993).

The coccolithophore Emiliania huxleyi (Lohmann) Hay and Mohler (Fig. 1) is one of the most abundant and widely distributed photosynthetic unicellular eukaryotes in modern oceans.

E. huxleyi was first described from ocean sediments about 270,000 years old and is thought to have appeared first in the tropics and subsequently spread to higher latitudes (Thierstein et al., 1977). E. huxleyi is considered to be the world's major producer of calcite (Westbroek et al., 1985). Not only its coccoliths, but also a

(17)

suite of organic biomarkers (long-chain alkenones and alkyl alkenoates) provide a highly characteristic record in the sedimentary archive (Westbroek et al., 1993). It is recognized to be an important factor in determining the exchange of CO2

between the oceans and the sediments (Dymond & Lyle, 1985). Steinke et al.

(2002) hypothesise that E huxleyi is the most important producer of DMS in a typical North Atlantic coccolithophore bloom and, hence, would contribute most of the DMSP lyase activity.

Figure 1: Scanning electron microscope image of the coccolithophore Emiliania huxleyi (Langer et al., 2006).

E. huxleyi occurs in all oceans except for the polar waters (Brand, 1994, Winter &

Siesser, 1994, Paasche, 2002, Marsh, 2003) and typically accounts for 20-50% of the total coccolithophore community in most oceanic areas (McIntyre & Bé, 1967). With its diameter of 5-10 µm E. huxleyi is one of the smaller coccolithophores. At one stage of its life cycle the cell is covered with one or several layers of heterococcoliths, 2-4 µm long and consisting of calcite and macromolecular organic material. Not only these non-motile diploid coccolith- bearing cells (C-cells), but also naked cells (N-cells) and motile, haploid scale- bearing cells (S-cells) participate in the life cycle of this species (Klaveness, 1972, Laguna et al., 2001). N-cells are morphologically very similar to C-cells, but do not calcify (Klaveness & Paasche, 1971). The S-cells possess two cilia and are covered with organic scales formed in the cisternae of the Golgi apparatus (van der Wal et al., 1985).

(18)

1.1.2

Emiliania huxleyi blooms

The coccolith-producing E. huxleyi is known for its formation of extensive ocean blooms with concomitant production of large amounts of DMS. Coccoliths, which readily reflect light, and DMS, which enhances cloud formation, contribute to increased albedo and thus have a cooling influence on the climate (Graham et al.

2000). Maximum concentrations of E. huxleyi of values as high as 1.2*10⁷cells L^-1 have been recorded (Berge, 1962). Coccolithophore blooms reach their greatest seasonal mean annual total of 6.3*10⁵ km² in the subarctic North Atlantic (Westbroek et al., 1993).

Figure 2: E. huxleyi summer bloom off the coast of Cornwall.

The reflexion of the sunlight is especially promoted by the detached coccoliths.

(http://www.sanger.ac.uk/Info/Press/gfx/050811_bloom.jpg)

Light scattering by coccoliths represents a special case of biological effects on surface ocean optics, with values for sub-surface reflectance exceeding 30%

(Balch et al., 1991) compared to 3-5% in the absence of coccoliths. With the density of coccoliths beyond 3*10⁵ mL^-1 within blooms of E. huxleyi, extreme conditions for biological warming and shallowing of the mixed layer are predicted (Kirk, 1988).

Termination of these blooms is accompanied by massive release of organic and inorganic matter to the water column, including detached coccoliths that reflect sunlight and are readily detectable in satellite images (Tyrrell & Merico, 2004) (Fig. 2).

(19)

1.1.3 Bloom termination by viruses

Zooplankton grazing, physical wash-out and light or micronutrient limitation are some factors that are responsible for the termination of natural phytoplankton blooms (Westbroek et al., 1993). Many eukaryotic algae, however, are known to be infected by viruses (Hallmann, 2007). E huxleyi from marine nanoplankton samples have been reported to contain viral particles approximately 200 nm in diameter (Manton & Leadbeater, 1974).

Several studies have investigated the role of viruses in controlling the bloom development of E. huxleyi (Bratbak et al., 1993, Bratbak et al., 1995, Brussaard et al., 1996, Wilson et al., 1998, Wilson et al., 2002b, Wilson et al., 2002a). These investigations clearly showed that viruses are responsible for the decline of E. huxleyi blooms. In some cases, viral lysis could account for 25 to 100% of the net mortality of E. huxleyi (Brussaard et al., 1996).

Wilson et al. (2002b) isolated two viruses from a dying E. huxleyi bloom in the Western English Channel and revealed that they were lytic viruses approximately 170 nm – 190 nm in diameter having an icosahedral symmetry. Phylogenetic analysis places one of these two viruses (EhV-86) in a new genus (Coccolithovirus) within the family Phycodnaviridae (Schroeder et al., 2002).

Several genomes of these algae infecting dsDNA viruses have been sequenced (Van Etten et al., 2002).

Regulated programmed cell death processes have been documented in several phytoplankton species and are hypothesized to play a role in population dynamics.

The mechanisms leading to the coordinated collapse of phytoplankton blooms are, however, poorly understood (Vardi et al., 2007). Wilson et al. (2005) postulated that the sphingolipid biosynthesis pathway (ceramide formation), encoded in the genome of EhV-86, could be implicated in the regulation of apoptosis in infected E. huxleyi cells. Therefore, one theory is that this algal virus encodes a mechanism for inducing apoptosis as a strategy for killing the host cell and disseminating progeny virions during the infection cycle (Wilson et al., 2005).

(20)

1.2 Reverse genetic tools to manipulate gene expression

The ability to switch certain genes of an organism’s genome on or off via reverse genetic tools delivers a valuable tool for the elucidation of certain pathways and allows us to study biochemical processes as well as viral infection mechanisms.

This can be done through knock-out mutants that can be created by the introduction of interfering RNA (RNAi) that is introduced into the cells and acts sequence specifically by silencing genes on the posttranscriptional level. Double-stranded RNA suppresses the expression of a target protein by stimulating the specific degradation of the target mRNA.

The silencing of certain genes by implementation of anti-sense RNA into the host cell can also be achieved using a vector approach. With this strategy, knock-out mutants can be generated by transformation of the host with a vector that expresses anti-sense constructs of the knock-out target genes. In this approach, artificial anti-sense RNA is expressed, leading to complementary sequences to the desired target genes, hence, hybridizing to the target mRNA which prevents it from being translated into protein.

A vector containing a promoter and selection or marker gene in front of a multiple cloning site (MCS) is therefore desired. The gene of interest can then be cloned into the MCS and transformed and expressed in the target organism.

A stable transformation of the microalga E. huxleyi would allow the generation of knock-out mutants e.g. of genes that are expressed during viral infection. The expression of selected virus genes would make it possible to get an insight into the mechanisms of viral infection, including gene-functions or pathways and processes.

1.2.1 Genetic transformation of microalgae

Genetic transformation is a process by which the genetic material carried by an individual cell is altered by the incorporation of foreign (exogenous) DNA into its genome.

The ability to manipulate microalgae via genetic engineering in order to introduce or optimize desired traits will facilitate more extensive exploitation of these organisms since interest in the use of microalgae for research as well as commercial applications has increased in recent years (Dunahay et al., 1995).

(21)

Genetic engineering in several microalgae such as Chlamydomonas reinhardtti (Debuchy et al., 1989, Kindle et al., 1989) and the simple multicellular organism, Volvox carteri (Schiedlmeier et al., 1994), has been carried out successfully (Kathiresan & Sarada, 2009). Genetic transformation (Agrobacterium-mediated, electroporation, biolistic gun, etc.) protocols are being developed and constantly improved for several species such as C. reinhardtii, V. carteri and Chlorella. The full potential of genetic transformation has not been realized for most of the algal species (Travella et al., 2005).

The strongest barrier for foreign DNA to enter cells is the cell membrane that has to be penetrated. Several methods for the introduction of DNA into the nucleus have been reported, including particle bombardment (Debuchy et al., 1989, Kindle et al., 1989, Klein et al., 1987), electroporation (Brown et al., 1991), and agitation with glass beads (Kindle, 1990) or silicon fibers (Dunahay, 1993).

Microparticle bombardment even works for the tough silica cell walls of diatoms and has been performed several times (Dunahay et al., 1995, Apt et al., 1996, Poulsen et al., 2006, Kroth, 2007). It is also recommended as the method of choice for the novel transformation of organisms where the protocol may include a number of uncertain experimental issues (Hallmann, 2007).

For a successful transformation, several prerequisites have to be established. An axenic culture is ideal so that after transformation the weakened culture cannot be overgrown by bacteria. Suitable selective agents or markers that can be expressed by the organism and are effective for the organism have to be defined. A vector containing essential parts, such as a promoter, antibiotic resistance or marker gene and a multiple cloning site, has to be designed and created. For the selection of transformed algae, a method must be established or be available that allows for regeneration of the target species from single cells, ideally on agar plates.

1.3 Aim of this work

E. huxleyi is the most abundant coccolithophore and an important member of the marine phytoplankton, whose bloom collapsing has been frequently linked to virus control in the marine environment (Evans et al., 2009, Kegel et al., 2007).

Further studies in order to fully asses the biogeochemical impact of E. huxleyi bloom termination by viruses are therefore desired.

(22)

The creation of a transformation system for E. huxleyi could initiate a series of experiments for the study of viral affliction of the coccolithophore. The mechanisms of DNA introduction into the host cell, the metabolic regulations, especially concerning the ceramide pathways, and induction of metacaspases in the host cell, introducing programmed cell death, could be investigated.

An understanding of the coccolithophore’s single metabolic pathways, like the yet unknown regulation of the microalga’s coccolith-production, could be facilitated.

The aim of this work is to design a novel vector construct for the transformation of the coccolithophore E. huxleyi. This construction has to contain essential components, for successful ongoing studies. An appropriate basic vector (i.e. yield of high copy numbers, containing ori. and resistance gene for the selection of bacterial clones) as starting construction has to be defined. The sequence of an endogenous controllable promoter which would serve best for subsequent transformation experiments has to be determined, isolated, amplified and provided with suitable restriction sites for further works. For the identification of positively transformed clones an E. huxleyi suitable antibiotic resistance and its gene, or an appropriate marker gene, have to be chosen. These genes also have to be amplified with primers providing restriction sites. The final vector should also contain a multiple cloning site that can eventually serve for the insertion of exogenous genes of interest into the target organism. Additionally, prerequisites such as the growth on solid media for further application of this vector should be implemented.

(23)

2. Materials and Methods

There were several tasks to be fulfilled for the conductance of this work. First of all, growth experiments with the coccolithophore Emiliania huxleyi in liquid as well as on solid media under stressed and non-stressed conditions were conducted; second, preliminary work like searching for sequences and preparing essential constituents (e.g. primerdesign) had to be performed; third, single components of this work had to be amplified and prepared; fourth, several cloning experiments for the final preparation of the single sequences and to build the transformation system had to be executed; and finally at last, the biolistic experiment for the possible transformation of E. huxleyi and posttranslational experiments create the end of this thesis.

2.1 Growth experiments

A previous diploma thesis (Strauss, 2008) has shown that the alga E. huxleyi is sensitive only against a few antibiotics. Three of the more harmful antibiotics are G418 s, puromycin, and chloramphenicol. Therefore, growth experiments for the verification of the best suited antibiotic and its concentration were performed. In addition, the resistance of E. huxleyi to the antibiotic kanamycin and its possible enhancement of growth of the alga was to be verified. As standard condition, all growth experiments - both liquid and solid - were incubated at 15°C and at approximately 150 µmol photons m^-² s^-1 in a 16:8 light:dark cycle.

2.1.1 Antibiotic verification in liquid media

E. huxleyi strain CCMP 1516 (Lohmann, 1902, Hay et al., 1967), obtained from the Plymouth Marine Laboratory (Plymouth, UK) was grown in liquid ANT-F/2 medium (Guillard, 1975) according to the previous work of Jan Strauss (2008).

Several conditions following Strauss (2008) were set up in triplicates as shown in Tab. 1.

(24)

Table 1: Used antibiotics and their applied concentrations.

Antibiotic Concentration

Kanamycin 500 – 1000 µg/mL

G418 500 µg/mL

Puromycin 50 µg/mL

Chloramphenicol 100 µg/mL

Each condition contained kanamycin plus the antibiotic stated in Tab. 1. The cultures were inoculated with 10*10³ cells/mL.

2.1.2 Determination of the growth rate

To determine cell density and size spectrum, the cell count was performed with a Multisizer Coulter Counter (Beckmann Coulter GmbH, Germany).

Culture flasks were gently shaken as to detach settled cells from the bottom and ensure homogenous suspension of the cells before sampling. Cultures with densities above 20*10³-30*10³ cells/mL were diluted with ANT-F/2 to a volume of 20 mL from which the Coulter Counter used 500 µ L for analysis of the probe.

Dilution factors from 2-400 were used since the Coulter Counter measures most accurate between 10*10³-20*10³ cells/mL.

For cultures showing a typical growth curve, the relative growth rate was determined using the following formula:

0

ln 0

ln t t

N µ N^t

−

= −

with µ = relative growth rate

Nt = cell counts [cells/mL] at time t N0 = cell counts [cells/mL] at time 0 t = time t [d]

t0 = time 0, starting time

(Schlegel, 1992)

(25)

2.1.3 Growth on solid media

First attempts of growth experiments on solid media were performed with ANT- F/2 medium and the addition of 1 % Bacto Agar (Becton, Dickinson and Company, USA). The media were autoclaved before adding 1 mg/mL kanamycin and one of the three antibiotics (G418, puromycin, chloramphenicol) using the same concentrations as in liquid media. Enough plates were poured so that three replicates of each condition (untreated, containing only kanamycin, and plates containing kanamycin plus one of the three selective antibiotics) could be examined. These plates were inoculated with 500 µ L culture at a concentration of 10*10³ cells/mL. For two hours the plates were incubated in upright position for the culture volume to integrate into the agar medium and then turned upside down.

However, as stated in Laguna et al. (2001) ANT-F/50 medium was used for further experiments. 1.5 % Bacto Agar was added before, and supplement of nutrients, vitamins and antibiotica after autoclaving. Plates with F/50 medium (containing ¹/25 supplements of F/2 medium) were inoculated with different volumes containing a dilution series of 50*10³ to 1*10³ cells in total.

2.2 Preliminary work

Before cloning experiments could start, some basic questions had to be answered.

An optimal cloning vector, its availability and the right sequences for a suitable promoter were investigated. The primer design and amplification as well as preparation of the single components for the vector were accomplished.

2.2.1 Selection of a suitable vector

Amongst miscellaneous opportunities, it was decided to select a plain basic vector (such as pUC18/19, pBlueskript, or pGEM-T), containing a suitable promoter, selection gene for bacteria and a multicloning site (MCS) as a start. The basic construct should be modified by cloning an E. huxleyi-suitable promoter and marker or selection gene into this vector. For this purpose, the available pUC18 vector (provided by M. Lucassen, Alfred-Wegener Institute, Bremerhaven) was chosen.

(26)

Figure 3: pUC18 vector (2686 bp) as a basic vector to be modified for later transformation of E. huxleyi.

The MCS shows restriction sites with red boxes, that are suitable to insert promoter, resistance gene, and marker gene. Resistance against ampicillin (AmpiR encoded by the bla gene), the

β-galactosidase (b-lactam), and the ori. from ColE1 are indicated.

Fig. 3 shows the pUC18 vector with restriction sites in the MCS and their position in the vector. Enzymes marked with a $ before their name indicate an enzyme that generates blunt ends which are unsuitable for directional cloning.

(ANGERSLOUSTAU, 2007). Enzymes that were selected for the cloning strategy are depicted with red boxes.

The location of the β-galactosidase gene in the MCS facilitates the selection of positively transformed clones by blue-white screening. This works because the amino- and carboxyl domains of β-galactosidase need not be carried on the same molecule to generate β-galactosidase activitiy. Instead, two inactive fragments of the polypeptide chain, one lacking the amino-terminal region (the α-acceptor) and the other the carboxy-terminal region (the α-donor), are able to associate both in vivo and in vitro to form a tetrameric active enzyme. This unusual form of complementation, called α-complementation, is widely used in molecular cloning to monitor insertion of foreign DNA sequences into vectors encoding the amino- terminal (α-donor) fragment of β-galactosidase (Sambrook & Russell, 2001). In order to be able to perform directional cloning, two restriction enzymes need to be chosen that do not generate the same overhangs. Additionally, they should not cut

(27)

the resistance gene, the marker gene, or the promoter, and perform under similar conditions to be able to conduct a double digest, employing both enzymes in one reaction.

2.2.2 Promoter search

A promoter characterizes a sequence situated upstream of a gene that indicates the beginning of a transcription site. This sequence is needed for the RNA- polymerase to recognize the starting point of the transcription of a gene.

Known sequences of FCP (fucoxanthin chlorophyll a/c-binding protein), HSP60 and HSP70 proteins (heat shock proteins) of related species such as Thalassiosira pseudonana (a diatom) or Phaeodactylum tricornutum (another diatom) – or others – were looked up at NCBI. These sequences were blasted (Altschul et al., 1990) against the E. huxleyi proteome accessed at the jgi (joint genome institution) homepage (http://genome.jgi-psf.org/Emihu1/Emihu1.home.html).

Found hits were screened for a “good” E-value (expectation value) which indicates the number of different alignments with scores equivalent to or better than the found hit that are expected to occur in a database search by chance (http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/glossary2.html). Meaning, the lower the E-value, the more significant the score – so E-values smaller than E^-20 were considered.

A similar starting point, compared to closely related species that are shown at the jgi BLAST page, and a definite start of translation (startcodon ATG) in the nucleotide sequence were important. The protein IDs and 500 bp upstream the translation starting point were copied into a separate text-file for the found fcp, hsp60, and hsp70 gene sequences respectively and saved. An alignment of these sequences using clustalW was performed (Larkin et al., 2007). Subgroups that show more similarities (homologies) could visually be identified using the program clustalX. It seemed that some patterns occured in several sequences that were not aligned by the alignment program clustalW. Some subgroups of sequences showing similar patterns were aligned and compared visually (data not shown).

However, since for persistent expression of the selection gene a high expressing promoter is necessary, sequences of high expressed ESTs (Kegel et al., in press) were blasted against the jgi E. huxleyi genome database. The found sequences

(28)

were compared to the previously inspected putative promoter sequences and the one possessing the protein ID 460117 (EVC02389) was chosen to be amplified.

For the investigation of a termination signal, the same procedure can be followed.

2.2.3 Primer design

Three vectors, containing the resistance genes against G418, puromycin, and chloramphenicol were ordered. These three genes should be amplified out of the vector and then cloned into the pUC18 vector. Using the online source primer3 resulted in primers that did not directly start and end enclosing exclusively the desired sequences. Primer3 results led to too many basepairs between promoter and resistance gene. Primers for the putative promoter sequence, the resistance neo (expressing resistance against G418), and the marker gene egfp (coding for an enhanced green fluorescence protein), were therefore created manually. It was also attempted to create primers that include desired restriction sites in their sequence which was not always possible. Thus modifications to some primers were done such that the restriction sites of the chosen restriction enzymes were added at the 5’ end plus 4 to 5 bp, resulting in the primer sequences stated in the following table:

Table 2: Designed primers containing suitable restriction sites for the amplification of the promoter region, resistance gene neo, and marker gene egfp.

Sequences in red and italics indicate wanted restriction sites of future utilized restriction enzymes:

EcoRI for FPrf, SacI for FPrr, BamHI for G418f, XbaI for G418r, SalI for GenSalf, and PstI for GenPstr. Bold letters designate start and end point of transcription sites. Mismatches of primers

with the target sites that had to be taken into account are not underlined.

Name Sequence Tm

[°C]

Length [bp]

FPrf 5’ ACACAGAATTCTGTGTGGCTTGAG 3’ 61.0 24

FPrr 5’ TTAAGAGCTCGGTGAGGAAGGAG 3’ 62.4 23

G418f 5’ TATAATAGGATCCACTATAGGAGG 3’ 57.6 24

G418r 5’ AGACAGCGAGCTTCTAGATTTAG 3’ 58.9 23

GenSalf 5' TATACGTCGACATGGTGAGCAAGGGCGAGGAG 3' 72.1 32 GenPstr 5' ATACACTGCAGCTTTACTTGTACAGCTCGTCCAT

GCCG 3'

72.7 38

(29)

Results of primer3 also reveal information about possible secondary structures among the primers that could be formed. Since primer3 was not used, this check had to be done in RNAcofold to exclude potential primer dimer, hairpin loops and other secondary structures.

2.2.4 DNA isolation

Genomic DNA from E. huxleyi was isolated using DNeasy Plant Mini Kit (Qiagen, Germany). A culture grown to late exponential or steady state phase was allocated into 50 mL tubes, centrifuged for 15 min at 4000 rpm. The supernatant was discarded, the pellet resuspended in 1.5 mL medium, allocated into 2 mL tubes, centrifuged for 5 min at 10000 rpm, and the supernatant was discarded again. Then given instructions in the Qiagen manual were followed. For short term storage the DNA was kept at 4°C or frozen at -20°C for long term storage.

Utilized material and equipment is listed in the appendix.

2.2.5 Preparation of backups

The transformation of Escherichia coli TOP10 cells is vital for long term storage and for the production of vector from a positive selected clone containing the desired feature. For the preparation of backups, the used material and equipment is listed in the appendix.

2.2.5.1 Generation of electrocompetent cells

To generate purchased vector and also for the further course of this work electrocompetent E. coli (TOP10) cells were prepared according to the following protocol.

5 mL LB medium with a concentration of 200 µg/mL streptomycin were incubated over night with E. coli TOP10 cells. The over-night culture was completely transferred into a 500 mL Erlenmeyer shaking flask containing prewarmed 200 mL LB medium. The culture was grown to an OD540 = 0.5 – 0.7.

It was then aliquoted into four prechilled 50 mL tubes and kept on ice for at least 15 min. The tubes were centrifuged under the same conditions in each step

(30)

(4000 g, at 2°C, for 15 min.). After centrifugation the pellets were resuspended carefully in 40 mL Washing Buffer each and centrifuged again. The pellets were resuspended in 20 mL Washing Buffer each, joined into two tubes and centrifuged. The pellets were resuspended in 10 mL Washing Buffer, joined into one tube and centrifuged. The pellet was now resuspended in 700 µ L Suspension Buffer which was aliquoted in 40-50 µ L aliquots into prechilled kryo vials. These were shock frozen in liquid nitrogen, and the electrocompetent cells were stored at -80°C.

2.2.5.2 Transformation of electrocompetent cells

The transformation of electrocompetent cells was performed with a Gene Pulser Xcell Electroporator (BioRad, USA). A variable amount of ligation reaction (0.5 µ L up to 2 µL) or vector (0.5 µ L) was added to 40-50 µL of electrocompetent E. coli, stirred carefully with the pipette tip, and then transferred into the 1 mm quartz electroporation cuvette. The cells were transformed at 1.8 kV, 25 µF, and 200 Ω. 0.5 mL prewarmed LB-medium was quickly added to the cells, and then transferred into a 2 mL tube containing 1 mL LB-medium in total. The cells were allowed to express their newly added feature (i.e. antibiotics resistance) while incubating at 37°C for one hour. A variable amount of 40 µL up to 100 µ L was spread on an agar-plate that contained 100 µ g/mL of the suitable antibiotic (ampicillin). If blue-white screening was planned, 16 µL X-Gal (promega, USA) (+40 µ L LB-medium) were spread onto the plate with a Drigalski spatula.

The plates were incubated over night at 37°C. On the next day, 5 mL liquid LB- medium containing ampicillin were inoculated with clones picked from the plates and incubated on a shaker at 37°C over night.

2.2.5.3 Plasmid preparation

Positive selected clones that contain plasmids with inserts were isolated from their host using the QIAprep Spin Miniprep Kit (Qiagen, Germany). The preparation was performed according to the instructions given in the manual.

(31)

2.3 PCR reactions for amplification

PCR reactions for the amplification of the single cloning components were performed. Primers (listed in Tab. 2) were generally used at a concentration of 10 µM for amplification reactions. In the following the single PCR reactions are described. The reagents and equipment that was used for the PCR reactions is listed in the appendix.

2.3.1 Amplification of the promoter

Several conditions were tested to optimize the amplification of the promoter region (Protein ID: 460117) from genomic E. huxleyi DNA. The addition of 5%

DMSO which prevents sequences from forming secondary structures, and 1 M betaine that also facilitates strand separation was necessary (Frackman et al., 1998). The following PCR setup for a 25 µ L reaction was finally used:

Table 3: Final PCR setup for the amplification of the E. huxleyi promoter region from genomic DNA

Substance Amount

Molecular grade H2O ad 25.0 µ L

5Prime Mastermix 10.0 µ L

DMSO 1.25 µ L

5M Betain 5.0 µ L

Primer FPrf 1.0 µ L

Primer FPrr 1.0 µ L

Sample DNA at least 100 ng

The PCR temperature program shown below was used for the promoter amplification:

(32)

Table 4: PCR program for the amplification of the E. huxleyi promoter region from genomic DNA

Temperature Time

94°C 5 min

94°C 30 s

56°C 30 s 35 cycles

72°C 1 min

72°C 10 min

4°C forever

2.3.2 Amplification of the resistance gene

The vector pSELECT (InvivoGen, Germany) served as a template for the amplification of the resistance gene neo that expresses resistance against the antibiotic G418. A temperature gradient PCR was performed from 51.0 to 57.8°C with the following PCR setup and thermocycler program:

Table 5: PCR setup for the amplification of the resistance gene neo from plasmid DNA.

Molecular Grade H2O ad 25.0 µ L 5Prime Mastermix 10.0 µ L Primer G418f 1.0 µ L Primer G418r 1.0 µ L Sample DNA 200 ng

The following table shows the PCR temperature program that was used to amplify the resistance gene neo.

(33)

Table 6: PCR program for the amplification of the resistance gene neo from plasmid DNA.

94°C 5 min

94°C 30 s

72°C 1 min

72°C 10 min

4°C forever

2.3.3 Amplification of the egfp gene

The green fluorescence protein gene (gfp) is broadly used as a marker for the verification of transformation reactions. The fluorescence of positively transformed clones can easily be observed under the fluorescence microscope. A modification of this gene – enhanced fluorescence green protein (egfp) – has already been employed in the available pPha-T1 vector (provided by J. Strauss) for the transformation of P. tricornutum from which it could easily be amplified.

Table 7: PCR setup for the amplification of the egfp gene from plasmid DNA.

Molecular Grade H2O ad 25.0 µ L

5Prime Mastermix 10.0 µ L

Primer GenSalf 1.0 µ L

Primer GenPstr 1.0 µ L

Sample DNA 1.0 µ L (unknown conc.)

The temperature program for the amplification of the egfp gene is shown in the following table.

(34)

Table 8: PCR program for the amplification of the egfp gene from plasmid DNA.

94°C 5 min

94°C 30 s

72°C 1 min

72°C 10 min

4°C forever

2.3.4 PCR product analysis

For the analysis of PCR products an agarose gel electrophoresis was run as described below using the material and equipment stated in the appendix.

Concentration measurements were performed with a NanoDrop – Spectro- photometer (Peqlab Biotechnologie GmbH, Germany) using 1-2 µ L of the sample.

2.3.5 Gel electrophoresis

PCR products were analyzed in a 1% agarose gel with the addition of 0.01‰

ethidium bromide in the gel. For gel extraction purposes, DNA was visualized by the addition of the dye SYBR Green to the samples in a ratio of 1:5. The gel extraction was performed with the MinElute Gel Extraction Kit (Qiagen, Germany) according to the instructions in the manual.

2.3.6 Processing of PCR products

For further processing of the PCR products it is useful to clone them into a TOPO vector. It is then easy to amplify sufficient, clean product by growing bacteria.

The desired product can be cut out using the induced restriction sites, which are verified at the same time.

The 5Prime Hotmastermix used in the PCR reactions for amplification contains a Taq DNA polymerase that adds an additional A to the end of the product resulting in an A-overhang. This overhang can be used to clone the PCR product into a pCR4-TOPO vector which is already provided linearized having a T-overhang

(35)

(TOPO TA Cloning Kit for Sequencing, pCR4-TOPO vector, InvitroGen, Germany). For this procedure, fresh PCR product is recommendable, since the additionally added A at the ends of a PCR product is quite fragile and likely to break off after some time. The ligation protocol for electrocompetent cells provided in the manual was followed and a Fast-plasmid-screening (see next section) was performed to check whether the picked clones contain an insert.

Sequencing PCRs were conducted as described in 2.4.3.1 to verify the sequence of the single cloned DNA fragments.

2.3.6.1 Fast screening for plasmids with insert

If a great number of clones were picked, a fast screening of the clones for plasmids containing an insert was performed so not each clone had to be prepped.

This was done by mixing 5 µ L of Suspension buffer with 5 µ L of Lysis buffer.

10 µ L of the over-night culture was added to the mix and incubated at 99°C for 5 minutes. 3 µ L loading dye were added to the mix which was applied onto a 1%

agarose gel containing 0.01‰ ethidium bromide. As a positive control, the original plain vector was applied to the gel as well, thus a size difference between vectors containing an insert and vectors that do not is notable.

For buffer contents and equipment that was used see appendix.

2.4 Cloning into pUC18

Six restriction sites in the pUC18 MCS were chosen to ligate the promoter region, the resistance gene and the marker gene into the vector (see Fig. 3). For the putative promoter EcoRI and SacI, for the neo gene BamHI and XbaI, and for the marker egfp SalI and PstI were selected. A schematic drawing of the assembly of the single components is illustrated below.

(36)

Figure 4: Assembly of single cloning fragments.

Restriction sites used for incorporation of the fragments into the vector and disturbing sites within the fragments are shown. Numbers indicate the predefined order of cloning.

It was realized that the resistance gene also contained a restriction site for SacI and the promoter one for PstI. With this knowledge, some restrictions arose. The cloning order would have to be first cloning the marker egfp, then the putative promoter and at last the resistance gene. However, after theoretical alignment of the sequences and looking at the reading frame it was realized that the open reading frame was interrupted and translation into the wanted amino acid sequences could not be sustained. Two transformation vectors were to be created, one containing the putative promoter and the resistance gene, the other with the promoter region and the marker gene. Two transformation experiments were planned. In one, the vector with the resistance selection should be used and in another experiment both vectors should be mixed and transformed at once (personal communication with A. Gruber, University of Constance).

2.4.1 Restriction digestion

For the restriction digestion, a 25 µ L reaction setup was performed as described in the following. Material and equipment was used as stated in the appendix.

(1) (3) (2)

PstI SalI

744bp egfp

XbaI BamHI

823 bp neo

SacI EcoRI 500 bp putative promoter SacI

PstI

(37)

Table 9: Reaction setup for restriction digestions.

Buffer 2.5 µ L

Restriction enzyme 0.5 µ L each

DNA approx. 500 ng

BSA (as required) 0.25 µ L Molecular Grade H2O ad 25 µ L

The reaction was incubated at 37°C for at least one hour in the heating block or thermocycler.

The restriction digests were purified in a 1% agarose gel stained with SYBR green (see 2.3.5) and extracted from the gel using the MinElute Gel Extraction Kit (Qiagen, Germany). The amount of the extracted DNA fragments was determined running 2 µ L of the extract and 1 µ L loading dye on another 1% agarose gel assessing the amount of DNA by comparison of the sample bands with the DNA size marker bands peqGOLD DNA-Leiter Mix (peqlab, Germany) of known quantity.

2.4.2 Ligation reaction and dephosphorylation

The ligation was carried out using T4 DNA Ligase, provided with 5xDNA Ligase Reaction Buffer (Invitrogen life technologies, Germany). The reaction was run at 15°C over night using the following set up:

Table 10: Reaction setup for ligation.

Ligation buffer 4.0 µ L

T4 DNA ligase 1.0 µ L

Insert:Vector 3:1 (at least 3 fmol:1 fmol) Molecular Grade H₂O ad 20 µ L

After the ligation reaction, 0.5 µ L Calf Intestinal Alkaline Phosphatase (CIAP), provided with 10x Dephosphorylation Buffer and Dilution Buffer (Invitrogen life

(38)

technologies, Germany) was optionally added to the digested pUC18 vector reaction in order to prevent religation of the vector. Since the vector was cut with two different restriction enzymes, it should not religate.

The transformation was performed as described in 2.2.5.2, varying the amount of ligation reaction volume added to the electrocompetent TOP10 cells from 0.5 µ L up to 2 µ L.

2.4.3 PCR for sequence verification

PCRs for sequencing verification were performed during several steps of cloning to verify the achieved sequences. After the transformation of E. huxleyi, recovery experiments of plasmid sequences were also conducted.

2.4.3.1 Sequencing PCRs

M13 primers (stated in Tab. 11 below) which are general primers, encompassing the insert of the TOPO as well as of the pUC18 vector, were used for sequencing PCRs. The primers were employed at 1 µM for sequencing PCRs.

Table 11: Sequences of M13 primers used for sequencing.

Name Sequence Length [bp]

M13f 5’ [AminoC6]GTAAAACGACGGCCAG 3’ 16

M13r 5’ CAGGAAACAGCTATGAC 3’ 17

The sequencing PCR reactions were performed using the Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) and were purified using the DyeEx 2.0 Spin Kit (Qiagen, Germany) prior to further analysis.

The following reaction setup was used:

(39)

Table 12: Reaction setup of a sequencing PCR using M13 primers.

Nucleotide Premix 1.0 µ L 5x Sequencing Buffer 1.5 µ L M13 Primer forward or reverse 1.0 µ L

Sample DNA 100 ng

Molecular Grade H2O ad 10.0 µ L

The temperature program in Tab. 13 was used for sequencing PCRs.

Table 13: PCR temperature program used for sequencing PCRs.

96°C 1 min

96°C 10 s

52°C 5 s 30 cycles

60°C 3 min

4°C forever

2.4.3.2 Sequence recovery experiments

M13 and G418 forward and reverse primers were used after biolistic transformation of E. huxleyi to see whether the culture contained the constructed vector PnpUC clone 7. For this purpose a different polymerase (Finnzyme, Phusion High Fidelity DNA Polymerase, New England Biolabs, USA) was used since it performs with higher specificity for high complexity templates. 5%

DMSO and 1 M betaine was also added to the reactions to improve the performance. All primers were used at a concentration of 10 µM with the following PCR setup and temperature programs:

(40)

Table 14: PCR setup for PnpUC (7) sequence recovery.

Molecular Grade H₂O ad 25.0 µ L 5x Phusion HF Buffer 5.0 µ L

10 mM dNTPs 0.5 µ L

Forward primer 1.0 µ L

Reverse primer 1.0 µ L

DMSO for 5 % 1.25 µ L

5 M Betain 5.0 µ L

Phusion DNA Polymerase 1.0 µ L

Sample DNA 1.0 µ L

Table 15: PCR temperature programs for PnpUC (7) sequence recovery with M13¹ and G418² primer pairs using High Fidelity Phusion DNA Polymerase.

98°C 30 s

98°C 10 s

65°C¹ / 51°C² 30 s 35 cycles

72°C 30 s

72°C 10 min

4°C forever

2.5 Transformation of the microalga

The transformation of the microalga E. huxleyi was the final step in this work for the verification of the functioning of the constructed vector PnpUC(7).

2.5.1 Preparation of the cells

An E. huxleyi culture was grown in ANT-F/2 containing kanamycin to eliminate bacterial contamination under conditions stated in 2.1. After microscopical inspection of the culture, it was transferred to plain ANT-F/2 medium. The cells were counted and harvested in the exponential phase by centrifuging them in 50 mL tubes at 3000 g for 1 min. The cells were resuspended in ANT-F/2 so that

(41)

100 µ L contained approx. 3.9*10⁷ cells which were spread with a Drigalski- spatula onto the centre of ANT-F/50 Agar plates on the day before bombardment.

2.5.2 Preparation of the DNA

The created transformation vector PnpUC clone 7 was prepared in large quantities using QIAprep Spin Miniprep Kit (Qiagen, Germany) and increasing concentrations using Microcon Centrifugal Filter Devices, Ultracell YM-30 (Millipore, Germany). Approximately 5 µg DNA in 5 µ L were added to 50 µ L goldparticle (processed according to Kroth, 2007), 50 µ L 2.5 M CaCl₂ and 20 µ L 0.1 M spermidine (Sigma, Germany). This mix was vortexed for 1 min. at RT, shortly centrifuged, the supernatant was discarded and the pellet resuspended in 250 µ L ethanol (100%). The suspension was vortexed again, centrifuged and the pellet was resuspended in a final volume of 50 µ L ethanol of which 10 µ L was needed for each shot with the particle gun.

2.5.3 Biolistic bombardment

Biolistic particle delivery is a method of transformation that uses helium pressure to introduce DNA-coated microcarriers into cells. Particle delivery is a convenient method for transforming intact cells in culture since minimal pre- or post- bombardment manipulation is necessary (BioRad manual, 1996). The equipment of the biolistic device was prepared and the bombardment performed according to the manual instructions.

2.6 Posttransformational treatment

After bombardment onto the ANT-F/50 agar plates, the cells remained on the unselective plates at standard culture conditions (see 2.1) for them to allow expression of the desired feature (resistance against G418) over night. Cells of all five plates were scraped off with a Drigalski-spatula into 100 mL ANT-F/2 liquid medium provided with 500 µg/mL G418. This culture was allowed to grow for roughly two weeks until it was investigated microscopically. Half of the culture was plated onto ANT-F/50 plates with and without G418, the other half

(42)

transferred into fresh ANT-F/2 liquid medium containing 500 µ g/mL kanamycin and 500 µg/mL G418.

(43)

3. Results

3.1 Growth experiments

Culturing experiments were conducted to understand the growth behaviour of E. huxleyi in unselective and selective liquid media, as well as unselective solid media. This is important for future transformation experiments with the microalga.

3.1.1 Growth in liquid media

In selective liquid media conditions according to Strauss (2008), the antibiotics puromycin, chloramphenicol and G418 were utilized. As can be seen in Fig. 5 growth of cultures was inhibited immediately in the presence of G418, chloramphenicol, or puromycin, as opposed to control cultures containing no antibiotics or only kanamycin. Unstressed cultures skip lag phase and directly grow exponentially. They behave very similar, which was also shown in a second growth experiment (data not shown).

1xE+3 1xE+4 1xE+5 1xE+6 1xE+7

0 5 10 15 20

time in days

N cells mL-1

E.hux in ANT-F/2 E.hux + Kanamycin E.hux + Kana + Puro E.hux + Kana + G418 E.hux + Kana + ChloA

Figure 5: Growth curve of E. huxleyi in selective and unselective liquid media with an initial cell count of 10*10³ cells/mL.

Displayed are mean cell counts (n=3). Puro = puromycin, Kana = kanamycin, ChloA = chloramphenicol.

(44)

The exponential phase with a growth rate of µ = 0.84 for the plain E. huxleyi culture in ANT-F/2 and µ = 0.77 for E. huxleyi with kanamycin lasted about 9-10 days. A maximum cell count was reached with the culture containing kanamycin at day 11 having 7.4*10⁶ cells/mL. Growth of cultures treated with the antibiotics puromycin, chloramphenicol, or G418 was inhibited. The measured number of cells in these cultures, however, remained static and was more or less equivalent to the initial cell count. For stressed cultures the cell count measurement was stopped after 12 days and for unstressed cultures after 16 days since a plateau was reached and cultures containing only kanamycin already reduced in number and seemed to die off.

3.1.2 Growth on solid media

According to Laguna et al. (2001) E. huxleyi can be grown on solid F/50 medium.

Using 1.5 % Bacto Agar in ANT-F/50 medium, very small single colonies could be observed after about 3 days. Inoculation of the plates with a dilution series of cells revealed that plating 1000 cells onto a single agar plate resulted in separated single colonies that can be picked to isolate them.

Regrowth experiments in liquid media were performed by scraping cells off the surface of the plates and transferring them into liquid ANT-F/2. Inspections under the microscope showed that the cells regrown from solid media could be identified as E. huxleyi cells (see Fig. 6).

Development of a vector construct for the transformation of the coccolithophore Emiliania huxleyi

Master Thesis